In vitro RNA transcription by the New Jersey serotype of vesicular stomatitis virus. I. Characterization of the mRNA species.

The in vitro RNA synthesis by the virion-associated RNA polymerase of vesicular stomatitis virus (VSV), New Jersey serotype, was compared with that of the serologically distinct Indiana serotype of VSV. The New Jersey serotype of VSV synthesized five distinct mRNA species in vitro, three of which were smaller than the corresponding species synthesized by the Indiana serotype of VSV. These included the mRNA's coding for the G, M, and NS proteins. By hybridization experiments, virtually no sequence homology was detected between the mRNA's of the two serotypes. Despite this lack of overall homology, the 12 to 18S mRNA species of both serotype contained a common 5'-terminal hexanucleotide sequence, G(5')ppp(5')A-A-C-A-G. The signicance of this finding in light of specific interactions between the two serotypes of VSV in vivo is discussed.     

Methyl group analysis of virion-associated high-molecular-weight RNA synthesized in vitro by purified vaccinia virus.

The methylation pattern of virion-associated high-molecular-weight RNA synthesized in vitro by purified vaccinia virus has been determined. Analysis of purified high-molecular-weight RNA synthesized with S-[methyl-3H]-adenosylmethionine and alpha[32P]UTP as precursors gave the following results. (i) Eessentially all molecules contained blocked and methylated structures of the type m7G(5')ppp(5')Gm and m7G(5')ppp(5')Am. (ii) There was no detectable methylation at internal sites. (iii) Under several different conditions of synthesis, the ratio of molecules containing m7G(5')ppp(5')Gm to those containing m7G(5')ppp(5')Am was imilar for both the virion-associated high-molecular-weight RNA and the virion-released 8-12S mRNA.     

Multiple methylated cap sequences in adenovirus type 2 early mRNA.

The methylated constituents of early adenovirus 2 mRNA were studied. RNA was isolated from polyribosomes of cells double labeled with [methyl-3H]methionine and 32PO4 from 2 to 7 g postinfection in the presence of cycloheximide. Cycloheximide ensures that methylation and processing are performed by preexisting host cell enzymes. RNA was fractionated into polyadenylic [poly(A)]+ and poly(A)- molecules using poly(U)-Sepharose, and undergraded virus-specific RNA was isolated by hybridization to viral DNA in 50% formamide at 37 degrees C. Viral mRNA was digested with RNase T2 and chromatographed on DEAE-Sephadex in 7 M urea. Two 3H-labeled RNase T2-resistant oligonucleotide fractions with charges between -5 and -6 were obtained, consistent with two classes of 5' terminal methyl "cap" structures, m7G(5')ppp(5')NmpNp (cap 1) and m7G(5')ppp(5')NmNmpNp (cap 2) (Nm is a ribose 2'-O-methylation). The putative cap 1 contains all the methylated constituents of cap 1 plus Cm. The molar ratios of m7G to 2'-O-methylnucleosides is about 1.0 for cap 1 and 0.5 for cap 2, consistent with the proposed cap structures. Most significant, compositional analysis indicates four different cap 1 structures and at least three different cap 2 structures. Thus there is a minimum of seven early viral mRNA species with different cap structures, unless each type of mRNA can have more than one 5' terminus. In addition to methylated caps, early mRNA contains internal base methylations, exclusively as m6A, as shown by analyses of the mononucleotide (-2 charge) fraction. m6A was present in the ratio of 1 mol of m6Ap per 450 nucleotides. Thus viral mRNA molecules contain two to three internal m6A residues per methyl cap, since there is on the average 1 cap per 1,250 nucleotides.     

Complete sequences of the ribosome recognition sites in vesicular stomatitis virus mRNAs: recognition by the 40S and 80S complexes.

Nucleotide sequences of the ribosome-protected translation initiation sites from the vesicular stomatitis virus (VSV) M and L protein mRNAs have been determined, completing the sequences of the sites from all the VSV mRNAs. A low level of protection at two internal AUG-containing sites in the N mRNA is also described. Small homologies are evident among some of the sites, but there are no obvious features common to all the sites other than a single AUG codon. In contrast, a large homology between the VSV M mRNA site and the alfalfa mosaic virus coat mRNA site (Koper-Zwarthoff et al., 1977) is noted. This homology suggests the existence of a common ancestral gene for these two apparently unrelated viruses. For each VSV mRNA species, the smallest sites protected in either the 40S or 80S initiation complexes are identical. These sites always contained the initiation codon, but only contained the capped 5' end in those mRNAs having the 5' end near the initiation site. If 40S ribosomes bind to the capped 5' end, either they do not protect it from nuclease digestion or the protection is only transitory in some VSV mRNAs. Consideration of the structures of the ribosome binding sites suggests that the differential effects of hypertonic shock on translation (Nuss and Koch, 1976) may be related to the distance between the 5' end of the mRNA and the initiation codon.     

Terminal sequences of vesicular stomatitis virus RNA are both complementary and conserved.

The nucleotide sequences at the 5' and 3' termini of RNA isolated from the New Jersey serotype of vesicular stomatitis virus [vsV(NJ)] and two of its defective interfering (DI) particles have been determined. The sequence differs from that previously demonstrated for the RNA from the Indiana serotype of VSV at only 1 of the first 17 positions from the 3' terminus and at only 2 of the first 17 positions from the 5' terminus. The 5'-terminal sequence of VSV(NJ) RNA is the complement of the 3'-terminal sequence, and duplexes which are 20 bases long and contain the 3' and 5' termini have been isolated from this RNA. The RNAs isolated from DI particles of VSV(NJ) have the same base sequences as do the RNAs from the parental virus. These results are in sharp contrast to those obtained with the Indiana serotype of VSV and its DI particles, in which the 3'-terminal sequences differ in 3 positions within the first 17. However, with both serotypes, the 3'-terminal sequence of the DI RNA is the complement of the 5'-terminal sequence of the RNA from the infectious virus. These findings suggest that the 3' and 5' RNA termini are highly conserved in both serotypes and that the 3' terminus of DI RNA is ultimately derived by copying the 5' end of the VSV genome, as recently proposed (D. Kolakofsky, M. Leppert, and L. Kort, in B. W. J. Mahy and R. D. Barry, ed., Negative-Strand Virus and the Host Cell, 1977; M. Leppert, L. Kort, and D. Kolakofsky, Cell 12:539-552, 1977; A. S. Huang, Bacteriol. Rev. 41:811-8218 1977).     

Methylation of high-molecular-weight subunit RNA of feline leukemia virus.

The high-molecular-weight subunit RNA of feline leukemia virus (Rickard strain) (FeLV-R) was analyzed for the presence of methyl groups. After purification of native 50-60S FeLV-R RNA on nondenaturing aqueous sucrose density gradients. FeLV-R 28S subunit RNA, doubly labeled with [14C]uridine and [methyl-3H]methionine, was isolated by centrifugation through denaturing sucrose density gradients in dimethyl sulfoxide. As calculated from their respective 3H/14C ratios. FeLV-R 28S RNA was methylated to the same degree as host cell poly(A)+ mRNA. When the 28S FeLV-R RNA was hydrolyzed to completion with RNase T2 or alkali, all of the methyl-3H chromatographed with mononucleotides on Pellionex-WAX, a weak anion exchanger. The methyl-labeled material co-chromatographed with 6-methyladenosine if the mononucleotide fraction obtained by Pellionex-WAX chromatography was hydrolyzed to nucleosides by bacterial alkaline phosphatase or with 6-methyladenine if purine bases were released from the mononucleotides by acid hydrolysis. In another experiment in which FeLV-R 28S RNA uniformly labeled with 32P was hydrolyzed and then analyzed by Pellionex-WAX chromatography, all of the 32P label again co-chromatographed with mononucleotides. Thus FeLV-R 28S RNA does not appear to contain a 5' structure, either methylated or nonmethylated similar to those recently reported for cellular and some animal virus mRNA's.     

Methylated nucleotides block 5' terminus of HeLa cell messenger RNA.

Polyadenylylated [poly(A)+] mRNA from HeLa cells that were labeled with [3H-methyl]-methionine and 14C-uridine was isolated by poly(U)-Sepharose chromatography. The presence of approximately two methyl groups per 1000 nucleotides of poly(A)+ RNA was calculated from the 3H/14C ratios and known degrees of methylation of 18S and 28S ribosomal RNAs. All four 2'-O-methylribonucleosides, but only two base-methylated derivatives, 7-methylguanosine (7MeG) and 6-methyladenosine (6MeA), were identified. 6MeA was the major component accounting for approximately 50% of the total methyl-labeled ribonucleosides. 7MeG, comprising about 10% of the total, was present exclusively at the 5' terminus of the poly(A)+ RNA and could be removed by periodate oxidation and beta elimination. Evidence for a 5' to 5' linkage of 7MeG to adjacent 2'-O-methylribonucleosides through at least two and probably three phosphates to give structures of the type 7MeG5'ppp5pNMep- and 7MeG5'ppp5'NMepNmep- was presented. The previous finding of similar sequences of methylated nucleotides in mRNA synthesized in vitro by enzymes associated with virus cores indicates that blocked 5' termini may be a characteristic feature of mRNAs that function in eucaryotic cells.     

Translation and characterization of poly(A)-lacking RNA from lupin root nodules

Total polysomal RNA from yellow lupin root nodules was fractionated by double oligo(dT)-cellulose chromatography. Poly(A)-containing and poly(A)-lacking RNA fractions showed considerable messenger activity in wheat germ and rabbit reticulocyte cell-free systems. The sizing of poly(A)-lacking RNA on sucrose-density gradient gives rise to separation of 14S mRNA from 22-24S mRNA species. A single polypeptide with molecular weight of 22,000 was coded for by 14S mRNA, while two polypeptides with an apparent mol. wt. of 90,000 and 87,000 were the main products of 22-24S mRNA fraction. High concentrations of unfractionated poly(A)-lacking RNA as well as the addition of poly(A) led to preferential synthesis of the 22,000 product. Preliminary results suggest the presence of m7GpppX cap structure at 5' terminus of the separated 14S and 22-24S mRNA species. This comes from the competition experiments with m7GMP and m7GTP as well as from the fact that the poly(A)-lacking RNA preparation was susceptible to methylation by methyl-transferase from vaccinia virus (methylated is the 2'-O-nucleotide adjacent to 7-methylguanosine). Digestion by T1 RNAase of methylated poly(A)-lacking RNA produced two short 5'-terminal oligonucleotides 10 and 17 nucleotides in length.     

Footprinting mRNA-ribosome complexes with chemical probes.

We footprinted the interaction of model mRNAs with 30S ribosomal subunits in the presence or absence of tRNA(fMet) or tRNA(Phe) using chemical probes directed at the sugar-phosphate backbone or bases of the mRNAs. When bound to the 30S subunits in the presence of tRNA(fMet), the sugar-phosphate backbones of gene 32 mRNA and 022 mRNA are protected from hydroxyl radical attack within a region of about 54 nucleotides bounded by positions -35 (+/- 2) and +19, extending to position +22 when tRNA(Phe) is used. In 70S ribosomes, protection is extended in the 5' direction to about position -39 (+/- 2). In the absence of tRNA, the 30S subunit protects only nucleotides -35 (+/- 2) to +5. Introduction of a stable tetraloop hairpin between positions +10 and +11 of gene 32 mRNA does not interfere with tRNA(fMet)-dependent binding of the mRNA to 30S subunits, but results in loss of protection of the sugar-phosphate backbone of the mRNA downstream of position +5. Using base-specific probes, we find that the Shine-Dalgarno sequence (A-12, A-11, G-10 and G-9) and the initiation codon (A+1, U+2 and G+3) of gene 32 mRNA are strongly protected by 30S subunits in the presence of initiator tRNA. In the presence of tRNA(Phe), the same Shine-Dalgarno bases are protected, as are U+4, U+5 and U+6 of the phenylalanine codon. Interestingly, A-1, immediately preceding the initiation codon, is protected in the complex with 30S subunits and initiator tRNA, while U+2 and G+3 are protected in the complex with tRNA(Phe) in the absence of initiator tRNA. Additionally, specific bases upstream from the Shine-Dalgarno region (U-33, G-32 and U-22) as well as 3' to the initiation codon (G+11) are protected by 30S subunits in the presence of either tRNA. These results imply that the mRNA binding site of the 30S subunit covers about 54-57 nucleotides and are consistent with the possibility that the ribosome interacts with mRNA along its sugar-phosphate backbone.     

Positioning of mRNA 3' of the a site bound codon on the human 80S ribosome

Short mRNA analogues carrying a UUU triplet at the 5'-termini and a perfluorophenylazide group at either the N7 atom of the guanosine or the C5 atom of the uridine 3' of the triplet were applied to study positioning of mRNA 3' of the A site codon. Complexes of 80S ribosomes with the mRNA analogues were obtained in the presence of tRNAPhe that directed UUU codon to the P site and consequently provided placement of the nucleotide with cross-linker in positions +9 or +12 with respect to the first nucleotide of the P site bound codon. Both types mRNA analogues cross-linked to the 18S rRNA and 40S proteins under mild UV-irradiation. Cross-linking patterns in the complexes where modified nucleotides of the mRNA analogues were in position +7 were analyzed for comparison (cross-linking to the 18S rRNA in such complexes has been studied previously). The efficiency of cross-linking to the ribosomal components depended on the nature of the modified nucleotide in the mRNA analogue and its position on the ribosome, extent of cross-linking to the 18S rRNA being decreased drastically when the modified nucleotide was moved from position +7 to position +12. The nucleotides of 18S rRNA cross-linked to mRNA analogues were determined. Modified nucleotides in positions +9 and +12 cross-linked to the invariant dinucleotide A1824/A1825 and to variable A1823 in the 3'-minidomain of 18S rRNA as well as to protein S15. The same ribosomal components have been found earlier to cross-link to modified mRNA nucleotides in positions from +4 to +7. Besides, all mRNA analogues cross-linked to the invariant nucleotide c1698 in the 3'-minidomain and to and the conserved region 605-620 closing helix 18 in the 5'-domain.     

Cell-free translation of purified virion-associated high-molecular-weight RNA synthesized in vitro by vaccinia virus.

Virion-associated high-molecular-weight (HMW) RNA synthesized in vitro by purified vaccinia virus particles has been translated in a wheat germ cell-free protein synthesizing system. Purified HMW RNA directs the synthesis of translation products which are identical to the translation products made in response to in vitro-synthesized, virion-released 8 to 12S mRNA. The translation of HMW RNA proceeds exclusively through a 5'-terminal cap-mediated initiation step. Furthermore, only one coding sequence is translated per HMW RNA molecule, and that sequence is probably located near the 5' end of the molecule. These conclusions are based on the following results. (i) Sodium dodecyl sulfate--polyacrylamide gel electrophoresis patterns of translation products synthesized in response to HMW RNA and in response to 8 to 12S mRNA were qualitatively identical. (ii) On an equal weight basis, HMW RNA was 25 to 30% as active as 8 to 12S mRNA in stimulating in vitro protein synthesis. (iii) Unmethylated HMW RNA was translated at 10% the efficiency of the methylated form of this RNA. (iv) m7pG inhibited the translation of fully methylated HMW RNA by 90%. (v) After the initiation step of translation was blocked by aurintricarboxylic acid, the rate with which amino acids were incorporated into individual polypeptides decreased in a similar manner for the translation of both HMW RNA and 8 to 12S mRNA. Virion-released 8 to 12S mRNA derived from virion-associated HMW RNA during a chase in the presence of ATP, GTP, and S-adenosylmethionine was also translated. At low RNA concentrations, the derived RNA appeared to stimulate amino acid incorporation more efficiently than the HMW RNA precursor. However, at higher concentrations of this RNA, protein synthesis was severely inhibited.     

2'-O-methylated oligonucleotides in ribosomal 18S and 28S RNA of a mouse hepatoma, MH 134.

Simple two-dimensional thin-layer chromatography was found to be useful for the separation of sugar methylated dinucleotides in RNA. Of the 16 possible sequences of the type Nm-Np, 15 were separated and all the sequences were determined. In a mouse hepatoma, MH 134, the levels of the sugar methylation in the 18S and 28S RNA molecules were 17-18 and 11-12 per 1000 nucleotides, respectively. Thus, 18s RNA contained approximately 35 2'-O-methylated dinucleotides and 28S RNA approximately 60 2'-O-methylated dinucleotides. The pattern of distribution was also distinct between these two molecules. Two 2'-O-methylated trinucleotides were identified in the 28S RNA with the sequences Um-Gm-Up and Um-Gm-psip. A unique 2'-O-methylated tetranucleotide was present also in the 28S RNA, the sequence of which was Am-Gm-Cm-Ap. The 5'-terminal nucleotides of both 18S and 28S RNA were obtained as nucleoside 3',5'-diphosphates (pNp) in the trinucleotide fraction of the RNase T2 digest. The 5'-termimi of 18S and 28S RNA were pUp and pCp, respectively, and found to be almost homogeneous.     

Isolation from rat liver and sequence of a RNA fragment containing 32 nucleotides from position 5 to 36 from the 3'' end of ribosomal 18S RNA.

Crude tRNA isolated from rat liver by the method of Rogg et al. (Biochem. Biophys. Acta 195, 13-15 1969) contains N6-dimethyladenosine (m6-2A) and was therefore fractionated in order to identify the m6-2A-containing RNAs. A unique species of RNA was purified which contained all the m62A present in the crude tRNA. Sequence analysis by postlabeling with gamma-32p-ATP and polynucleotide kinase revealed that this RNA represents the 32 nucleotides AAGGUUUC(C)U GUAGGUGm62Am62ACCUGCGGAAGGAUC from position 5 to 36 of the 3' terminus of ribosomal 18S RNA. The 36 nucleotide long sequence from the 3' end of rat liver 18S rRNA exhibits extensive homology with the corresponding sequence of E. coli 16S rRNA and with the 21 nucleotide long 3' terminal sequence so far known from Saccharomyces carlsbergensis 17S rRNA. A heterogeneity in this sequence provides the first evidence on the molecular level for the existence of (at least) two sets of redundant ribosomal 18S RNA genes in the rat.     

The complete sequence of a unique RNA species synthesized by a DI particle of VSV.

The 2S RNA synthesized in vitro by the RNA polymerase of a defective interfering (DI) particle of vesicular stomatitis virus was labeled at its 3' terminus with 32P-cytidine 3', 5' bisphosphate and RNA ligase. Analysis of the labeled RNA showed that it was a family of RNAs of different length but all sharing the same 5' terminal sequence. The largest labeled RNA was purified by gel electrophoresis, and the sequence of 41 of its 46 nucleotides was determined by rapid RNA sequencing methods. The assignment of the remaining 5 nucleotides was made on the basis of an analysis of one of the smaller RNAs and published data. A new approach in RNA sequencing based on the identification of 3' terminal nucleotides of rna fragments originally present in the DI product or generated during the ligation reaction confirmed most of the sequence. The complete sequence of this 46 nucleotide long plus-sense RNA is: ppACGAAGACCACAAAACCAGAUAAAAAA UAAAAACCACAAGAGGGUC-OH. This RNA anneals to the RNA of the DI particle from which it was synthesized, indicating that its synthesis is template-specified. At least the first 17 and possibly all of the nucleotides are also complementary to sequences at the 3' end of two other VSV DI particles which were derived independently and whose genomes differ significantly in length. These data suggest a common 3' terminal sequence among all VSV DI particles which contain part of the Lgene region of the parental genome.