Evidence for a HeLa nuclear protein that binds specifically to the single-stranded d(CCCTAA)n telomeric motif.

In recent years several telomere binding proteins from eukaryotic organisms have been identified that are able to recognise specifically the duplex telomeric DNA repeat or the G-rich 3'-ending single strand. In this paper we present experimental evidence that HeLa nuclear extracts contain a protein that binds with high specificity to the single-stranded complementary d(CCCTAA)n repeat. Electrophoretic mobility shift assays show that the oligonucleotide d(CCCTAACCCTAACCCTAACCCT) forms a stable complex with this protein in the presence of up to 1000-fold excesses of single-stranded DNA and RNA competitors, but is prevented from doing so in the presence of its complementary strand. SDS-PAGE experiments after UV cross-linking of the complex provide an estimate of 50 kDa for the molecular weight of this protein.     

Nuclear import of RPA in Xenopus egg extracts requires a novel protein XRIPalpha but not importin alpha.

Replication protein A (RPA) is a eukaryotic single-stranded (ss) DNA-binding protein that is essential for general DNA metabolism. RPA consists of three subunits (70, 33 and 14 kDa). We have identified by two-hybrid screening a novel Xenopus protein called XRIPalpha that interacts with the ssDNA-binding domain of the largest subunit of RPA. XRIPalpha homologues are found in human and in Drosophila but not in yeast. XRIPalpha is complexed with RPA in Xenopus egg extracts together with another 90 kDa protein that was identified as importin beta. We have demonstrated that XRIPalpha, but not importin alpha, is required for nuclear import of RPA. Immunodepletion of XRIPalpha from the egg extracts blocks nuclear import of RPA but not that of nucleoplasmin, a classical import substrate. RPA import can be restored by addition of recombinant XRIPalpha. Conversely, depletion of importin alpha blocks import of nucleoplasmin but not that of RPA. GST-XRIPalpha pull-down assay shows that XRIPalpha interacts directly with recombinant importin beta as well as with RPA in vitro. Finally, RPA import can be reconstituted from the recombinant proteins. We propose that XRIPalpha plays the role of importin alpha in the RPA import scheme: XRIPalpha serves as an adaptor to link RPA to importin beta.     

Cell cycle regulated phosphorylation of RPA-32 occurs within the replication initiation complex.

The transition from G1 to S phase of the cell cycle may be regulated by modification of proteins which are essential for initiating DNA replication. One of the first events during initiation is to unwind the origin DNA and this requires a single-stranded DNA binding protein. RPA, a highly conserved multi-subunit single-stranded DNA binding protein, was first identified as a cellular protein necessary for the initiation of SV40 DNA replication. The 32 kDa subunit of RPA has been shown to be phosphorylated at the start of S phase. Using SV40 replication as a model, we have reproduced in vitro the S phase-dependent phosphorylation of RPA-32 and show that it occurs specifically within the replication initiation complex. Phosphorylated RPA-32 is predominantly associated with DNA. Phosphorylation is not a pre-requisite for association with DNA, but occurs after RPA binds to single-stranded DNA formed at the origin during the initiation phase. The protein kinase(s) which phosphorylates RPA-32 is present at all stages of the cell cycle but RPA-32 does not bind to the SV40 origin or become phosphorylated in extracts from G1 cells. Therefore, the cell cycle-dependent phosphorylation of RPA-32 may be regulated by its binding to single-stranded origin DNA during replication initiation.     

Initiation of adenovirus DNA replication. II. Structural requirements using synthetic oligonucleotide adenovirus templates

Adenovirus (Ad) virions contain a 55-kDa terminal protein covalently linked to both 5'-ends of the linear duplex DNA genome. The origin of DNA replication is contained within the terminal 50 base pair of the inverted terminal repeats. In the accompanying paper (Kenny, M. K., Balogh, L. A., and Hurwitz, J. (1988) J. Biol. Chem. 263, 9801-9808), it was demonstrated that synthetic oligonucleotide templates which contain the Ad origin, but lack the 55-kDa terminal protein, can serve as templates for the initiation of Ad DNA replication. Partially duplex oligonucleotides that lacked up to 14 nucleotides from the 5'-end of the nontemplate (displaced) strand supported initiation as much as 20-fold more efficiently than fully duplex oligonucleotides. The removal of 18 nucleotides or more from the 5'-end of the displaced strand resulted in a sharp decrease in the ability of the DNA templates to support initiation. The poor template efficiency of certain DNAs could be explained by their inability to bind nuclear factor I. The initiation efficiency observed with other DNAs correlated with their ability to bind the preterminal protein-Ad DNA polymerase complex. At low concentrations of the Ad DNA-binding protein, protein-primed initiation was also observed on single-stranded DNAs. The single-stranded template strand of the Ad origin was at least 5-20-fold better at supporting initiation than other single-stranded DNAs. These findings suggest a model in which the 3'-end of the template strand is rendered single-stranded as a prerequisite for initiation of Ad DNA replication.     

An estradiol-dependent protein from chicken liver binds single-stranded DNA and RNA

We have identified two estradiol-dependent single-stranded DNA binding proteins in the nucleus and cytoplasm of chicken hepatocytes that bind the sequence 5'TCACCTTCGCTATG3' in the first exon of the chicken vitellogenin gene. As judged by chromatography on heparin-Sepharose and by proteolytic clipping bandshift assay, the two proteins are different. Furthermore, they only bind to the oligonucleotide corresponding to the upper strand. Depurination and depyrimidination interference experiments with the cytoplasmic protein show that the bases CCTT-G are involved in the protein-DNA interaction. An RNA corresponding to the upper strand of the gene between nucleotide positions -73 and +53 competes for binding to the single-stranded DNA. UV cross-linking experiments performed with bromouridine-substituted single-stranded RNA reveal that an estradiol-dependent hepatocyte cytoplasmic protein with a Mr of 71,000 binds to the mRNA-like single-stranded RNA.     

Binding activity of replication protein A to UV-damaged single-stranded DNA.

To obtain the information for the exact role of replication protein A (RPA) on both eukaryotic DNA replication and repair, the binding preference of RPA purified from Xenopus egg extract against the undamaged and UV-damaged single-stranded DNA was studied by the gel shift assay. Chemically synthesized oligonucleotide containing the pyrimidine(6-4)pyrimidone photoproduct at one site was used as a model of UV-damaged DNA. Results of competition assay and Scatchard plots indicate that RPA preferentially binds to the 6-4 photoproduct oligonucleotide than the undamaged DNA.     

Reovirus protein sigmaNS binds in multiple copies to single-stranded RNA and shares properties with single-stranded DNA binding proteins

Reovirus nonstructural protein sigmaNS interacts with reovirus plus-strand RNAs in infected cells, but little is known about the nature of those interactions or their roles in viral replication. In this study, a recombinant form of sigmaNS was analyzed for in vitro binding to nucleic acids using gel mobility shift assays. Multiple units of sigmaNS bound to single-stranded RNA molecules with positive cooperativity and with each unit covering about 25 nucleotides at saturation. The sigmaNS protein did not bind preferentially to reovirus RNA over nonreovirus RNA in competition experiments but did bind preferentially to single-stranded over double-stranded nucleic acids and with a slight preference for RNA over DNA. In addition, sigmaNS bound to single-stranded RNA to which a 19-base DNA oligonucleotide was hybridized at either end or near the middle. When present in saturative amounts, sigmaNS displaced this oligonucleotide from the partial duplex. The strand displacement activity did not require ATP hydrolysis and was inhibited by MgCl(2), distinguishing it from a classical ATP-dependent helicase. These properties of sigmaNS are similar to those of single-stranded DNA binding proteins that are known to participate in genomic DNA replication, suggesting a related role for sigmaNS in replication of the reovirus RNA genome.     

Phosphorylation of replication protein A by S-phase checkpoint kinases

The major eukaryotic single-stranded DNA (ssDNA) binding protein, replication protein A (RPA), is a heterotrimer with subunits of 70, 32 and 14 kDa (RPA70, RPA32 and RPA14). RPA-coated ssDNA has been implicated as one of the triggers for intra-S-phase checkpoint activation. Phosphorylation of RPA occurs in cells with damaged DNA or stalled replication forks. Here we show that human RPA70 and RPA32 can be phosphorylated by purified S-phase checkpoint kinases, ATR and Chk1. While ATR phosphorylates the N-terminus of RPA70, Chk1 preferentially phosphorylates RPA's major ssDNA binding domain. Chk1 phosphorylated RPA70 shows reduced ssDNA binding activity, and binding of RPA to ssDNA blocks Chk1 phosphorylation, suggesting that Chk1 and ssDNA compete for RPA's major ssDNA binding domain. ssDNA stimulates RPA32 phosphorylation by ATR in a length dependent manner. Furthermore, 3'-, but not 5'-, recessed single strand/double strand DNA junctions produce an even stronger stimulatory effect on RPA32 phosphorylation by ATR. This stimulation occurs for both RNA and DNA recessed ends. RPA's DNA binding polarity and its interaction to 3'-primer-template junctions contribute to efficient RPA32 phosphorylation. Progression of DNA polymerase is able to block the accessibility of the 3'-recessed ends and prevent the stimulatory effects of primer-template junctions on RPA phosphorylation by ATR. We propose models for the role of RPA phosphorylation by Chk1 in S-phase checkpoint pathways, and the possible regulation of ATR activity by different nucleic acid structures.     

Recruitment of replication protein A by the papillomavirus E1 protein and modulation by single-stranded DNA

With the exception of viral proteins E1 and E2, papillomaviruses depend heavily on host replication machinery for replication of their viral genome. E1 and E2 are known to recruit many of the necessary cellular replication factors to the viral origin of replication. Previously, we reported a physical interaction between E1 and the major human single-stranded DNA (ssDNA)-binding protein, replication protein A (RPA). E1 was determined to bind to the 70-kDa subunit of RPA, RPA70. In this study, using E1-affinity coprecipitation and enzyme-linked immunosorbent assay-based interaction assays, we show that E1 interacts with the major ssDNA-binding domain of RPA. Consistent with our previous report, no measurable interaction between E1 and the two smaller subunits of RPA was detected. The interaction of E1 with RPA was substantially inhibited by ssDNA. The extent of this inhibition was dependent on the length of the DNA. A 31-nucleotide (nt) oligonucleotide strongly inhibited the E1-RPA interaction, while a 16-nt oligonucleotide showed an intermediate level of inhibition. In contrast, a 10-nt oligonucleotide showed no observable effect on the E1-RPA interaction. This inhibition was not dependent on the sequence of the DNA. Furthermore, ssDNA also inhibited the interaction of RPA with papillomavirus E2, simian virus 40 T antigen, human polymerase alpha-primase, and p53. Taken together, our results suggest a potential role for ssDNA in modulating RPA-protein interactions, in particular, the RPA-E1 interactions during papillomavirus DNA replication. A model for recruitment of RPA by E1 during papillomavirus DNA replication is proposed.     

Effects of single-stranded DNA binding proteins on primer extension by telomerase

We present a biochemical analysis of the effects of three single-stranded DNA binding proteins on extension of oligonucleotide primers by the Tetrahymena telomerase. One of them, a human protein designated translin, which was shown to specifically bind the G-rich Tetrahymena and human telomeric repeats, slightly stimulated the primer extension reactions at molar ratios of translin/primer of <1:2. At higher molar ratios, it inhibited the reactions by up to 80%. The inhibition was caused by binding of translin to the primers, rather than by a direct interaction of this protein with telomerase. A second protein, the general human single-stranded DNA binding protein Replication Protein A (RPA), similarly affected the primer extension by telomerase, even though its mode of binding to DNA differs from that of translin. A third protein, the E. coli single-stranded DNA binding protein (SSB), whose binding to DNA is highly cooperative, caused more substantial stimulation and inhibition at the lower and the higher molar ratios of SSB/primer, respectively. Both telomere-specific and general single-stranded DNA binding proteins are found in living cells in telomeric complexes. Based on our data, we propose that these proteins may exert either stimulatory or inhibitory effects on intracellular telomerases, depending on their local concentrations.     

The anchor site of telomerase from Euplotes aediculatus revealed by photo-cross-linking to single- and double-stranded DNA primers.

Telomerase is a ribonucleoprotein enzyme that adds telomeric sequence repeats to the ends of linear chromosomes. In vitro, telomerase has been observed to add repeats to a DNA oligonucleotide primer in a processive manner, leading to the postulation of a DNA anchor site separate from the catalytic site of the enzyme. We have substituted photoreactive 5-iododeoxypyrimidines into the DNA oligonucleotide primer d(T4G4T4G4T4G2) and, upon irradiation, obtained cross-links with the anchor site of telomerase from Euplotes aediculatus nuclear extract. No cross-linking occurred with a primer having the same 5' end and a nontelomeric 3' end. These cross-links were shown to be between the DNA primer and (i) a protein moiety of approximately 130 kDa and (ii) U51-U52 of the telomerase RNA. The cross-linked primer could be extended by telomerase in the presence of [alpha-32P]dGTP, thus indicating that the 3' end was bound in the enzyme active site. The locations of the cross-links within the single-stranded primers were 20 to 22 nucleotides upstream of the 3' end, providing a measure of the length of DNA required to span the telomerase active and anchor sites. When the single-stranded primers are aligned with the G-rich strand of a Euplotes telomere, the cross-linked nucleotides correspond to the duplex region. Consistent with this finding, a cross-link to telomerase was obtained by substitution of 5-iododeoxycytidine into the CA strand of the duplex region of telomere analogs. We conclude that the anchor site in the approximately 130-kDa protein can bind duplex as well as single-stranded DNA, which may be critical for its function at chromosome ends. Quantitation of the processivity with single-stranded DNA primers and double-stranded primers with 3' tails showed that only 60% of the primer remains bound after each repeat addition.     

Isolation and characterization of two Saccharomyces cerevisiae genes that encode proteins that bind to (TG1-3)n single strand telomeric DNA in vitro.

By screening lambda gt11 libraries with a radiolabeled (TG1-3)n oligonucleotide, two Saccharomyces cerevisiae genes were identified that encode polypeptides that recognize the single-stranded telomeric repeat sequence (TG1-3)n. The first gene, NSR1, a previously identified gene, encodes a protein involved in ribosomal RNA maturation and possibly in transport of proteins into the nucleus. The second gene, GBP2 (G-strand Binding Protein), is an anonymous open reading frame from chromosome III. These two genes contain RNA recognition motifs (RRMs) that are found in proteins that interact with RNA. Both Nsr1p and Gbp2p bind specifically to yeast single strand (TG1-3)n DNA in vitro. To test whether these two proteins associate with telomeres in vivo, strains were constructed in which one or both of these genes were either disrupted or overexpressed. None of these alterations affected telomere length or telomere position effect. The potential role of these two (TG1-3)n binding proteins is discussed.     

Interaction of the p70 subunit of RPA with a DNA template directs p32 to the 3'-end of nascent DNA.

Human replication protein A is a heterotrimeric protein involved in various processes of DNA metabolism. To understand the contribution of replication protein A individual subunits to DNA binding, we have expressed them separately as soluble maltose binding protein fusion proteins. Using a DNA construct that had a photoreactive group incorporated at the 3'-end of the primer strand, we show that the p70 subunit on its own is efficiently cross-linked to the primer at physiological concentrations. In contrast, crosslinking of the p32 subunit required two orders of magnitude higher protein concentrations. In no case was the p14 subunit labelled above background. p70 seems to be the predominant subunit to bind single-stranded DNA and this interaction positions the p32 subunit to the 3'-end of the primer.     

The Rad51-dependent pairing of long DNA substrates is stabilized by replication protein A

Rad51 protein forms nucleoprotein filaments on single-stranded DNA (ssDNA) and then pairs that DNA with the complementary strand of incoming duplex DNA. In apparent contrast with published results, we demonstrate that Rad51 protein promotes an extensive pairing of long homologous DNAs in the absence of replication protein A. This pairing exists only within the Rad51 filament; it was previously undetected because it is lost upon deproteinization. We further demonstrate that RPA has a critical postsynaptic role in DNA strand exchange, stabilizing the DNA pairing initiated by Rad51 protein. Stabilization of the Rad51-generated DNA pairing intermediates can be can occur either by binding the displaced strand with RPA or by degrading the same DNA strand using exonuclease VII. The optimal conditions for Rad51-mediated DNA strand exchange used here minimize the secondary structure in single-stranded DNA, minimizing the established presynaptic role of RPA in facilitating Rad51 filament formation. We verify that RPA has little effect on Rad51 filament formation under these conditions, assigning the dramatic stimulation of strand exchange nevertheless afforded by RPA to its postsynaptic function of removing the displaced DNA strand from Rad51 filaments.     

The yeast recombinational repair protein Rad59 interacts with Rad52 and stimulates single-strand annealing

The yeast RAD52 gene is essential for homology-dependent repair of DNA double-strand breaks. In vitro, Rad52 binds to single- and double-stranded DNA and promotes annealing of complementary single-stranded DNA. Genetic studies indicate that the Rad52 and Rad59 proteins act in the same recombination pathway either as a complex or through overlapping functions. Here we demonstrate physical interaction between Rad52 and Rad59 using the yeast two-hybrid system and co-immunoprecipitation from yeast extracts. Purified Rad59 efficiently anneals complementary oligonucleotides and is able to overcome the inhibition to annealing imposed by replication protein A (RPA). Although Rad59 has strand-annealing activity by itself in vitro, this activity is insufficient to promote strand annealing in vivo in the absence of Rad52. The rfa1-D288Y allele partially suppresses the in vivo strand-annealing defect of rad52 mutants, but this is independent of RAD59. These results suggest that in vivo Rad59 is unable to compete with RPA for single-stranded DNA and therefore is unable to promote single-strand annealing. Instead, Rad59 appears to augment the activity of Rad52 in strand annealing.     

Double-stranded DNA induces the phosphorylation of several proteins including the 90 000 mol. wt. heat-shock protein in animal cell extracts.

Double-stranded DNA (dsDNA) induces the transfer of phosphate from ATP to several proteins in extracts of widely divergent eukaryotic cells. Extracts of HeLa cells, rabbit reticulocytes, Xenopus eggs and Arbacia eggs all show dsDNA-dependent protein phosphorylation. The mechanism is specific for dsDNA and will not respond to either RNA or single-stranded DNA. One of the proteins which is phosphorylated in response to dsDNA has a subunit mol. wt. of 90 000 and has been identified as a heat-shock protein (hsp90). Although mouse cell extracts were shown to contain hsp90, they failed to show a dsDNA-dependent protein phosphorylation. The observation that dsDNA can modulate the phosphorylation of a set of proteins raises the possibility that dsDNA may play a role as a cellular regulatory signal.     

Parvovirus initiator protein NS1 and RPA coordinate replication fork progression in a reconstituted DNA replication system

We show here that the DNA helicase activity of the parvoviral initiator protein NS1 is highly directional, binding to the single strand at a recessed 5' end and displacing the other strand while progressing in a 3'-to-5' direction on the bound strand. NS1 and a cellular site-specific DNA binding factor, PIF, also known as glucocorticoid modulating element binding protein, bind to the left-end minimal replication origin of minute virus of mice, forming a ternary complex. In this complex, NS1 is activated to nick one DNA strand, becoming covalently attached to the 5' end of the nick in the process and providing a 3' OH for priming DNA synthesis. In this situation, the helicase activity of NS1 did not displace the nicked strand, but the origin duplex was distorted by the NS1-PIF complex, as assayed by its sensitivity to KMnO(4) oxidation, and a stretch of about 14 nucleotides on both strands of the nicked origin underwent limited unwinding. Addition of Escherichia coli single-stranded DNA binding protein (SSB) did not lead to further unwinding. However, addition of recombinant human single-stranded DNA binding protein (RPA) to the initiation reaction catalyzed extensive unwinding of the nicked origin, suggesting that RPA may be required to form a functional replication fork. Accordingly, the unwinding mediated by NS1 and RPA promoted processive leading-strand synthesis catalyzed by recombinant human DNA polymerase delta, PCNA, and RFC, using the minimal left-end origin cloned in a plasmid as a template. The requirement for RPA, rather than SSB, in the unwinding reaction indicated that specific NS1-RPA protein interactions were formed. NS1 was tested by enzyme-linked immunosorbent assay for binding to two- or three-subunit RPA complexes expressed from recombinant baculoviruses. NS1 efficiently bound each of the baculovirus-expressed complexes, indicating that the small subunit of RPA is not involved in specific NS1 binding. No NS1 interactions were observed with E. coli SSB or other proteins included as controls.     

Human replication protein A. The C-terminal RPA70 and the central RPA32 domains are involved in the interactions with the 3'-end of a primer-template DNA

Although the mechanical aspects of the single-stranded DNA (ssDNA) binding activity of human replication protein A (RPA) have been extensively studied, only limited information is available about its interaction with other physiologically relevant DNA structures. RPA interacts with partial DNA duplexes that resemble DNA intermediates found in the processes of DNA replication and DNA repair. Limited proteolysis of RPA showed that RPA associated with ssDNA is less protected against proteases than RPA bound to a partial duplex DNA containing a 5'-protruding tail that had the same length as the ssDNA. Modification of both the 70- and 32-kDa subunits, RPA70 and RPA32, respectively, by photoaffinity labeling indicates that RPA can bind the primer-template junction of partial duplex DNAs by interacting with the 3'-end of the primer. The identification of the protein domains modified by the photoreactive 3'-end of the primer showed that domains located in the central part of the RPA32 subunit (amino acids 39-180) and the C-terminal part of the RPA70 subunit (amino acids 432-616) are involved in these interactions.     

Small molecule inhibitor of the RPA70 N-terminal protein interaction domain discovered using in silico and in vitro methods

The pharmacological suppression of the DNA damage response and DNA repair can increase the therapeutic indices of conventional chemotherapeutics. Replication Protein A (RPA), the major single-stranded DNA binding protein in eukaryotes, is required for DNA replication, DNA repair, DNA recombination, and DNA damage response signaling. Through the use of high-throughput screening of 1500 compounds, we have identified a small molecule inhibitor, 15-carboxy-13-isopropylatis-13-ene-17,18-dioic acid (NSC15520), that inhibited both the binding of Rad9-GST and p53-GST fusion proteins to the RPA N-terminal DNA binding domain (DBD), interactions that are essential for robust DNA damage signaling. NSC15520 competitively inhibited the binding of p53-GST peptide with an IC(50) of 10 μM. NSC15520 also inhibited helix destabilization of a duplex DNA (dsDNA) oligonucleotide, an activity dependent on the N-terminal domain of RPA70. NSC15520 did not inhibit RPA from binding single-stranded oligonucleotides, suggesting that the action of this inhibitor is specific for the N-terminal DBD of RPA, and does not bind to DBDs essential for single-strand DNA binding. Computer modeling implicates direct competition between NSC15520 and Rad9 for the same binding surface on RPA. Inhibitors of protein-protein interactions within the N-terminus of RPA are predicted to act synergistically with DNA damaging agents and inhibitors of DNA repair. Novel compounds such as NSC15520 have the potential to serve as chemosensitizing agents.