Linkage map of two HLA-SB beta and two HLA-SB alpha-related genes: an intron in one of the SB beta genes contains a processed pseudogene

Three overlapping cosmid clones contain coding sequences for four HLA Class II genes, provisionally identified as two HLA-SB alpha and two HLA-SB beta genes. The genes are in the order beta, alpha, beta, alpha, inverted with respect to each other. One of the SB beta genes contains a 513 bp sequence that appears to be a processed pseudogene, flanked by direct 17 bp repeat sequences, in the intron upstream of the beta 1 exon. The pseudogene is homologous to a family of sequences of approximately 25-40 members, most of which are not on chromosome 6. A cDNA clone, highly homologous to the pseudogene, except for its 5' end, contains a normal poly(A) addition site and a poly(A) tail. The cDNA clone is homologous to a single-copy gene in both man and mouse, encoded on human chromosome 15. A search of published DNA sequences identified a mouse sequence, with about 77% similarity to the pseudogene sequence, in the negative strand of an intron in a mouse dihydrofolate reductase gene. The second SB beta gene does not contain the pseudogene sequence.     

Repetitive satellite-like sequences are present within or upstream from 3 avian protein-coding genes.

Peculiar DNA sequences made up by the tandem repetition of a 5 bp unit have been identified within or upstream from three avian protein-coding genes. One sequence is located within an intron of the chicken "ovalbumin-X" gene with 5'-TCTCC-3' as basic repeat unit (36 repeats). Another sequence made of 27 repeats of a 5'-GGAAG-3' basic unit is found 2500 base pairs upstream from the promoter of the chicken ovotransferrin (conalbumin) gene. A related but different sequence is present in the corresponding region of the ovotransferrin gene in the pheasant, with 5'-GGAAA-3' as the basic unit (55 repeats). These three satellite-like elements are thus characterized by a total assymetry in base distribution, with purines restricted to one strand, and pyrimidines to the other. Two of the basic repeat units can be derived from the third one (GGAAA) by a single base pair change. These related sequences are found repeated in three avian genomes, at degrees which vary both with the sequence type and the genome type. Evolution of tandemly repeated sequences (including satellites) is in general studied by analysing randomly picked elements. The presence of conserved protein-coding regions neighbouring satellite-like sequences allow to follow their evolution at a single locus, as exemplified by the striking comparison of the pheasant and chicken sequences upstream from the ovotransferrin gene.     

The U1 snRNA gene repeat from the sea urchin (Strongylocentrotus purpuratus): the 70 kilobase tandem repeat ends directly 3'' to a U1 gene.

Lambda phage clones containing multiple copies of the 1.1 kb tandemly repeated unit of the sea urchin (S. purpuratus) U1 RNA genes were isolated from a gene library. The 1.1 kb repeat unit encodes a single copy of the predominant U1 RNA expressed in oocytes and embryos prior to the blastula stage. The tandem repeat unit is about 80 kb in size and is probably present one time per haploid genome as judged by pulsed-field electrophoresis of sperm DNA digested with restriction enzymes which do not cut in the repeat unit. Two of the phage contained DNA flanking the repeat unit as well as several repeat units. The tandem repeat unit ends just 3' to the U1 coding region. There is only limited homology in the 5' flanking region with U1 snRNA genes from the sea urchin L. variegatus.     

The nucleotide sequence of oocyte 5S DNA in Xenopus laevis. II. The GC-rich region

The primary sequence of the GC-rich half of the repeating unit in X. laevis 5S DNA has been determined in both a single plasmid-cloned repeating unit and in the total population of repeatig units. The GC-rich half of the repeating unit contains a single long duplication of 174 nucleotides. The duplicated segment commences 73 nucleotides preceding the 5' end of the gene and terminates at nucleotide 101 of the gene. The duplicated portion of the gene, termed the pseudogene, differs by 10 nucleotides from the corresponding portion of the gene, and the remaining duplicated sequence of 73 nucleotides differs by 13 nucleotides. The plasmid-cloned repeating unit differs from the dominant sequence in the total population repeating units by 6 nucleotides in the GC-rich region. Evidence is provided that most of the CpG dinucleotides in 5S DNA are at least partially methylated.     

Characterization of an unusual DNA length polymorphism 5'' to the human antithrombin III gene

Nucleotide sequence analysis revealed that a DNA length polymorphism 5' to the human antithrombin III gene is due to the presence of 32bp or 108bp nonhomologous nucleotide sequences (variable segments) 345bp upstream from the translation initiation codon. Sequences at the 3' borders of both variable segments can form intrastrand inverted repeat structures with sequences further downstream. An inverted repeat is also found immediately 5' to the site where the variable segments are located. Thus, cruciform structures may form flanking the variable segments of both alleles of this DNA length polymorphism. DNA secondary structure may be detected with single strand specific nucleases. S1 nuclease sensitive sites were mapped in recombinant plasmids containing the cloned alleles of the ATIII length polymorphism. The site most sensitive to S1 is located upstream from the variable segments in an AT-rich segment flanked by 6bp direct repeats. A region of lesser nuclease sensitivity was also observed in the AT-rich loops formed between the inverted repeats 5' to the variable segments.     

Organization of the human protein S genes

Human genomic clones that span the entire protein S expressed gene (PS alpha) and the 3' two-thirds of the protein S pseudogene (PS beta) have been isolated and characterized. The PS alpha gene is greater than 80 kilobases in length and contains 14 introns and 15 exons, as well as 6 repetitive "Alu" sequences. Exons I and XV contain 112 and 1139 bp 5' and 3' noncoding segments in addition to the amino and carboxyl termini, respectively. Exons I-VIII encode protein segments that are homologous to the vitamin K dependent clotting proteins and are bounded by introns whose position and type are identical with other members of this protein family. Exons IX-XV encode protein segments homologous to sex hormone binding globulin (SHBG) and are bounded by introns of identical type and position as in the SHBG gene. Genomic clones for the PS beta gene cover a distance of greater than 55 kilobases and contain segments corresponding to amino acids 46-635 of the mature protein and the 1.1-kb 3' noncoding region of the cDNA. The presence of multiple base changes in the coding portions of this gene, resulting in termination codons and frame shifts, suggests that it is a pseudogene. Comparison of DNA sequences for the two genes reveals 97% identity for coding and 3' noncoding, and 95.4% for intronic regions, suggesting divergence of the two genes is a relatively recent event.     

Association of a truncated cytochrome c processed pseudogene with a similarly truncated member from a long interspersed repeat family of rat.

The cytochrome c multigene family of rat contains approximately 30 processed pseudogenes that represent genomic DNA copies of three alternate mRNAs. Here, the DNA sequence of an unusual processed pseudogene reveals that it has a complete 3' noncoding region including a short poly A tail but unlike the others is abruptly truncated at its 5' end, 19 amino acid codons from the translation terminator. At this position the pseudogene is fused through 17 consecutive adenylic acid residues to a 1.3 kb repetitive sequence. This repetitive element is flanked by direct repeats and represents a truncated member from a major long interspersed repeat family. The rat element is a composite of sequences observed in long interspersed repeats from both rodents and primates. Comparison to the equivalent mouse sequences shows that the 5' half of the repeat distal to the pseudogene has an open reading frame and is highly conserved whereas the half adjacent to the pseudogene is evolutionarily unstable. The proportion of cytochrome c pseudogene recombinant clones containing this repetitive DNA is 3 fold greater than observed in random isolates and may reflect a general tendency of processed pseudogenes to associate with other repetitive sequences in the genome.     

5S ribosomal RNA genes of the newt Notophthalmus viridescens.

The genes which code for the 5S ribosomal RNA in the newt, Notophthalmus viridescens have been cloned and analyzed. Two types of repeating unit were detected: a major type consisting of a 120 bp coding region with a 111 bp spacer, and a minor type composed of a coding region, a pseudogene, and a 113 bp spacer. The pseudogene is a 36 bp segment which corresponds to the 3' terminal third of the 5S RNA gene, and is situated immediately 3' to the gene, being separated from it by 2 bp. Two recombinant plasmids were obtained in which the major and minor units were arranged in an interspersed pattern.     

A nuclear factor that binds purine-rich, single-stranded oligonucleotides derived from S1-sensitive elements upstream of the CFTR gene and the MUC1 gene.

We have identified two regions of non-random purine/pyrimidine strand asymmetry that were nearly identical in sequence in the 5' flanking (promoter) regions of the human cystic fibrosis transmembrane conductance regulator (CFTR) gene and the human MUC1 gene. These regions contain perfect mirror repeat elements, a sequence motif previously found to be associated with the formation of H-DNA conformations. In this report we demonstrate that a single-stranded non-B DNA conformation exists at low pH in supercoiled plasmids containing the similar mirror repeat elements, and that S1 nuclease digestion maps the single-stranded region to the position of the mirror repeats. In addition, we identify a nuclear protein of approximately 27 kD that binds to single-stranded oligonucleotides corresponding to the purine-rich strand of this region, but not to the pyrimidine-rich strands or to double-stranded oligonucleotides with corresponding purine/pyrimidine strand asymmetry.     

Cloning and analysis of the pseudogene for human epinephrine synthesizing enzyme, phenylethanolamine N-methyltransferase (PNMT)

1. This gene completely lacks the intervening sequences. 2. This gene is truncated at the 5' end peptide encoding region by 433 base pairs (bp). 3. The 502 bp of this gene containing poly(A) signal are completely identical to the 3' half of mRNA encoding region of functional gene. 4. This gene has a poly(A) tail and is flanked by direct repeat of 6 bp. 5. Here we report for the first time the complete sequence of a human pseudogene for phenylethanolamine N-methyltransferase and this is the first report of cloning of pseudogene for catecholamine biosynthetic enzymes.     

Histone genes of the sea urchin (S. purpuratus) cloned in E. coli: Order,polarity, and strandedness of the five histone-coding and spacer regions

Sea urchin (S. purpuratus) histone DNA of constructed plasmid chimeras cloned in E. coli was cleaved with the restriction endonucleases Eco RI, Hind III, Sal I, Bam I, and Hha I. The resulting fragments were ordered and isolated directly from agarose gels or cloned into other plasmids. Each fragment hybridized to one or another of the five histone mRNAs and elucidated the order of the histone genes in each of the cloned fragments. Some DNA did not hybridize to histone mRNAs and was identified as spacer DNA located between coding regions.Total sea urchin DNA was cleaved with restriction endonucleases, fractionated on agarose gels, and hybridized to histone mRNAs or histone DNA. The results revealed the order of the five histone genes in the histone gene repeat unit and demonstrate that the histone spacer DNAs have little sequence homology to other genes. Exonuclease III digestion of specific linear chimeric histone DNA plasmids followed by hybridization with mRNAs demonstrated the existence of all five histone genes on one strand of DNA and the 5′-3′ polarity of that strand. These results, in conjunction with the data of Wu et al. (1976), allow us to construct a map of coding and spacer sequences in the transcribed strand of the S. purpuratus histone gene repeat unit:

     

Evidence for the presence of HABP1 pseudogene in multiple locations of mammalian genome

The gene encoding hyaluronan-binding protein 1 (HABP1) is expressed ubiquitously in different rat tissues, and is present in eukaryotic species from yeast to humans. Fluorescence in situ hybridization indicates that this is localized in human chromosome 17p13.3. Here, we report the presence of homologous sequences of HABP1 cDNA, termed processed HABP1 pseudogene in humans. This is concluded from an additional PCR product of ~0.5 kb, along with the expected band at approximately 5 kb as observed by PCR amplification of human genomic DNA with HABP1-specific primers. Partial sequencing of the 5-kb PCR product and comparison of the HABP1 cDNA with the sequence obtained from Genbank accession number AC004148 indicated that the HABP1 gene is comprised of six exons and five introns. The 0.5-kb additional PCR product was confirmed to be homologous to HABP1 cDNA by southern hybridization, sequencing, and by a sequence homology search. Search analysis with HABP1 cDNA sequence further revealed the presence of similar sequence in chromosomes 21 and 11, which could generate ~0.5 kb with the primers used. In this report, we describe the presence of several copies of the pseudogene of HABP1 spread over different chromosomes that vary in length and similarity to the HABP1 cDNA sequence. These are 1013 bp in chromosome 21 with 85.4% similarity, 1071 bp in chromosome 11 with 87.2% similarity, 818 bp in chromosome 15 with 82.3% similarity, and 323 bp in chromosome 4 with 84% similarity to HABP1 cDNA. We have also identified similar HABP1 pseudogenes in the rat and mouse genome. The human pseudogene sequence of HABP1 possesses a 10 base pair direct repeat of "AGAAAAATAA" in chromosome 21, a 12-bp direct repeat of "AG/CAAATTA/CAA/TTA" in chromosome 4, a 8-bp direct repeat of "ACAAAG/TCT" in chromosome 15. In the case of chromosome 11, there is an inverted repeat of "AGCCTGGGCGACAGAGCGAGA" ~50 bp upstream of the HABP1 pseudogene sequence. All of the HABP1 pseudogene sequences lack 5' promoter sequence and possess multiple mutations leading to the insertion of premature stop codons in all three reading frames. Rat and mouse homologs of the HABP1 pseudogene also contain multiple mutations, leading to the insertion of premature stop codons confirming the identity of a processed pseudogene.