Black lipid membranes of tetraether lipids from Thermoplasma acidophilum.

Black lipid membranes were formed of tetraether lipids from Thermoplasma acidophilum and compared to the bilayer forming lipids diphytanoylphosphatidylcholine and diphythanylglucosylglycerol. Bilayer-forming lipids varied in thickness of black lipid membranes due to the organic solvent used. Measurements of the specific membrane capacitance (Cm = 0.744 microF/cm2) showed that the membrane-spanning tetraether lipids from Thermoplasma acidophilum form a monolayer of a constant thickness of 2.5-3.0 nm no matter from which solvent. This finding corresponds to the results of Gliozzi et al. for the lipids of another archaebacterium, Sulfolobus solfataricus. Black lipid membranes were formed at room temperature with a torus from bilayer-forming lipids, however, the torus could also be formed by the tetraether-lipid itself at room temperature and at defined concentration. In these stable black lipid membranes, conductance was measured in the presence of valinomycin, nonactin, and gramicidin. At 10(-7) M concentration, valinomycin mediated higher conductance in membranes from tetraether lipids (200-1200 microS/cm2) than from bilayer-forming lipids (125-480 microS/cm2). Nonactin, at 10(-6) M concentration, mediated a 6-fold higher conductance in a tetraether lipid membrane than in a bilayer, whereas conductance, in the presence of 5 x 10(-11) M gramicidin could reach higher values in bilayers than in tetraether lipid monolayers of comparable thickness. Monensin did not increase the conductance of black lipid membranes from tetraether lipids under all conditions applied in our experiments. Poly(L-lysine) destroyed black lipid membranes. Lipopolysaccharides from Thermoplasma acidophilum were not able to form stable black lipid membranes by themselves. The lipopolysaccharide complexes from Thermoplasma acidophilum and from Escherichia coli decreased the valinomycin-mediated conductance of monolayer and bilayer membranes. This influence was stronger than that of the polysaccharide dextran.     

Biochemical properties of the proteasome from Thermoplasma acidophilum.

We have purified proteasomes to apparent homogeneity from the archaebacterium Thermoplasma acidophilum. This proteinase has a molecular mass of about 650 kDa and an isoelectric point of 5.6. The proteasome hydrolyses peptide substrates containing an aromatic residue adjacent to the reporter group, as well as [14C]methylated casein optimally at pH 8.5 and 90 degrees C. The enzyme activity is enhanced severalfold by Mg2+ and Ca2+ at 25-500 mM. This increase in activity results primarily from a change in Km. The serine-proteinase inhibitors diisopropylfluorophosphate and 3,4-dichloroisocoumarin irreversibly inhibit the enzyme, obviously by modification of both the alpha and beta subunits in the proteasome. The inhibition of proteasomal activity by the peptidylchloromethanes, Cbz-Leu-Leu-CH2Cl and Cbz-Ala-Ala-Phe-CH2Cl (Cbz, benzyloxycarbonyl), is reversible and predominantly of a competitive type. The enzyme is not activated by any of the compounds that typically stimulate the activities of the eukaryotic proteasome.     

The effect of A13+ on the physical properties of membrane lipids in Thermoplasma acidophilum.

Using Electron Paramagnetic Resonance Spectroscopy, Al³⁺ was shown to produce a dramatic decrease of membrane lipid fluidity on the microorganism $\text{Thermoplasma}\text{acidophilum}$ at a pH > 2. The ability of Al³⁺ to alter lipid fluidity was enhanced with increasing pH (from 3 to 5). At pH 4, 10^?2 M Al³⁺ increased the lower lipid phase transition by 39°C, and a detectable change was observed with AlCl₃ concentrations as low as 10^?5 M. The ability of Al³⁺ to increase the lower lipid phase transition temperature of $\text{T.}\text{acidophilum}$ is the largest of any cation/lipid interaction yet reported.     

Thermotropic properties of dispersions of cholesterol with tetraether lipids from Thermoplasma acidophilum

The main glycophospholipid from Thermoplasma acidophilum is composed of a diisopranol-2,3-glycerotetraether. The fraction of pentane cyclizations of its hydrocarbon chains increases with the growth temperature of the source organism (39-59 degrees C). Hydrated mixtures of these lipids together with cholesterol have been studied by calorimetry. With the reduction of the phase transition temperatures and enthalpy changes of the transitions, cholesterol is readily incorporated into lipid monolayers in the liquid-crystalline and the (metastable) solid-analogue phase. Lipid samples with a high number of acyclic hydrocarbon chains form a stable and a metastable solid-analogue phase. With the increasing concentration of cholesterol the metastable solid-analogue phase is stabilized and the time constant for the formation of the stable solid-analogue phase is prolonged.     

Purification and properties of pyruvate kinase from Thermoplasma acidophilum

Thermoplasma acidophilum is a thermoacidophilic archaebacterium occupying a paradoxical place in phylogenetic trees (phenotypically it is a thermoacidophile but phylogenetically it classifies with the methanogens). To better understand its phylogeny, the pyruvate kinase from this organism is being investigated as a molecular marker. The enzyme has been purified and has a native M(r) of 250,000. It consists of four, apparently identical subunits each of M(r) 60,000. No remarkable kinetic differences have been found between this thermophilic enzyme and its mesophilic counterparts other than its greater thermostability. Its amino acid composition has been determined and some partial sequencing has been done.     

Biosynthesis of archaeal membrane lipids: digeranylgeranylglycerophospholipid reductase of the thermoacidophilic archaeon Thermoplasma acidophilum

The basic core structure of archaeal membrane lipids is 2,3-di-O-phytanyl-sn-glyceryl phosphate (archaetidic acid), which is formed by the reduction of 2,3-di-O-geranylgeranylglyceryl phosphate. The reductase activity for the key enzyme in membrane lipid biosynthesis, 2,3-digeranylgeranylglycerophospholipid reductase, was detected in a cell free extract of the thermoacidophilic archaeon Thermoplasma acidophilum. The reduction activity was found in the membrane fraction, and FAD and NADH were required for the activity. The reductase was purified from a cell free extract by ultracentrifugation and four chromatographic steps. The purified enzyme showed a single band at ca. 45 kDa on SDS-PAGE, and catalyzed the formation of archaetidic acid from 2,3-di-O-geranylgeranylglyceryl phosphate. Furthermore, the enzyme also catalyzed the reduction of 2,3-di-O-geranylgeranylglyceryl phosphate analogues such as 2,3-di-O-phytyl-sn-glyceryl phosphate, 3-O-(2,3-di-O-phytyl-sn-glycero-phospho)-sn-glycerol and 2,3-di-O-phytyl-sn-glycero-phosphoethanolamine. The N-terminal 20 amino acid sequence of the purified enzyme was determined and was found to be identical to the sequence encoded by the Ta0516m gene of the T. acidophilum genome. The present study clearly demonstrates that 2,3-digeranylgeranylglycerophospholipid reductase is a membrane associated protein and that the hydrogenation of each double bond of 2,3-digeranylgeranylglycerophospholipids is catalyzed by a single enzyme.     

Stereochemistry of reduction in digeranylgeranylglycerophospholipid reductase involved in the biosynthesis of archaeal membrane lipids from Thermoplasma acidophilum

The basic core structure of archaeal membrane lipids is 2,3-di-O-phytanylglyceryl phosphate, which is formed by reduction of 2,3-di-O-geranylgeranylglyceryl phosphate. This reaction is the final committed step in the biosynthesis of archaeal membrane lipids and is catalyzed by digeranylgeranylglycerophospholipid reductase (DGGGPL reductase). The putative DGGGPL reductase gene (Ta0516m) of Thermoplasma acidophilum was cloned and expressed. The purified recombinant enzyme appeared to catalyze the formation of 2,3-di-O-phytanylglyceryl phosphate from 2,3-di-O-geranylgeranylglyceryl phosphate, which confirmed that the Ta0516m gene of T. acidophilum encodes DGGGPL reductase. The stereospecificity in reduction of 2,3-di-O-phytylglyceryl phosphate by the recombinant reductase appeared to take place through addition of hydrogen in a syn manner by analyzing the enzyme reaction product by NMR spectroscopy.     

Calorimetry of tetraether lipids from Thermoplasma acidophilum: incorporation of alamethicin, melittin, valinomycin, and nonactin.

The development and application of model membrane systems on the basis of tetraether lipids from Thermoplasma acidophilum has been proposed. In this respect incorporation of membrane proteins and ionophores is indispensable and is demonstrated in the case of alamethicin, melittin, nonactin, and valinomycin by calorimetry. Dipalmitoylphosphatidylcholine (DPPC) and dihexadecylmaltosylglycerol (DHMG) were chosen for comparison. Melittin and alamethicin prove to broaden the lipid phase transition and to reduce the melting temperature Tm and enthalpy change (delta H) of the main phospholipid from T. acidophilum (MPL) and DPPC. The decrease in Tm, however, is more pronounced in DPPC than in MPL. Valinomycin shows only a marginal effect on the temperature and width of the transition; delta H is reduced in MPL and remains constant in DPPC and DHMG. With nonactin the phase transition of DPPC is quenched, and delta H and the half-height width are increased. DHMG is affected to a lesser extent and MPL only marginally. The four ionophores exhibit different modulation of the phase transition behavior of the various lipids as expected from their varying molecular structures. Thus, the integral membrane protein alamethicin, the peripheral protein melittin, valinomycin, and nonactin interact primarily with lipid head groups and are readily incorporated into the tetraether lipid structures.     

Purification and properties of malate dehydrogenase from the thermoacidophilic archaebacterium Thermoplasma acidophilum

Malate dehydrogenase from the thermoacidophilic archaebacterium Thermoplasma acidophilum is purified 50-fold to electrophoretic homogeneity. The purified enzyme crystallizes readily. Native malate dehydrogenase shows a relative molecular mass of 144 000. It is a tetramer of identical subunits with a relative molecular mass of 36 600. Malate dehydrogenase from Thermoplasma uses both NADH and NADPH as coenzyme to reduce oxaloacetate. The enzyme shows A-side (pro-R) stereospecificity for both coenzymes. The pH optimum for the reduction of oxaloacetate in the presence of NADH is found to be at pH 8.1. At pH 7.4 the Km value for oxaloacetate is found to be 5.6 microM while for NADH a value of 11.7 microM is found. The homogeneous enzyme shows a turnover number of kcat = 108 s-1.     

Incorporation of synthetic peptide helices in membranes of tetraether lipids from Thermoplasma acidophilum. A calorimetric study

Four analogues of the membrane-modifying, alpha-helical polypeptide antibiotic alamethicin were synthesized. the alpha-helical deca-, undeca-, heptadeca-, and icosapeptides were mixed with the main tetraether lipid of the Archaebacterium Thermoplasma acidophilum (MPL), dipalmitoylphosphatidylcholine (DPPC) and dihexadecylmaltosylglycerol (DHMG) in various ratios and the modification of the lipid phase transition was determined by differential thermal analysis (DTA). The polypeptides form mixed phases with MPL and DPPC, however, not with DHMG. Heptadeca- and icosapeptide exert a much stronger reduction of enthalpy (delta H) than deca- and undecapeptide and bind about 0.5 molecule of MPL (or one molecule of DPPC) per peptide molecule. delta H of the DPPC pretransition is reduced by the deca- and the undecapeptides and completely disappears with heptadeca- and icosapeptides (at 0.2 mole of peptide/mole of lipid). The modulation of the melting point Tm by the incorporation of peptides is more pronounced with MPL than with DPPC, the heptadecapeptide exhibiting the strongest reduction (with MPL) and the strongest broadening of the transition peak (with DPPC). Helix length, amphiphilicity and charge of the polypeptides can be correlated with the observed modifications of the lipid phase transitions.     

Isolation and characterization of novel neutral glycolipids from Thermoplasma acidophilum.

Several novel neutral glycolipids (GL-1a, GL-1b, GL-2a, GL-2b and GL-2c) were isolated from Thermoplasma acidophilum by high-performance liquid chromatography using phenylboronic acid-silica and preparative thin-layer chromatography. The tentative structures of these lipids were characterized by the combination of gas-liquid chromatography, the methylation procedure, and (1)H-NMR and FAB-mass spectrometries. The lipophilic portion of the neutral glycolipids was composed of a simple molecular species named caldarchaeol (dibiphytanyl-diglycerol tetraether). The sugar moieties of these glycolipids were composed of gulose and glucose which formed monosaccharide residues on one side or both sides of the core lipids. Gulose was attached to the terminal glycerol OH group of the core lipid with a beta-configuration and glucose being attached with an alpha-configuration. The proposed structure of GL-1a was gulosylcaldarchaeol and that of GL-1b was glucosylcaldarchaeol. The structures of GL-2a, GL-2b, and GL-2c were the analogs of the caldarchaeol derivatives attached by a variety of gulosyl residues or glucosyl residues on both sides of the terminal OH groups.     

Dielectric properties of developing rabbit brain at 37 degrees C

The dielectric properties of developing rabbit brain were measured at 37 degrees C between 10 MHz and 18 GHz using time domain and frequency domain systems. The results show a variation with age of the dielectric properties of brain. An analysis of the data suggests that the water dispersion in the brain of newly born animals can be represented by a Debye equation. This dispersion increases in complexity with age, and there is evidence of a smaller additional relaxation process centered around 1 GHz. It is concluded that the principal contribution to this subsidiary dispersion region arises from water of hydration.     

The nucleotide sequence of the tRNAMMet from the archaebacterium Thermoplasma acidophilum.

Using in vitro labelling techniques, a tRNAMMet from Thermoplasma acidophilum, a member of the Archaebacteriae, has been shown to have the sequence: pGCCGGG Gs4UGGCUCANCUGGAGGAGC m2(2)GCCGGACmUCAUt6AAUCCGGAGGUCUCGGG psi psi CmGAUCCCCGAUCCCGGCACCAOH. Despite the small genome size of this non-parasitic organism, eight modified nucleosides are present, one of which is typically eubacterial, one of which is typically eukaryotic and some of which appear to be unique to the archaebacteria. There is no close sequence homology between this tRNA and that of any other methionine tRNA so far sequenced (less than 70%) but it has almost 90% homology with the nucleotide sequence proposed by Eigen and Oswatitsch for the ancestral quasi-species.     

Monomolecular organization of the main tetraether lipid from Thermoplasma acidophilum at the water-air interface

The monomolecular organization of the main tetraether phospholipid from the archaeon Thermoplasma acidophilum was studied by means of a Langmuir film balance integrated into a fluorescence microscope. After transfer to solid surfaces at different pressures the films were further investigated by ellipsometry, small angle X-ray scattering and atomic force microscopy. In order to complete former results about the main tetraether phospholipid of T. acidophilum [Strobl, C., Six, L., Heckmann, K., Henkel, B., Ring, K., 1985. Z. Naturforsch. 40c, 219-222], the thickness and the two-dimensional organization of the monomolecular films were investigated. Two mean heights values were determined, one of 1.5-1.8 nm and another one of 4-5 nm, indicative for two different molecular arrangements. The former one is interpreted as a 'horseshoe' organization with two polar endings in the aqueous subphase, whereas the latter appears to represent the upright population of molecules with one polar end in the subphase and the other one in the air. In freshly spread and compressed films small domains of the upright lipid population are initially observed, which enlarge with increasing pressure. These domains are no longer existent after 12 h of spreading without compression.     

Purification and characterization of glucose dehydrogenase from the thermoacidophilic archaebacterium Thermoplasma acidophilum.

Glucose dehydrogenase was purified to homogeneity from the thermoacidophilic archaebacterium Thermoplasma acidophilum. The enzyme is a tetramer of polypeptide chain Mr 38,000 +/- 3000, it is catalytically active with both NAD+ and NADP+ cofactors, and it is thermostable and remarkably resistant to a variety of organic solvents. The amino acid composition was determined and compared with those of the glucose dehydrogenases from the archaebacterium Sulfolobus solfataricus and the eubacteria Bacillus subtilis and Bacillus megaterium. The N-terminal amino acid sequence of the Thermoplasma acidophilum enzyme was determined to be: (S/T)-E-Q-K-A-I-V-T-D-A-P-K-G-G-V-K-Y-T-T-I-D-M-P-E.     

Physicochemical characterization of tetraether lipids from Thermoplasma acidophilum. V. Evidence for the existence of a metastable state in lipids with acyclic hydrocarbon chains

The main glycophospholipid of Thermoplasma acidophilum, grown at 39 degrees C, is composed of a di-isopranol-2,3-glycerotetraether. It has been characterized in hydrated systems by calorimetry. Unlike its equivalent grown at 59 degrees C, it shows complex phase properties, which include at least three different phases, (1) a liquid-analogue state (C), which is stable above 20 degrees C, (2) a metastable solid-analogue state (A) formed by supercooling of the liquid-analogue state (C) and (3) a stable solid-analogue state (B), which is slowly formed and may include a close chain packing of lipids and a network of hydrogen bonds between the headgroups. A high fraction of acyclic isopranol chains seems to be a prerequisite for the formation of state (B). A phase diagram, displaying the observed states and the transitions between them is proposed.     

Effects of pH and temperature on the composition of polar lipids in Thermoplasma acidophilum HO-62

Thermoplasma acidophilum HO-62 was grown at different pHs and temperatures, and its polar lipid compositions were determined. Although the number of cyclopentane rings in the caldarchaeol moiety increased when T. acidophilum was cultured at high temperature, the number decreased at low pHs. Glycolipids, phosphoglycolipids, and phospholipids were analyzed by high-performance liquid chromatography with an evaporative light-scattering detector. The amount of caldarchaeol with more than two sugar units on one side increased under low-pH and high-temperature conditions. The amounts of glycolipids increased and those of phosphoglycolipids decreased under these conditions. The proton permeability of the liposomes obtained from the phosphoglycolipids that contained two or more sugar units was lower than that of the liposomes obtained from the phosphoglycolipids that contained one sugar unit. From these results, we propose the hypothesis that T. acidophilum adapts to low pHs and high temperatures by extending sugar chains on their cell surfaces, as well as by varying the number of cyclopentane rings.     

Purification and enzymic characterization of the cytoplasmic pyrophosphatase from the thermoacidophilic archaebacterium Thermoplasma acidophilum.

Cytoplasmic pyrophosphatase has been isolated from the thermoacidophilic archaebacterium Thermoplasma acidophilum. The enzyme was purified to electrophoretic homogeneity by combining ion-exchange and affinity-chromatographic separations. This soluble pyrophosphatase probably consists of six identical subunits, since SDS/PAGE gave an estimate of about 22 kDa for a single subunit and size-exclusion chromatography under non-denaturing conditions indicates a molecular mass of 110 +/- 5 kDa. The two most prominent catalytic features of this enzyme are the absolute requirement for divalent cations for catalytic action, Mg2+ conferring the highest activity, and the pronounced specificity for PPi. The catalytic behavior apparently follows simple Michaelis-Menten kinetics with a Km of about 7 microM for PPi and a specific activity of about 1200 U/mg at 56 degrees C. Surprisingly, maximum activity could be observed at 85 degrees C which is more than 20 degrees C above the temperature for optimal growth. Several cytoplasmic extracts of eubacteria and archaebacteria have been probed with a polyclonal antiserum raised against the purified archaebacterial protein. The only noticeable cross-reactivity could be detected with an extract from the methanogen Methanosarcina barkeri although this probably does not reflect the inferred phylogenetic relationship between methanogens and Thermoplasma acidophilum.     

The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum.

The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH. The homology with the 55 rRNA from another archaebacterial species, Halobacterium cutirubrum, is only 60.6% and other 55 rRNAs are even less homologous. Examination of the potential for forming secondary structure is revealing. T. acidophilum does not conform to the usual models employed for either procaryotic or eucaryotic 5S rRNAs. Instead this 5S rRNA has a mixture of the characteristic features of each. On the whole this 5S rRNA does however appear more eucaryotic than eubacterial. These results give further support to the notion that the archaebacteria represent an extremely early divergence among entities with procaryotic organization.