Expression of hepatic pyruvate carboxylase mRNA in C57BL/6J Ahb/b and congenic Ahd/d mice exposed to 2,3,7,8-tetrachlorodibenzo-p-dioxin

The activity and level of hepatic pyruvate carboxylase (PC) has been reported to be altered by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) treatment in mice. If alteration in PC level/activity by TCDD influences TCDD toxicity, one would expect to observe an early post-exposure reduction in PC mRNA. To examine the molecular events responsible for the alteration of PC activity in livers of TCDD-treated mice, we designed a synthetic DNA oligonucleotide probe specific for PC mRNA. Northern blot analysis on RNA extracts from hepatic tissue at various times and doses post-TCDD exposure were done. Furthermore, to elucidate the role of the dioxin Ah locus on alterations of PC activity by TCDD, we utilized C57BL/6J (Ah^b/b, Ah high TCDD affinity) mice and a congenic (Ah^d/d, Ah low TCDD affinity) mouse strain. At 8 days post TCDD treatment, a dose-dependent reduction of hepatic PC mRNA levels was observed in Ah^b/b mice. The response, reduction in PC mRNA levels, in the Ah^b/b strain was about 10-fold greater than that of comparably exposed congenic Ah^d/d mice. These results indicate that previously reported reductions in PC activity/level by TCDD treatment of mice is a consequence of a reduction in PC mRNA levels and that the effect requires a competent Ah receptor. © 1996 John Wiley & Sons, Inc.     

Zygosity Determination in Hairless Mice by PCR Based on Hrhr Gene Analysis

We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hr^hr allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hr^hr in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hr^hr allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hr^hr (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hr^hr gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age.     

Ah receptor involvement in mediation of pyruvate carboxylase levels and activity in mice given 2,3,7,8-tetrachlorodibenzo-p-dioxin

The arylhydrocarbon receptor (AhR) plays a central role in mediating 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) toxicity in animals. The investigations described here provide evidence that support a role for the AhR in TCDD-mediated pyruvate carboxylase (PC) level/activity reductions in mice. Pyruvate carboxylase plays a pivotal role in gluconeogenesis and in supplying carbon units for the citric acid cycle. Delivered ip in a corn oil carrier, TCDD suppresses PC activity/amount at doses as low as 1 μg/kg in responsive C57BL/6J(Ah^b/b) mice. Corn oil alone injected ip into mice at 4 mL/kg appears to be an inducer that increases the amount and activity of PC. However, TCDD suppresses this induction. In the Ah^b/b mouse, PC levels and activity are reduced to 10% of control values at a dose of 75 μg/kg. A time-course experiment shows that the PC reductions are apparent within 16 hours post-TCDD exposure. Here we report investigations on the PC/TCDD response using a congenic C57BL/6J(Ah^d/d) mouse strain having an AhR with a low affinity for TCDD. If the PC/TCDD response is AhR mediated, the congenic mouse strain (Ah^d/d) would require much higher doses of TCDD to suppress PC. In the Ah^d/d mice, we observe that an approximately 60-fold increase in TCDD dose is necessary to produce a PC/TCDD effect. We also find that in Ah^d/d mice, corn oil does not induce an increase in PC activity/amounts, as reported for Ah^b/b mice.     

DNA,chromatin and chromosomes: By E. M. Bradbury,N. Maclean and H. R. Matthews. New York: Halsted Press (a division of John Wiley and Sons). (1981). 281 pp. $24.95

The Ah locus regulates the induction of cytochrome P₁-450 by foreign chemicals such as 3-methyl-cholanthrene and 2,3,7,8-tetrachlorodibenzo-p-dioxin. The induction process is controlled by the cytosolic Ah receptor. The cytosolic and nuclear Ah receptors were studied in the liver from inbred C57BL/6N (Ah^b/Ah^b) mice, inbred DBA/2N (Ah^d/Ah^d) mice and heterozygotes (Ah^b/Ah^d) and homozygotes (Ah^d/Ah^d) derived from the (C57BL/6N × DBA/2N)F1 × DBA/2N backcross. After [³H-1,6]-2,3,7,8-tetrachlorodibenzo-p-dioxin (³H-TCDD) is given in vivo, the receptor in Ah^b/Ah^b and Ah^b/Ah^d mice is detectable in the cytoplasm and nucleus; in Ah^d/Ah^d mice the receptor is not measurable in the cytosol, but is found in the nucleus at levels one fourth to one fifth of those in Ah^b/Ah^b mice. P₁-450 (23S) mRNA content was estimated by Northern hybridization and by Rot analysis with a mouse P₁-450 cloned cDNA. An excellent dose-response relationship (r = 0.99) was found between the amount of ³H-TCDD-Ah receptor complex appearing in the nucleus and the quantity of P₁-450 mRNA induced in mice with all three possible Ah genotypes.     

Inducible Monooxygenase Activities and 3-Methylcholanthrene-Initiated Tumorigenesis in Mouse Recombinant Inbred Sublines

The induction of a certain group of hepatic monooxygenase activities by polycyclic aromatic compounds is regulated by the same locus or gene cluster controlling the formation of cytochrome P₁–450 (P–448) in mice. Certain inbred strains of mice are "responsive" (Ah^b) to such induction, whereas others are "nonresponsive" (Ah^d). A pair of closely related sublines that differ with respect to the Ah locus (for aromatic hydrocarbon responsiveness) were used to identify or confirm the pleiotropic effects of this gene. The lines were derived by sibling-mating without selection from (C57L/J x AKR/J)F ₂ mice; the two sublines were separated at the F₁₂ generation. Ten microsomal monooxygenase activities and one cytosol enzyme activity known to be associated with the Ah locus were similarly associated with cytochrome P₁–450 formation in these recombinant inbred sublines as well. Nine additional hepatic monooxygenase activities studied were found not to be associated with the Ah locus; certain of these activities were increased slightly, following treatment of nonresponsive as well as responsive mice with polycyclic aromatic compounds. The Ah^b-containing subline was highly susceptible to 3-methylcholanthrene-induced subcutaneous sarcomas, whereas the Ah-^d-containing subline was relatively resistant. These results emphasize the potential importance of this particular enzyme for the study of coordinated regulation in mammals.     

Molecular Basis for the rhino (hr)Phenotype: A Nonsense Mutation in the MousehairlessGene

The hairless (hr) and rhino (hr^rh) mutations are autosomal recessive allelic mutations that map to mouse Chromosome 14. Both hairless and rhino mice have a number of skin and nail abnormalities and develop a striking form of total alopecia at approximately 3–4 weeks of age. The molecular basis of the hairless mouse phenotype was previously found to be the result of a murine leukemia proviral insertion in intron 6 of thehrgene that resulted in aberrant splicing. In this study, we report a 2-bp substitution in exon 4 of thehrgene in a second allele ofhr,rhino 8J (hr^rh-8J), leading to a nonsense mutation. These findings document the molecular basis of the rhino phenotype for the first time and suggest that rhino is a functional knock-out of thehrgene.     

The Effects of Mutant Gene hairless in Chimeric Mice

The autosomal recessive gene hairless (hr) is responsible for the complete hairlessness in mice homozygous for this gene. Hair shedding that begins at the age of 10 days is caused by an abnormal cycle of hair follicle development disturbed at the catagen stage. This results in enhanced programmed cell death (apoptosis) and ultimately leads to the complete hair follicle destruction and shedding of all hairs by the age of three weeks. To study the phenotypic expression of the hr gene in a chimeric organism, we have obtained 12 chimeric mice hr/hr +/+ by means of aggregation of early embryos hr/hr and +/+. In chimeric mice, the hair shedding has begun two days later than in the hr/hr mice. By day 23 of postnatal development, hairless areas were present on the coat of chimeric mice or the latter were completely hairless depending on the percentage of the hr/hr mutant component. In four chimeras with high content of the mutant component (68–76%), the hair shedding process was similar to that in the hr/hr mice, though it was accomplished two days later. In three chimeras with 48–51% of the mutant component, alternating hairless and hair-covered bands were observed. These data suggest that the hr gene acts in epidermal cells of a hair follicle, because epidermal cell clones in embryonic skin migrate in the lateral–ventral direction coherently and without mixing. However, some chimeras displayed a pattern which was not so clear-cut: the band borders were illegible and hairs partly covered the hairless areas. In some chimeras, the uniform thinning of the coat was observed. Analysis of the effects of the hr mutant gene in chimeric mice differing in the ratio between mutant (hr/hr) and normal (+/+) components in tissues suggests that the hrgene acts in the epidermal cells of the hair follicle. The interactions between cells have an essential effect on the mode and degree of the hr gene expression, which leads to distortion of the ectodermal coat pattern in chimeras.     

2,3,7,8-Tetrachlorodibenzo-p-dioxin causes an increase in protein kinases growth hepatic associated with epidermal factor receptor in the plasma membrane

2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD), administered to male rats at a single intraperitoneal (IP) injection dose of 25 μg/kg causes down-regulation of epidermal growth factor (EGF) receptor in the plasma membrane of rat liver which starts after two days and continues throughout the experimental period (20 days). Using monoclonal antibody to EGF receptor, it was determined that TCDD-caused EFG receptor down-regulation in the rat liver was accompanied by increased protein kinase activity. Such an increase in the protein kinase activity involves, at least in part, an activation of protein tyrosine kinase. Examination of serum samples from control and treated rats revealed no detectable difference in the level of EGF itself or EGF receptor-reacting substances (eg, hormones and other growth factors). In vivo TCDD caused early eye opening and tooth eruption and poor body weight gain and hair growth in mouse neonates similar to those observed with exogenously administered EGE The results indicate that such EGF receptor–mediated effect of TCDD has some toxocilogical significance in vivo. Although TCDD causes significant reduction in [¹²⁵I]-EGF binding in the hepatic plasma membrane in susceptible strains of mice, it has only modest effects in tolerant strains. The results are consistent with the idea that the action of TCDD on the EGF receptor is mediated through the cytosoliclnuclear TCDD receptor, which is known to be regulated by the Ah locus.     

Genetic Linkage between the AH Locus and a Major Gene That Inhibits Susceptibility to Audiogenic Seizures in Mice

Mice of the DBA/2 (D2) strain are highly susceptible to sound-induced seizures at 21 days of age; whereas, mice of the C57BL/6 (B6) strain are resistant to these seizures. Although the difference in susceptibility to audiogenic seizures (ASs) between these two strains is inherited as a multiple-factor trait, an association was observed between susceptibility to ASs and the Ah locus. The Ah locus controls the inducibility of aryl hydrocarbon hydroxylase (AHH) activity by a number of aromatic hydrocarbons. B6 mice carry the Ah^b allele and have inducible AHH activity; whereas, D2 mice carry the Ah^d allele and have noninducible activity. Inducibility is inherited as a Mendelian dominant trait in crosses between these strains. Mice carrying the Ah^b allele are generally less susceptible to ASs at 21 days of age than are mice carrying the Ah^d allele. The combined results from B6 x D2 recombinant inbred strains, congenic strains (where the Ah^b allele was placed into the D2 genome and the Ah^d allele placed into the B6 genome), the B6D2F₁ x D2 backcross generation, and a random survey of various inbred strains, suggest that the association between these two traits is due to genetic linkage, rather than to pleiotrophy or to chance. A major gene that inhibits susceptibility to ASs appears to be closely linked to the Ah locus. This gene has been designated Ias, for inhibition of ASs. A large portion of the genetic variability of AS susceptibility may be due to the segregation of Ias.     

Role of endogenous retroviruses as mutagens: the hairless mutation of mice

We have developed an experimental approach to distinguish the 40-60 endogenous C-type proviruses of mice and to determine their association with well characterized developmental and physiological mutations. The hairless (hr) mutation causes a variety of pleiotropic effects. Using oligonucleotide probes specific for different classes of murine leukemia virus, we have identified and cloned a provirus present in HRS/J hr/hr animals but absent in HRS/J +/+. Genetic analyses showed perfect concordance between the hr phenotype and the presence of the provirus in a number of inbred and congenic strains of mice. Molecular analysis of a haired revertant established the causal relationship since it revealed the excision of most of the proviral genome leaving behind one long terminal repeat. These findings show that virus integration caused the hairless mutation and point to the utility of naturally occurring retroviral integrations for accessing the genome of the mouse.     

Genetic expression of aryl hydrocarbon hydroxylase induction. VI. Control of other aromatic hydrocarbon-inducible mono-oxygenase activities at or near the same genetic locus

When mice are administered aromatic hydrocarbons, the induction of aryl hydrocarbon (benzo[a]pyrene) hydroxylase, p-nitroanisole O-demethylase, 7-ethoxycoumarin O-deethylase, and 3-methyl-4-methylaminoazobenzene N-demethylase activities—all membrane-bound mono-oxygenases having cytochrome P₄₅₀ associated with their active sites—is associated with the same genetic locus or with closely linked loci; we have previously proposed that this genetic region be designated the Ah locus for aromatic hydrocarbon responsiveness. Expression of these four inducible enzyme activities occurs as a single autosomal dominant trait in offspring from a genetic cross between inbred C57BL/6N and DBA/2N mice and from the appropriate backcrosses and intercross. There are no striking differences in relative thermolability or ontogenetic expression among these four closely linked aromatic hydrocarbon-induced mono-oxygenase activities. All four of these microsomal enzyme activities exist in two forms—one predominantly present in control or aromatic hydrocarbon-treated genetically nonresponsive mice and the other predominantly present in aromatic hydrocarbon-treated genetically responsive mice; the latter form is preferentially inhibited in vitro by such compounds as α-naphthoflavone. Whether a single induction-specific protein or a group of induction-specific proteins is associated with the Ah locus remains uncertain. The expression of aminopyrine N-demethylase, d-benzphetamine N-demethylase, NADPH-cytochrome c reductase, and NADPH-cytochrome P₄₅₀ reductase activities in aromatic hydrocarbon-treated genetically responsive and nonresponsive mice is not correlated with the Ah locus.     

Strain differences in the induction of mono-oxygenase activity in mouse skin by topical clobetasol propionate: evidence of a role for the hr locus

The effect of the topical application of clobetasol propionate on cutaneous ethoxycoumarin O'dealkylation (EOD) has been studied in various strains of mice. Clobetasol propionate markedly increased cutaneous EOD activity in adult hairless mice only. Similar treatment of adult haired C57BL/6J mice, or adult haired DBA/2J mice had no significant effect on cutaneous EOD activity. In contrast 3 methylcholanthrene induced cutaneous EOD activity in both hairless and C57 strains to a far greater extent than in the DBA strain. EOD activity in hairless mice non-responsive to polycyclic hydrocarbons, derived by selective breeding of hairless and DBA strains was induced by clobetasol propionate to a similar extent to that observed in responsive hairless strains. Hepatic EOD activity was not induced by clobetasol propionate in any of the strains tested. Strain differences in the induction of EOD by clobetasol propionate were not related to differences in either the concentration of cytosolic glucocorticoid receptor in the skin, the dissociation constant of the cytosolic receptor, or differences in percutaneous absorption. Polycyclic hydrocarbons did not compete with triaminolone acetonide for binding to the cytosolic glucocorticoid receptor. Strain differences in the induction of EOD activity by clobetasol propionate appear therefore not to be related to strain differences in either the Ah receptor of the glucocorticoid receptor, but to be regulated by the hr locus.     

Inhibition of UVR‐Induced Tanning and Immunosuppression by Topical Applications of Vitamins C and E to the Skin of Hairless (hr/hr) Mice 1

Exposure of C3HBYB/Wq hairless (hr/hr) mice to ultra‐violet radiation (UVR) for 15 days induced intense tanning of their dorsal skin. Small, dark freckles appeared first, gradually enlarging and coalescing as treatment progressed yielding a uniform tan. Histologically, the gross changes in skin color were matched initially by the appearance of scattered epidermal melanocytes that subsequently proliferated to form discrete, progressively expanding and abutting populations resulting in a uniform melanocyte network throughout the basal layer of the interfollicular epidermis. In contrast, when applied topically before each daily exposure to UVR, a cream or lotion vehicle containing both vitamins C and E (Vits C/E) inhibited UVR‐induced erythema and tanning. Application of Vits C/E, both before and after irradiation, was no more effective in providing photoprotection than pre‐treatment only. At the tissue level, UVR‐induced proliferation and melanogenesis of melanocytes were reduced compared with irradiated controls. The density of individual melanocyte populations was reduced, as was the number of melanocyte populations achieving merger (confluence) with others. Confluence grades and cell counts, estimating the maximum density of melanocyte populations in UVR–Vits C/E‐treated mice, were approximately two thirds those of UVR–vehicle‐treated controls. However, tanning was only one fifth that of UVR–vehicle‐treated controls, suggesting that melanogenesis was also inhibited. In addition to its inhibitory actions on irradiated melanocytes, Vits C/E also inhibited UVR‐induced suppression of contact hypersensitivity (CHS) in haired (Hr/hr) and hr/hr mice of the C3HBYB/Wq strain. The common denominators for most, if not all, of the influences of topically‐applied Vits C/E in muting the responses of the melanocyte and immune systems to UVR may stem from the vitamins’ combined ability to suppress UVR‐stimulated inflammation and its associated cascade of mediators.     

Analysis of the effects of mutant hairless genes in chimeric mice

The autosomal recessive gene hairless (hr) is responsible for the complete hairlessness in mice homozygous for this gene. Hair shedding that begins at the age of 10 days is caused by an abnormal cycle of hair follicle development disturbed at the catagen stage. This results in enhanced programmed cell death (apoptosis) and ultimately leads to the complete hair follicle destruction and shedding of all hairs by the age of three weeks. To study the phenotypic expression of the hr gene in a chimeric organism, we have obtained 12 chimeric mice hr/hr <--> +/+ by means of aggregation of early embryos hr/hr and +/+. In chimeric mice, the hair shedding has begun two days later than in the hr/hr mice. By day 23 of postnatal development, hairless areas were present on the coat of chimeric mice or the latter were completely hairless depending on the percentage of the hr/hr mutant component. In four chimeras with high content of the mutant component (68-76%), the hair shedding process was similar to that in the hr/hr mice, though it was accomplished two days later. In three chimeras with 48-51% of the mutant component, alternating hairless and hair-covered bands were observed. These data suggest that the hr gene acts in epidermal cells of a hair follicle, because epidermal cell clones in embryonic skin migrate in the lateral-ventral direction coherently and without mixing. However, some chimeras displayed a pattern which was not so clear-cut: the band borders were illegible and hairs partly covered the hairless areas. In some chimeras, the uniform thinning of the coat was observed. Analysis of the effects of the hr mutant gene in chimeric mice differing in the ratio between mutant (hr/hr) and normal (+/+) components in tissues suggests that the hr gene acts in the epidermal cells of the hair follicle. The interactions between cells have an essential effect on the mode and degree of the hr gene expression, which leads to distortion of the "ectodermal" coat pattern in chimeras.     

Ah receptor for 2,3,7,8- tetrachlorodibenzo-p-Dioxin: Ontogeny in chick embryo liver

Aryl hydrocarbon hydroxylase (AHH, cytochrome P₁-450) is induced in chick liver very early during embryonic development if embryos are treated with 3-methylcholanthrene–type compounds such as 3,4,3′4′-tetrachlorobiphenyl. In mammals, AHH induction is known to be mediated by the Ah receptor. Liver from embryonic and newly hatched chicks was found to contain a cytosolic receptor for 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) which has properties that are very similar to properties of the Ah receptor previously characterized in mammalian tissues. In chick embryo liver, cytosolic binding sites for TCDD were of high affinity (K_d for [3-H]-TCDD = 0.2 nM) and were specific for 3-methylcholanthrene–type inducers. The specific binding component sedimented at about 9S on sucrose density gradients prepared at low ionic strength. A high level of Ah receptor was detected in chick embryo liver by the fifth day of incubation (5 DI); this is at least 24 hours prior to the onset of AHH inducibility. The Ah receptor concentration increased from 5 DI to 8 DI, the period when chick liver is undergoing early morphological differentiation. After 8 DI, Ah receptor levels dropped substantially and remained low into the posthatching period. In contrast, AHH inducibility was high by 7 DI and remained high throughout embryonic development and into the posthatching period. The discrepancy between Ah receptor levels and the degree of AHH inducibility suggests that only a small fraction of the Ah receptor population is required for maximal AHH induction.     

Gene <Emphasis Type="Italic">angora</Emphasis> as a modifier of the <Emphasis Type="Italic">hairless</Emphasis> gene in mouse

The interaction between mouse angora-Y (Fgf5 ^go-Y) and hairless (hr) genes have been studied. Homozygous mutant gene Fgf5 ^go-Y increases length of all hair types, while homozygotes for the h gene lose hair completely starting on day 14 after birth. We obtained mice with genotypes +/+ hr/hr F₂, +/Fgf5 ^go-Y hr/hr and Fgf5 ^go-Y/Fgf5 ^go-Y hr/hr. Both +/Fgf5 ^go-Y hr/hr and +/+ hr/hr mice began to loose hair from their heads on day 14. This further extended on the whole body. On day 21 the mice were completely deprived of hair. Therefore a single dose of gene Fgf5 ^go-Y does not modify alopecia in mice homozygous for hr. However in double homozygotes Fgf5 ^go-Y/Fgf5 ^go-Y hr/hr alopecia started 4 days later, namely on day 18. It usually finished 10–12 days after detection of first bald patches. On days 28–30 double homozygotes lose coat completely. Hair loss in double homozygous mice was 1.5-fold slower than in +/+ hr/hr mice. This resulted from a significant extension of anagen phase induced by a mutant homozygous gene Fgf5 ^go-Y in morphogenesis of the hair follicle. The hr gene was expressed at the transmission phase from anagen to catagen. Our data shows that the angora gene is a modifier of the hairless gene and this results in a strong repression of alopecia progression in double homozygous mice compared to +/+ hr/hr animals.     

TCDD causes stimulation of c-ras expression in the hepatic plasma membranes in vivo and in vitro

A series of in vivo and in vitro experiments were conducted to determine the effects of 2, 3, 7, 8-tetrachlorodibenzo-p-dioxin (TCDD) administered on the expression of c-ras. Differences in c-ras expression between control and TCDD treated groups were determined by immunoassay of p21^ras protein, or indirectly measured by the specific binding of ³H-GTP to hepatic plasma membrane preparations. Intraperitoneal injection of sublethal doses of TCDD significantly elevated (P < 0.05, Student t test) levels of hepatic p21^ras protein in Sprague-Dawley rats and TCDD sensitive C57BL/6J mice. Such an increase occurred at an early stage of poisoning in the C57BL/6J mice. The earliest increase was detectable 6 hr after dosing, and the differencebecame statistically significant by 12 and 24 hr after dosing. In contrast, TCDD tolerant DBA/2J mice had only a marginal increase in hepatic p21^ras protein which did not become statistically significant even at 24 hr post-dosing. TCDD evoked increases in hepatic p21^ras protein of C57BL/6J mice were accompanied by the increase in the specific binding of GTP to hepatic plasma membranes. Column chromatography of solubilized rat hepatic membrane proteins on sephadex G-50 showed TCDD administration increased levels of a ³H-GTP binding protein with MW of approximately 21 Kd. ³H-GTP binding in total hepatic membranes was also elevated (P<0.05, Fisher PLSD multiple comparison test) 6 hr and 24 hr after dosing of C57BL/6J mice, but as expected the effect of TCDD was not as conspicuous as that found in the plasma membrane. TCDD treatment increased levels of a 21 Kd protein found in the in vitro translation products of RNA purified from guinea pig liver. This protein was identified as a c-ras protein based upon its ability to bind GTP, precipitation by a polyclonal antibody against the rasHa and Ki proteins and subsequent SDS-PAGE which showed a single protein band of ≈ 21 Kd.     

Actions of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) on human epidermal keratinocytes in culture

Summary In humans, the skin is a particularly sensitive target for 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and certain halogenated analogs. Reported lesions include a thickening of the epidermis (acanthosis), hyperkeratosis, and squamous metaplasia of the epithelial lining of the sebaceous glands. In this report we describe ongoing studies on the actions of TCDD on cultured human epidermal cells. This system has been established as an in vitro model for interfollicular epidermal hyperkeratinization. Treatment of newly confluent cultures with TCDD results in enhanced differentiation as judged by histologic examination of the cultures, a decrease in the number of basal proliferating cells, and an increase in the number of envelope competent (differentiating) cells and terminally differentiated cells with highly cross-linked cornified envelopes. Changes in the differentiation program are preceded by a decrease in epidermal growth factor (EGF) binding. The concentration dependence and stereospecificity for these responses suggest the involvement of theAh receptor. We propose that TCDD modulates normal patterns of epidermal differentiation through direct actions on proliferating basal cells, modulating the responsiveness of these cells to growth factors such as EGF. This paper was presented at the Session-In-Depth on In Vitro Applications in Toxicology at the 34th Annual Meeting of the Tissue Culture Association, Orlando, FL, June 12–16, 1983. Rosemarie Osborne was a Chemical Industry Institute of Toxicology Postdoctoral Fellow.     

Effects of epidermal growth factor (EGF), transforming growth factor-alpha (TGFalpha), and 2,3,7,8-tetrachlorodibenzo-p-dioxin on fusion of embryonic palates in serum-free organ culture using wild-type, EGF knockout, and TGFalpha knockout mouse strains

BACKGROUND: 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is teratogenic in mice, producing cleft palate (CP). TCDD exposure disrupts expression of epidermal growth factor (EGF) receptor, EGF, and transforming growth factor-alpha (TGFalpha) in the palate and affects proliferation and differentiation of medial epithelial cells. EGF knockout embryos are less susceptible to the induction of CP by TCDD. This study used palate organ culture to examine the hypothesis that EGF enables a response to TCDD. METHODS: The midfacial tissues from wild-type (WT), EGF knockout, C57BL/6J, and TGFalpha knockout embryos were placed in organ culture on gestational day (GD) 12. Palatal explants were cultured for 4 days in serum-free Bigger's (BGJ) medium with 0.1% dimethyl sulfoxide (DMSO) or 1 x 10(-8) M TCDD with or without 2 ng of EGF/ml, 1 or 2 ng of TGFalpha/ml. Effects on palatal fusion were evaluated on day 4 of culture. EGF levels in explants and medium were determined using Luminex technology. RESULTS: In serum-free, control medium, palates from all of the strains fused. EGF knockout palates cultured with TCDD (no EGF) fused, but those cultured with TCDD + 2 ng of EGF/ml failed to fuse (p < 0.05 vs. control or TCDD without EGF). TGFalpha knockout palates failed to fuse when cultured with TCDD + 2 ng of TGFalpha/ml. EGF levels increased in tissue and accumulated in the medium after 24 hr of culture. CONCLUSIONS: This study demonstrated that providing EGF to the palates of EGF knockout mice restored the response to TCDD. These studies support the hypothesis that the mechanism for induction of CP by TCDD is mediated via the EGFR pathway.