Role of mismatch repair in aging

A common feature of aging is the accumulation of genetic damage throughout life. DNA damage can lead to genomic instability. Many diseases associated with premature aging are a result of increased accumulation of DNA damage. In order to minimize these damages, organisms have evolved a complex network of DNA repair mechanisms, including mismatch repair (MMR). In this review, we detail the effects of MMR on genomic instability and its role in aging emphasizing on the association between MMR and the other hallmarks of aging, serving to drive or amplify these mechanisms. These hallmarks include telomere attrition, epigenetic alterations, mitochondrial dysfunction, altered nutrient sensing and cell senescence. The close relationship between MMR and these markers may provide prevention and treatment strategies, to reduce the incidence of age-related diseases and promote the healthy aging of human beings.     

Telomeres,cardiovascular aging,and potential intervention for cellular senescence

A consistent association has been observed between leukocyte telomere length (LTL) and atherosclerosis, but the mechanisms underlying these associations are still not well understood. Premature biology aging was evident in atherosclerotic plaques, characterized by reduced cell proliferation, irreversible growth arrest and apoptosis, and telomere attrition. As atherosclerosis is a state of chronic low-grade inflammation and increased oxidative stress, shortened LTL in patients with atherosclerosis might stem from the two sources, one is an accelerated rate in hematopoietic stem cells (HSCs) replication to replace leukocytes consumed in the inflammatory process, and another is the increase in the loss of telomere repeats per replication. Thus, diminished HSC reserves at birth and age-dependent telomere attrition afterward are mirrored in shortened LTL during the adulthood. In addition, the inter-individual variation of LTL in the general population can be partly explained by genetic factors regulating telomere maintenance and the rate of HSCs replication. Atherosclerosis is an aging-related disease, and practically all humans develop atherosclerosis if they live long enough. Here we overview the potential roles of LTL dynamics in the imbalance between injurious oxidative stress/inflammation and endothelial repair during the pathogenesis of age-related atherosclerosis, and discuss the possibility that preventing accelerated cellular senescence is a potential target in prevention of atherosclerosis.     

Telomere instability in a human tumor cell line expressing NBS1 with mutations at sites phosphorylated by ATM

Nijmegen breakage syndrome (NBS) is an autosomal genetic disease demonstrating a variety of phenotypic abnormalities, including premature aging, increased cancer incidence, chromosome instability, and sensitivity to ionizing radiation. The gene involved in NBS, NBS1, is part of the MRE11/RAD50/NBS1 (MRN) complex that also includes MRE11 and RAD50, which is involved in DNA repair and cell cycle regulation in response to DNA damage. The MRN complex is also involved in telomere maintenance, as demonstrated by the shortened telomeres in NBS primary human fibroblasts and the association of NBS1 with the telomere-binding protein TRF2. To learn more about how a deficiency in telomere maintenance might contribute to chromosome instability in NBS, we have investigated the stability of telomeres in two telomerase-positive human tumor cell clones, BNmt-On and BNmt-Off, expressing an inducible NBS1(S278A/S343A) gene containing mutations at serines 278 and 343 phosphorylated by ATM. The results demonstrate an increased rate of telomere loss in both clones following expression of NBS1(S278A/S343A). The absence of detectable changes in average telomere length suggests that NBS1-associated telomere loss results from stochastic events involving complete telomere loss or loss of telomere capping function. The recombination events associated with telomere loss were found to be similar to those shown previously to result in breakage/fusion/bridge cycles, suggesting that telomere loss can contribute to chromosome instability in NBS1-deficient cells. Telomere loss showed no correlation with radiosensitivity or radioresistant DNA synthesis, demonstrating that NBS1(S278A/S343A) promotes telomere loss through a separate pathway from these other phenotypes associated with NBS.     

Finding of novel telomeric repeats and their distribution in the human genome

Telomeres, the nucleoprotein structures, located at the end of the chromosomes are correlated with cancer and aging. The accelerated telomere attrition can accelerate human aging and leads to the progression of several cancers. Our work describes the finding of two novel telomeric repeats “CACAGA” and “TCTCTGCGCCTGCGCCGGCGCGGCGCGCC” and demonstrates their distribution in human chromosomes compare to the reported telomeric repeat TTAGGG. Simultaneously, the distance between the adjacent telomeric repeats (loop) was determined and the presence of shorter loops in the telomeric regions might address the correlation between the telomere attrition and senescence condition in human.     

Telomere biology: Cancer firewall or aging clock?

It has been a decade since the first surprising discovery that longer telomeres in humans are statistically associated with longer life expectancies. Since then, it has been firmly established that telomere shortening imposes an individual fitness cost in a number of mammalian species, including humans. But telomere shortening is easily avoided by application of telomerase, an enzyme which is coded into nearly every eukaryotic genome, but whose expression is suppressed most of the time. This raises the question how the sequestration of telomerase might have evolved. The predominant assumption is that in higher organisms, shortening telomeres provide a firewall against tumor growth. A more straightforward interpretation is that telomere attrition provides an aging clock, reliably programming lifespans. The latter hypothesis is routinely rejected by most biologists because the benefit of programmed lifespan applies only to the community, and in fact the individual pays a substantial fitness cost. There is a long-standing skepticism that the concept of fitness can be applied on a communal level, and of group selection in general. But the cancer hypothesis is problematic as well. Animal studies indicate that there is a net fitness cost in sequestration of telomerase, even when cancer risk is lowered. The hypothesis of protection against cancer has never been tested in animals that actually limit telomerase expression, but only in mice, whose lifespans are not telomerase-limited. And human medical evidence suggests a net aggravation of cancer risk from the sequestration of telomerase, because cells with short telomeres are at high risk of neoplastic transformation, and they also secrete cytokines that exacerbate inflammation globally. The aging clock hypothesis fits well with what is known about ancestral origins of telomerase sequestration, and the prejudices concerning group selection are without merit. If telomeres are an aging clock, then telomerase makes an attractive target for medical technologies that seek to expand the human life- and health-spans.     

Change in the telomere length distribution with age in the Japanese population

Telomeres play a role in cellular aging and they may also contribute to the genetic basis of human aging and longevity. A gradual loss of the telomeric repeat sequences has been reported in adult tissue specimens. This study determined the percentage of telomere restriction fragment in various molecular-sized regions in addition to measuring the average telomere length. Mean telomere restriction fragment (TRF) length was determined by Southern blot analysis using a longer telomeric repeat probe with higher sensitivity. A significant decrease in longer telomere fragments and a quick increase in the shortest fragments were observed, especially in male subjects. There was a tendency that the age-adjusted telomere length was longer in females than that observed in males, while males lose the telomeric sequence faster than females. These data indicated that the percentage of longer telomeres fragments decreased, while the shortest fragments increased quickly with age. In addition, the longest telomere fragments decreased and the short fragments increased with a relatively stable frequency with age. There was also a significant difference in the longest telomere fragment percentage between males and female in their 40s and 50s, whereas no difference was observed in the mean TRF length. Interestingly, the changing rate of the longest and the shortest range group of TRF percentage associated with aging seemed quite different between before and after 50-year old with a gender-related contrast. This contrast implies a drastic change around the age of 50 of unknown factors that affect telomere attrition. The first two authors equally contributed to this article.     

Telomerase activation induces elongation of the telomeric single-stranded overhang, but does not prevent chromosome aberrations in human vascular endothelial cells

Chromosome aberrations such as loss of chromosome 13 were frequently observed in human endothelial cells from umbilical cord veins (HUVEC). A recent study showed that the length of telomeric single-stranded 3'-overhangs (G-tails) is more important as an essential structure for chromosome maintenance than the net telomere length in telomere t-loop formation. Here, we have examined G-tail length using G-tail telomere HPA in normal and hTERT-transduced HUVECs. We found that forced expression of hTERT in HUVEC induced G-tail as well as total telomere length elongation. G-tail length was well correlated with total telomere length. However, hTERT introduction did not prevent chromosome aberrations such as loss of chromosome 13. Normal characteristics such as morphology, up-regulation of vWF, and tube formation were observed in hTERT-HUVEC as in young normal HUVEC. These results show that chromosome aberrations in HUVEC are independent of telomere G-tail and total telomere attrition.     

Stress, social rank and leukocyte telomere length

Blood leukocytes are a heterogeneous mixture of cell types whose telomere lengths differ greatly, reflecting variation in stem cell turnover and recruitment, expansion and replacement of more mature cell types as well as variable telomere loss and telomere repair. These differences in cell and telomere length dynamics, together with the evidence that telomere length is influenced strongly by genetic polymorphisms, greatly complicate the interpretation of claims that socio-economic status modulates the rate of telomere attrition.     

Accelerated telomere shortening and replicative senescence in human fibroblasts overexpressing mutant and wild-type lamin A

LMNA mutations are responsible for a variety of genetic disorders, including muscular dystrophy, lipodystrophy, and certain progeroid syndromes, notably Hutchinson-Gilford Progeria. Although a number of clinical features of these disorders are suggestive of accelerated aging, it is not known whether cells derived from these patients exhibit cellular phenotypes associated with accelerated aging. We examined a series of isogenic skin fibroblast lines transfected with LMNA constructs bearing known pathogenic point mutations or deletion mutations found in progeroid syndromes. Fibroblasts overexpressing mutant lamin A exhibited accelerated rates of loss of telomeres and shortened replicative lifespans, in addition to abnormal nuclear morphology. To our surprise, these abnormalities were also observed in lines overexpressing wild-type lamin A. Copy number variants are common in human populations; those involving LMNA, whether arising meiotically or mitotically, might lead to progeroid phenotypes. In an initial pilot study of 23 progeroid cases without detectable WRN or LMNA mutations, however, no cases of altered LMNA copy number were detected. Nevertheless, our findings raise a hypothesis that changes in lamina organization may cause accelerated telomere attrition, with different kinetics for overexpession of wild-type and mutant lamin A, which leads to rapid replicative senescence and progroid phenotypes.     

Telomeres,senescence, and hematopoietic stem cells

The replicative lifespan of normal somatic cells is restricted by the erosion of telomeres, which are protective caps at the ends of linear chromosomes. The loss of telomeres induces antiproliferative signals that eventually lead to cellular senescence. The enzyme complex telomerase can maintain telomeres, but its expression is confined to highly proliferative cells such as stem cells and tumor cells. The immense regenerative capacity of the hematopoietic system is provided by a distinct type of adult stem cell: hematopoietic stem cells (HSCs). Although blood cells have to be produced continuously throughout life, the HSC pool seems not to be spared by aging processes. Indeed, limited expression of telomerase is not sufficient to prevent telomere shortening in these cells, which is thought ultimately to limit their proliferative capacity. In this review, we discuss the relevance of telomere maintenance for the hematopoietic stem cell compartment and consider potential functions of telomerase in this context. We also present possible clinical applications of telomere manipulation in HSCs and new insights affecting the aging of the hematopoietic stem cell pool and replicative exhaustion. This work was supported by European Community Grant LSHC-CT-2004-502943 (MOL CANCER MED).     

Mitochondrial dysfunction leads to telomere attrition and genomic instability

Mitochondrial dysfunction and oxidative stress have been implicated in cellular senescence, apoptosis, aging and aging-associated pathologies. Telomere shortening and genomic instability have also been associated with replicative senescence, aging and cancer. Here we show that mitochondrial dysfunction leads to telomere attrition, telomere loss, and chromosome fusion and breakage, accompanied by apoptosis. An antioxidant prevented telomere loss and genomic instability in cells with dysfunctional mitochondria, suggesting that reactive oxygen species are mediators linking mitochondrial dysfunction and genomic instability. Further, nuclear transfer protected genomes from telomere dysfunction and promoted cell survival by reconstitution with functional mitochondria. This work links mitochondrial dysfunction and genomic instability and may provide new therapeutic strategies to combat certain mitochondrial and aging-associated pathologies.     

Nuclear envelope dysfunction and its contribution to the aging process

The nuclear envelope (NE) is the central organizing unit of the eukaryotic cell serving as a genome protective barrier and mechanotransduction interface between the cytoplasm and the nucleus. The NE is mainly composed of a nuclear lamina and a double membrane connected at specific points where the nuclear pore complexes (NPCs) form. Physiological aging might be generically defined as a functional decline across lifespan observed from the cellular to organismal level. Therefore, during aging and premature aging, several cellular alterations occur, including nuclear‐specific changes, particularly, altered nuclear transport, increased genomic instability induced by DNA damage, and telomere attrition. Here, we highlight and discuss proteins associated with nuclear transport dysfunction induced by aging, particularly nucleoporins, nuclear transport factors, and lamins. Moreover, changes in the structure of chromatin and consequent heterochromatin rearrangement upon aging are discussed. These alterations correlate with NE dysfunction, particularly lamins’ alterations. Finally, telomere attrition is addressed and correlated with altered levels of nuclear lamins and nuclear lamina‐associated proteins. Overall, the identification of molecular mechanisms underlying NE dysfunction, including upstream and downstream events, which have yet to be unraveled, will be determinant not only to our understanding of several pathologies, but as here discussed, in the aging process.     

Telomeres and telomerase in the fetal origins of cardiovascular disease: a review

Telomeres are noncoding functional DNA repeat sequences at the ends of chromosomes that decrease in length by a predictable amount at each cell division. When the telomeres become critically short, the cell is no longer able to replicate and enters cellular senescence. Recent work has shown that within individuals, telomere length tracks with cardiovascular health and aging and is also affected by growth variation, both prenatally and postnatally. Therefore telomere length can be a marker of both growth history (cell division) and tissue function (senescence). Relationships between early growth and later health have emerged as a research focus in the epidemiology of chronic diseases of aging, such as heart disease and diabetes. The "fetal origins" literature has demonstrated that hormonal and nutritional aspects of the intrauterine environment not only affect fetal growth but also can permanently alter the metabolic program of the individual. Smaller infants tend to have a higher risk of developing cardiovascular disease. Much less attention has been paid to possible genetic links between the processes of early growth and later disease. Our aim in this review is to summarize evidence for one such genetic mechanism, telomere attrition, that may underlie the fetal origins of cardiovascular disease and to discuss this mechanism in light of the evolution of senescence.     

Age‐related telomere attrition causes aberrant gene expression in sub‐telomeric regions

Telomere attrition has been proposed as a biomarker and causal factor in aging. In addition to causing cellular senescence and apoptosis, telomere shortening has been found to affect gene expression in subtelomeric regions. Here, we analyzed the distribution of age‐related differentially expressed genes from the GTEx RNA sequencing database of 54 tissue types from 979 human subjects and found significantly more upregulated than downregulated genes in subtelomeric regions as compared to the genome‐wide average. Our data demonstrate spatial relationships between telomeres and gene expression in aging.     

Telomere attrition predicts reduced survival in a wild social bird,but short telomeres do not

Attempts to understand the causes of variation in senescence trajectories would benefit greatly from biomarkers that reflect the progressive declines in somatic integrity (SI) that lead to senescence. While telomere length has attracted considerable interest in this regard, sources of variation in telomere length potentially unrelated to declines in SI could, in some contexts, leave telomere attrition rates a more effective biomarker than telomere length alone. Here, we investigate whether telomere length and telomere attrition rates predict the survival of wild white‐browed sparrow‐weaver nestlings (Plocepasser mahali). Our analyses of telomere length reveal counterintuitive patterns: telomere length soon after hatching negatively predicted nestling survival to fledging, a pattern that appears to be driven by differentially high in‐nest predation of broods with longer telomeres. Telomere length did not predict survival outside this period: neither hatchling telomere length nor telomere length in the mid‐nestling period predicted survival from fledging to adulthood. Our analyses using within‐individual telomere attrition rates, by contrast, revealed the expected relationships: nestlings that experienced a higher rate of telomere attrition were less likely to survive to adulthood, regardless of their initial telomere length and independent of effects of body mass. Our findings support the growing use of telomeric traits as biomarkers of SI, but lend strength to the view that longitudinal assessments of within‐individual telomere attrition since early life may be a more effective biomarker in some contexts than telomere length alone.     

Stn1 is critical for telomere maintenance and long‐term viability of somatic human cells

Disruption of telomere maintenance pathways leads to accelerated entry into cellular senescence, a stable proliferative arrest that promotes aging‐associated disorders in some mammals. The budding yeast CST complex, comprising Cdc13, Stn1, and Ctc1, is critical for telomere replication, length regulation, and end protection. Although mammalian homologues of CST have been identified recently, their role and function for telomere maintenance in normal somatic human cells are still incompletely understood. Here, we characterize the function of human Stn1 in cultured human fibroblasts and demonstrate its critical role in telomere replication, length regulation, and function. In the absence of high telomerase activity, shRNA‐mediated knockdown of hStn1 resulted in aberrant and fragile telomeric structures, stochastic telomere attrition, increased telomere erosion rates, telomere dysfunction, and consequently accelerated entry into cellular senescence. Oxidative stress augmented the defects caused by Stn1 knockdown leading to almost immediate cessation of cell proliferation. In contrast, overexpression of hTERT suppressed some of the defects caused by hStn1 knockdown suggesting that telomerase can partially compensate for hStn1 loss. Our findings reveal a critical role for human Stn1 in telomere length maintenance and function, supporting the model that efficient replication of telomeric repeats is critical for long‐term viability of normal somatic mammalian cells.     

Regulation of telomere length by fatty acid elongase 3 in yeast. Involvement of inositol phosphate metabolism and Ku70/80 function

In this study, we investigated the roles of very long-chain fatty acid (VLCFA) synthesis by fatty acid elongase 3 (ELO3) in the regulation of telomere length and life span in the yeast Saccharomyces cerevisiae. Loss of VLCFA synthesis via deletion of ELO3 reduced telomere length, and reconstitution of the expression of wild type ELO3, and not by its mutant with decreased catalytic activity, rescued telomere attrition. Further experiments revealed that alterations of phytoceramide seem to be dispensable for telomere shortening in response to loss of ELO3. Interestingly, telomere shortening in elo3Delta cells was almost completely prevented by deletion of IPK2 or KCS1, which are involved in the generation of inositol phosphates (IP4, IP5, and inositol pyrophosphates). Deletion of IPK1, which generates IP6, however, did not affect regulation of telomere length. Further data also suggested that elo3Delta cells exhibit accelerated chronologic aging, and reduced replicative life span compared with wild type cells, and deletion of KCS1 helped recover these biological defects. Importantly, to determine downstream mechanisms, epistasis experiments were performed, and data indicated that ELO3 and YKU70/80 share a common pathway for the regulation of telomere length. More specifically, chromatin immunoprecipitation assays revealed that the telomere binding and protective function of YKu80p in vivo was reduced in elo3Delta cells, whereas its non-homologues end-joining function was not altered. Deletion of KCS1 in elo3Delta cells recovered the telomere binding and protective function of Ku, consistent with the role of KCS1 mutation in the rescue of telomere length attrition. Thus, these findings provide initial evidence of a possible link between Elo3-dependent VLCFA synthesis, and IP metabolism by KCS1 and IPK2 in the regulation of telomeres, which play important physiological roles in the control of senescence and aging, via a mechanism involving alterations of the telomere-binding/protection function of Ku.     

P66SHC deletion improves fertility and progeric phenotype of late‐generation TERC‐deficient mice but not their short lifespan

Oxidative stress and telomere attrition are considered the driving factors of aging. As oxidative damage to telomeric DNA favors the erosion of chromosome ends and, in turn, telomere shortening increases the sensitivity to pro‐oxidants, these two factors may trigger a detrimental vicious cycle. To check whether limiting oxidative stress slows down telomere shortening and related progeria, we have investigated the effect of p66SHC deletion, which has been shown to reduce oxidative stress and mitochondrial apoptosis, on late‐generation TERC (telomerase RNA component)‐deficient mice having short telomeres and reduced lifespan. Double mutant (TERC^?/? p66SHC^?/?) mice were generated, and their telomere length, fertility, and lifespan investigated in different generations. Results revealed that p66SHC deletion partially rescues sterility and weight loss, as well as organ atrophy, of TERC‐deficient mice, but not their short lifespan and telomere erosion. Therefore, our data suggest that p66SHC‐mediated oxidative stress and telomere shortening synergize in some tissues (including testes) to accelerate aging; however, early mortality of late‐generation mice seems to be independent of any link between p66SHC‐mediated oxidative stress and telomere attrition.     

How will telomeric complex be further contributed to our longevity? — The potential novel biomarkers of telomere complex counteracting both aging and cancer

With the smooth move towards the coming expected clinical reports of anticancer pharmaceutical molecules targeting telomeres and telomerase, and also with the exciting success in the extension of lifespan by regulating telomerase activity without increased onset of oncogenesis in laboratory mouse models (Garcia-Cao et al., 2006; Jaskelioff et al., 2011), we are convinced that targeting telomeres based on telomerase will be a potential approach to conquer both aging and cancer and the idea of longevity seems to be no more mysterious. More interestingly, emerging evidences from clinical research reveal that other telomeric factors, like specifi c telomeric binding proteins and nonspecific telomere associated proteins also show crucial importance in aging and oncogenesis. This stems from their roles in the stability of telomere structure and in the inhibition of DNA damage response at telomeres. Uncapping these proteins from chromosome ends leads to dramatic telomere loss and telomere dysfunction which is more abrupt than those induced by telomerase inactivation. Abnormal expression of these factors results in developmental failure, aging and even oncogenesis evidenced by several experimental models and clinical cases, indicating telomere specifi c proteins and its associated proteins have complimentary roles to telomerase in telomere protection and controlling cellular fate. Thus, these telomeric factors might be potential clinical biomarkers for early detection or even therapeutic targets of aging and cancer. Future studies to elucidate how these proteins function in telomere protection might benefit patients suffering aging or cancer who are not sensitive to telomerase mediation.