The importance of individual nucleotides for the structure and function of rRNA molecules in E. coli. A mutagenesis study

Methods of in vitro mutagenesis were employed to determine the importance of individual nucleotides within the ribosomal RNAs for the structure and function of E. coli ribosomes. A series of defined nucleotides in the genes for the 5 S and 16 S RNA were altered by transition and transversion mutations using either oligonucleotide-directed or bisulfite-catalyzed mutation procedures. Plasmids harbouring the mutated rRNA genes were expressed and the ribosomes containing such altered RNAs were investigated for impairments in RNA-protein interaction assembly and mRNA-coded tRNA binding.     

Effect of growth rate on the amounts of ribosomal and transfer ribonucleic acids in yeast.

The steady-state growth rate of Saccharomyces cerevisiae was varied by growing the cells in different media. The total amount of ribonucleic acid (RNA) per cell was found to decrease as a nonlinear function of decreasing growh rate. The RNA from cells growing in different media was analyzed by polyacrylamide gel electrophoresis. Although the amounts of both ribosomal RNA and transfer RNA decreased with decreasing growth rate, the ratio of ribosomal to transfer RNA was not constant. As the growth rate was reduced the ribosomal RNA fraction decreased slightly, whereas the transfer RNA fraction increased slightly. Thus the levels of ribosomal and transfer RNA were regulated to similar yet different extents. The levels of the different ribosomal RNA species were more closely coordinated. At all growth rates the ribosomal RNAs (including 5S RNA) were present in equimolar amounts. The rate of protein synthesis in yeast cells also decreased with decreasing growth rate. The low rates of protein synthesis did not appear to be due to limiting numbers of ribosomes or transfer RNA molecules.     

The degradation of ribonucleic acids injected into Xenopus laevis oocytes

Different radioactive RNAs were injected into Xenopus laevis oocytes, and their degradation followed with time. Deproteinized ribosomal RNAs and synthetic polynucleotides, with the exception of polyadenylic acid, were degraded rapidly with apparent first order kinetics and half-lives ranging from 1–6 hr. Transfer RNA, poly(A), and ribosomal RNA injected as whole ribosomal particles were quite stable during the period studied (20 hr). Messenger RNAs from Dictyostelium discoideum and Vesicular Stomatitis Virus, which have poly(A) sequences at their 3′ terminus, presented biphasic degradation kinetics. Approximately 60% of these RNAs was degraded in the first 6 hr, whereas the remaining 30–40% was stable for at least 22 hr. Analysis of the stable material by sucrose gradients showed that it had the same sedimentation pattern as the original material, except that it contained, in addition, free poly(A) sequences sedimenting somewhat smaller than 4S. Puromycin treatment of the cells injected with Dictyostelium mRNAs reduced the percentage of stable RNA to 10%, approximately the poly(A) content of these RNAs. Similar treatment with emetine, which also inhibited cellular protein synthesis, did not affect the stable mRNA fraction.     

RNA binding proteins in the RNA interference phenomenon

The ability of short RNAs (21-27 nucleotides) to silence genes containing homologous nucleotide sequences is related to RNA silencing. The pathways of short RNAs (siRNA and microRNA) biogenesis from their precursors, double stranded and hairpin RNAs respectively, are briefly reviewed. The functioning of specific RNA binding domains found for the first time in the proteins operating in RNA interference (RNAi) is considered. The interactions of these domains with the earlier well known RNA binding modules in RNAi proteins are described.     

2′-5′-Oligoadenylate synthetase is activated by a specific RNA sequence motif

2′-5′-Oligoadenylate synthetase plays a central role in the cellular innate antiviral response. Although activation of 2′-5′-oligoadenylate synthetase by double stranded RNA was discovered more than 30 years ago it is still unclear which sequence features are required by an RNA to activate the enzyme. A pool of chemically synthesized short double stranded RNAs of specific sequence was used to probe 2′-5′-oligoadenylate synthetase activation. It was found that activating double stranded RNAs contain the following motif: NNWWNNNNNNNNNWGN. Verification of this sequence motif in a pool of 102 small double stranded RNAs demonstrated a false positive prediction rate of 8% and a false negative prediction rate of 12%. The sequence motif identified provides mechanistic insight into the mechanism of 2′-5′-oligoadenylate synthetase activation by double stranded RNA and allows theoretical predictions whether a given RNA molecule has the capability to activate 2′-5′-oligoadenylate synthetase.     

The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.     

SELECTIVE RETENTION AND FILTRATION OF BRAIN NUCLEIC ACIDS IN AGAROSE GELS

Abstract— Total nucleic acids of rat brain have been separated by agarose gel chromatography at 2 m -NaCl into DNA. transfer RNA plus low molecular weight RNA. and high molecular weight RNA fractions. The DNA fraction contained less than 1 per cent RNA by weight judged by either short-term or long-term labelling with ortho[³²P]phosphate. The high molecular weight RNA fraction contained 28 s and 18 s ribosomal RNAs and a heterogeneous population of 20-60 s RNAs, apparent after short-term labelling and characterized by a high content of nearest-neighbour-labelled uridylic acid. The rapidly sedimenting (>30 s ) portion of these RNAs could be largely separated from ribosomal RNAs by gel filtration using 4% agarose. The ribosomal RNAs could be fully resolved into 28 s and 18 s components by agarose gel chromatography at 0.5 m -0.6 m -NaCl, as shown by analysis of their sedimentation and nucleotide composition.     

Evolutionary changes in the higher order structure of the ribosomal 5S RNA.

Comparative studies have been undertaken on the higher order structure of ribosomal 5S RNAs from diverse origins. Competitive reassociation studies show that 5S RNA from either a eukaryote or archaebacterium will form a stable ribonucleoprotein complex with the yeast ribosomal 5S RNA binding protein (YL3); in contrast, eubacterial RNAs will not compete in a similar fashion. Partial S1 ribonuclease digestion and ethylnitrosourea reactivity were used to probe the structural differences suggested by the reconstitution experiments. The results indicate a more compact higher order structure in eukaryotic 5S RNAs as compared to eubacteria and suggest that the archaebacterial 5S RNA contains features which are common to either group. The potential significance of these results with respect to a generalized model for the tertiary structure of the ribosomal 5S RNA and to the heterogeneity in the protein components of 5S RNA-protein complexes are discussed.     

Destabilization of the secondary structure of RNA by ribosomal protein S1 from escherichia coli

S1 is an acidic protein associated with the 3′ end of 16S RNA; it is indispensable for ribosomal binding of natural mRNA. We find that S1 unfolds single stranded stacked or helical polynucleotides (poly rA, poly rC, poly rU). It prevents the formation of poly (rA + rU) and poly (rI + rC) duplexes at 10–25 mM NaCl but not at 50–100 mM NaCl. Partial, salt reversible denaturation is also seen with coliphage MS2 RNA, $\text{E. coli}$ rRNA and tRNA. Generally, only duplex structures with a Tm greater than about 55° are formed in the presence of S1. The protein unfolds single stranded DNA but not poly d(A·T).     

Binding of 4'-aminomethyl 4,5',8-trimethyl psoralen to DNA, RNA and protein in HeLa cells and Drosophila cells.

In Drosophila cells and HeLa cells treated with 4'-aminomethyl trioxsalen and ultraviolet light, this compound binds covalently to DNA and RNA. The maximum number of molecules bound to 10(3) base pairs in DNA is 60 and in RNA it is 20. In nuclei treated likewise the number of molecules bound to 10(3) base pairs in DNA can be as high as 376. When cells are irradiated in the frozen state the number of 4'-aminomethyl trioxsalen molecules bound per 10(3) base pairs in DNA is about 40 and in RNA about 20. DNA molecules from cells or nuclei treated with 4'-aminomethyl trioxsalen and ultraviolet light are highly crosslinked and appear as loops interspersed by double stranded regions when analyzed in the electron microscope under denaturing conditions. The loop sizes are heterogeneous and the fraction of double stranded regions increases to almost complete double-strandedness at high degrees of reaction. No secondary structures could be found in ribosomal RNA from Drosophila cells or HeLa cells after treatment with 4'-aminomethyl trioxsalen and ultraviolet light. In cells treated with 4'-aminomethyl trioxsalen and ultraviolet light the RNAase activity is increased considerably suggesting a release of lysosomal enzymes. 4'-aminomethyl trioxsalen and its photodecomposition products bind strongly to cellular proteins.     

On the role of rRNA tertiary structure in recognition of ribosomal protein L11 and thiostrepton.

Ribosomal protein L11 and an antibiotic, thiostrepton, bind to the same highly conserved region of large subunit ribosomal RNA and stabilize a set of NH4(+)-dependent tertiary interactions within the domain. In vitro selection from partially randomized pools of RNA sequences has been used to ask what aspects of RNA structure are recognized by the ligands. L11-selected RNAs showed little sequence variation over the entire 70 nucleotide randomized region, while thiostrepton required a slightly smaller 58 nucleotide domain. All the selected mutations preserved or stabilized the known secondary and tertiary structure of the RNA. L11-selected RNAs from a pool mutagenized only around a junction structure yielded a very different consensus sequence, in which the RNA tertiary structure was substantially destabilized and L11 binding was no longer dependent on NH4+. We propose that L11 can bind the RNA in two different 'modes', depending on the presence or absence of the NH4(+)-dependent tertiary structure, while thiostrepton can only recognize the RNA tertiary structure. The different RNA recognition mechanisms for the two ligands may be relevant to their different effects on protein synthesis.     

Depurination of ribosomal RNA and inhibition of viral RNA translation by an antiviral protein of Celosia cristata

An antiviral protein (25 kD) isolated from leaves of Celosia cristata (CCP 25) was tested for depurination study on ribosomal RNA from yeast. Ribosomal RNA yielded 360 nucleotide base fragment after treatment with CCP 25 indicating that CCP 25 was a ribosome inactivating protein. CCP 25 also inhibited translation of brome mosaic virus (BMV) and pokeweed mosaic virus (PMV) RNAs in rabbit reticulocyte translation system. The radioactive assay showed that incorporation of [35S]-methionine was less in translation proteins of BMV nucleic acid when CCP 25 was added to translation system. This indicated that antiviral protein from Celosia cristata not only depurinated ribosomal RNA but also inhibited translation of viral RNA in vitro.     

Photoreactivating enzyme from Escherichia coli: isolated enzyme lacks absorption in its actinic wavelength region and its ribonucleic acid cofactor is partially double stranded when associated with apoprotein

Isolated photoreactivating enzyme (PRE) from Escherichia coli exhibits some optical density at wavelengths greater than 300 nm. After correcting for the effects of light scattering, however, we find no true absorption in the spectral region that is required for enzymatic activity (320-450 nm). At shorter wavelengths, there is an absorption maximum near 260 nm that is due primarily to an RNA cofactor. Heating to 60 degrees C and subsequently cooling to 4 degrees C release the RNA cofactor from association with apoprotein and result in hyperchromicity. Circular dichroism indicates that the RNA associated with native enzyme is partially double stranded. At low ionic strength (mu = 0.01), heating to 15 degrees C or protease treatment at 4 degrees C results in irreversible loss of part of the double strandedness. We show that the difference spectrum at 4 degrees C between the absorption spectra of native enzyme and heat-treated enzyme can be fit by a superposition of reference spectra for denaturation of A-U and G-C base pairs derived from model polynucleotides. The coefficients of the linear combination of reference spectra were used to calculate the fraction of A-U and G-C base pairs. We find that both A-U and G-C base pairs are present in equal concentrations and that about 20% are in a double-stranded conformation in the native enzyme.     

Three helical domains form a protein binding site in the 5S RNA-protein complex from eukaryotic ribosomes.

A ribosomal protein binding site in the eukaryotic 5S rRNA has been delineated by examining the effect of sequence variation and nucleotide modification on the RNA's ability to exchange into the EDTA-released, yeast ribosomal 5S RNA-protein complex. 5S RNAs of divergent sequence from a variety of eukaryotic origins could be readily exchanged into the yeast complex but RNA from bacterial origins was rejected. Nucleotide modifications in any of three analogous helical regions in eukaryotic 5S RNAs of differing origin reduced the ability of this RNA molecule to form homologous or heterologous RNA-protein complexes. Because sequence comparisons did not indicate common nucleotide sequences in the interacting helical regions, a model is suggested in which the eukaryotic 5S RNA binding protein does not simply recognize specific nucleotide sequences but interacts with three strategically oriented helical domains or functional groups within these domains. Two of the domains bear a limited sequence homology with each other and contain an unpaired nucleotide or "bulge" similar to that recently reported for one of the 5S RNA binding proteins in Escherichia coli (Peattie, D.A., Douthwaite, S., Garrett, R.A. and Noller, H.F. (1981) Proc. Natl. Acad. Sci. 78, 7331-7335). The results further indicate that the single ribosomal protein of eukaryotic 5S RNA-protein complexes interacts with the same region of the 5S rRNA molecule as do the multiple protein components in complexes of prokaryotic origin.     

Secondary structure of prokaryotic 5S ribosomal ribonucleic acids: a study with ribonucleases

The structures of 5S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus were examined by using ribonucleases A, T1, and T2 and a double helix specific cobra venom ribonuclease. By using both 5' and 3'-32P-end labeling methods and selecting for digested but intact 5S RNA molecules, we were able to distinguish between primary and secondary cutting positions and also to establish the relative degree of cutting. The data reveal the predicted similarities of the higher order structure in the two RNAs but also demonstrate a few significant differences. The data also provide direct evidence for three of the helical regions of the Fox and Woese model of 5S RNA [Fox, G. E., & Woese, C. (1975) Nature (London) 256, 505] and support other important structural features which include a nucleotide looped out from a helical region which has been proposed as a recognition site for protein L18.     

Stiffness of viroids and viroid-like RNA in solution.

The sedimentation coefficients of the potato spindle tuber viroid, four viroid-like RNAs from cadang-cadang-disease, circular RNA from velvet tobacco mottle virus, circular RNA from Solanum nodiflorum mottle virus and double stranded RNA5 from cucumber mosaic virus were measured in the analytical ultracentrifuge. The numbers of nucleotides of the RNA species varied between 246 and 670. The hydrodynamic models of rigid rods and flexible cylinders were applied for the interpretation of the sedimentation coefficients. Double-stranded RNA5 from cucumber mosaic virus with 335 basepairs fits the model of a rigid rod with an hydrated diameter of 29 A. Potato spindle tuber viroid and the four viroid-like RNA species of cadang-cadang-disease form a homologous series of flexible cylinders with a Kuhn's statistical length lambda-1 of 600 A. The circular RNA from the two viruses mentioned above are more flexibel than the viroids and viroid-like RNAs. The hydrodynamic interpretation is in accordance with thermodynamic data and secondary structure models. In two of the RNAs from cadang-cadang, cruciform structures would also be possible on the basis of the nucleotide sequence. The hydrodynamic data, however, favour clearly the extended structure over the cruciform.     

Fine structure of ribosomal RNA: I. Conservation of homologous regions within ribosomal RNA of eukaryotes

By molecular hybridization experiments the homologies between ribosomal RNAs from a unicellular organism (Gyrodinium cohnii), three invertebrates (Drosophila hydei, Chironomus thummi, Sciara coprophila), an amphibian (Xenopus laevis), and a mammal (mouse) were determined. Competition hybridization experiments demonstrated that portions of these homologous regions are the same in all the ribosomal RNAs tested, regardless of animal species. This conclusion based on hybridization data was confirmed by comparative fingerprint analysis. The ribosomal RNA sequences involved in heterologous hybridization have a higher A + T composition than the bulk ribosomal RNA. It appears from competition experiments of a heterologous hybridization that two thirds of the conserved similar regions are present in 18 S ribosomal RNA, and the remaining one third in 28 S ribosomal RNA. It is argued that these similar regions have been conserved during evolution due to their structural and/or functional role in ribosomal RNA.     

The mechanism of action of trichosanthin on eukaryotic ribosomes--RNA N-glycosidase activity of the cytotoxin.

Trichosanthin is a ribosome-inactivating protein from root tubers of Trichosanthes kirilowii Maxim. In this paper, the mechanism of action of trichosanthin on eukaryotic ribosomes was studied. A fragment of about 450 nucleotides was released from 28S ribosomal RNA after treatment of rat liver ribosome with trichosanthin and its isolated ribosomal RNAs were treated with aniline. Analysis of nucleotide sequence of 5' terminus of this fragment revealed that the aniline-sensitive site of the phosphodiester bond was between positions A4324 and G4325 in the 28S rRNA. Adenine was recovered by ion-exchange column chromatography from the 50% ethanol soluble fraction of the reaction mixture in which rat liver ribosomes were treated with trichosanthin. Thin-layer chromatographic analysis indicated that 1 mol of adenine was released from 1 mol of ribosomes. When the ribosomes were incubated with trichosanthin in the presence of inorganic [32P]phosphate, little incorporation of radioactivity into 28S rRNA was observed, indicating that the release of adenine was not mediated by phosphorolysis. These results demonstrate that trichosanthin inactivates the ribosomes by cleaving the N-C glycosidic bond of adenylic acid at 4324 of 28S rRNA in a hydrolytic fashion.