Molecular dynamics simulations of DNA curvature and flexibility: helix phasing and premelting

Recent studies of DNA axis curvature and flexibility based on molecular dynamics (MD) simulations on DNA are reviewed. The MD simulations are on DNA sequences up to 25 base pairs in length, including explicit consideration of counterions and waters in the computational model. MD studies are described for ApA steps, A-tracts, for sequences of A-tracts with helix phasing. In MD modeling, ApA steps and A-tracts in aqueous solution are essentially straight, relatively rigid, and exhibit the characteristic features associated with the B'-form of DNA. The results of MD modeling of A-tract oligonucleotides are validated by close accord with corresponding crystal structure results and nuclear magnetic resonance (NMR) nuclear Overhauser effect (NOE) and residual dipolar coupling (RDC) structures of d(CGCGAATTCGCG) and d(GGCAAAAAACGG). MD simulation successfully accounts for enhanced axis curvature in a set of three sequences with phased A-tracts studied to date. The primary origin of the axis curvature in the MD model is found at those pyrimidine/purine YpR "flexible hinge points" in a high roll, open hinge conformational substate. In the MD model of axis curvature in a DNA sequence with both phased A-tracts and YpR steps, the A-tracts appear to act as positioning elements that make the helix phasing more precise, and key YpR steps in the open hinge state serve as curvature elements. Our simulations on a phased A-tract sequence as a function of temperature show that the MD simulations exhibit a premelting transition in close accord with experiment, and predict that the mechanism involves a B'-to-B transition within A-tracts coupled with the prediction of a transition in key YpR steps from the high roll, open hinge, to a low roll, closed hinge substate. Diverse experimental observations on DNA curvature phenomena are examined in light of the MD model with no serious discrepancies. The collected MD results provide independent support for the "non-A-tract model" of DNA curvature. The "junction model" is indicated to be a special case of the non-A-tract model when there is a Y base at the 5' end of an A-tract. In accord with crystallography, the "ApA wedge model" is not supported by MD.     

Axis Curvature and Ligand Induced Bending in the CAP-DNA Oligomers

The origin of DNA axis curvature in complexes of the catabolite activator protein with DNA is studied using multiple molecular dynamics (MD) simulations of the free and protein-bound forms of the DNA. The results are compared to available solution and crystal structure data. The MD simulations reproduce the experimentally observed bend in DNA and indicate that ∼40% of the bending observed in the complex is intrinsic to the DNA sequence, whereas ∼60% is induced on protein binding. The MD provides a model for the dynamical structure of the DNA free in solution and for ligand-induced bending.     

Molecular dynamics simulations of papilloma virus E2 DNA sequences: dynamical models for oligonucleotide structures in solution

The specificity of papilloma virus E2 protein-DNA binding depends critically upon the sequence of a region of the DNA not in direct contact with the protein, and represents one of the simplest known examples of indirect readout. A detailed characterization of this system in solution is important to the further investigation hypothesis of a structural code for DNA recognition by regulatory proteins. In the crystalline state, the E2 DNA oligonucleotide sequence, d(ACCGAATTCGGT), exhibits three different structural forms. We report herein studies of the structure of E2 DNA in solution based on a series of molecular dynamics (MD) simulations including counterions and water, utilizing both the canonical and various crystallographic structures as initial points of departure. All MDs converged on a single dynamical structure of d(ACCGAATTCGGT) in solution. The predicted structure is in close accord with two of the three crystal structures, and indicates that a significant kink in the double helix at the central ApT step in the other crystal molecule may be a packing effect. The dynamical fine structure was analyzed on the basis of helicoidal parameters. The calculated curvature in the sequence was found to originate primarily from YPR steps in the regions flanking the central AATT tract. In order to study the role of structural adaptation of the DNA in the binding process, a subsequent simulation on the 16-mer cognate sequence d(CAACCGAATTCGGTTG) was initiated from the crystallographic coordinates of the bound DNA in the crystal structure of the protein DNA complex. MD simulations starting with the protein-bound form relaxed rapidly back to the dynamical structure predicted from the previous simulations on the uncomplexed DNA. The MD results show that the bound form E2 DNA is a dynamically unstable structure in the absence of protein, and arises as a consequence of both structural changes intrinsic to the sequence and induced by the interaction with protein.     

A 5-nanosecond molecular dynamics trajectory for B-DNA: analysis of structure, motions, and solvation.

We report the results of four new molecular dynamics (MD) simulations on the DNA duplex of sequence d(CGCGAATTCGCG)2, including explicit consideration of solvent water, and a sufficient number of Na+ counterions to provide electroneutrality to the system. Our simulations are configured particularly to characterize the latest MD models of DNA, and to provide a basis for examining the sensitivity of MD results to the treatment of boundary conditions, electrostatics, initial placement of solvent, and run lengths. The trajectories employ the AMBER 4.1 force field. The simulations use particle mesh Ewald summation for boundary conditions, and range in length from 500 ps to 5.0 ns. Analysis of the results is carried out by means of time series for conformationalm, helicoidal parameters, newly developed indices of DNA axis bending, and groove widths. The results support a dynamically stable model of B-DNA for d(CGCGAATTCGCG)2 over the entire length of the trajectory. The MD results are compared with corresponding crystallographic and NMR studies on the d(CGCGAATTCGCG)2 duplex, and placed in the context of observed behavior of B-DNA by comparisons with the complete crystallographic data base of B-form structures. The calculated distributions of mobile solvent molecules, both water and counterions, are displayed. The calculated solvent structure of the primary solvation shell is compared with the location of ordered solvent positions in the corresponding crystal structure. The results indicate that ordered solvent positions in crystals are roughly twice as structured as bulk water. Detailed analysis of the solvent dynamics reveals evidence of the incorporation of ions in the primary solvation of the minor groove B-form DNA. The idea of localized complexation of otherwise mobile counterions in electronegative pockets in the grooves of DNA helices introduces an additional source of sequence-dependent effects on local conformational, helicoidal, and morphological structure, and may have important implications for understanding the functional energetics and specificity of the interactions of DNA and RNA with regulatory proteins, pharmaceutical agents, and other ligands.     

Molecular dynamics of a DNA Holliday junction: the inverted repeat sequence d(CCGGTACCGG)₄

All-atom molecular dynamics (MD) computer simulations have been applied successfully to duplex DNA structures in solution for some years and found to give close accord with observed results. However, the MD force fields have generally not been parameterized against unusual DNA structures, and their use to obtain dynamical models for this class of systems needs to be independently validated. The four-way junction (4WJ), or Holliday junction, is a dynamic DNA structure involved in central cellular processes of homologous replication and double strand break repair. Two conformations are observed in solution: a planar open-X form (OPN) with a mobile center and four duplex arms, and an immobile stacked-X (STX) form with two continuous strands and two crossover strands, stabilized by high salt conditions. To characterize the accuracy of MD modeling on 4WJ, we report a set of explicit solvent MD simulations of ～100 ns on the repeat sequence d(CCGGTACCGG)₄ starting from the STX structure (PDB code 1dcw), and an OPN structure built for the same sequence. All 4WJ MD simulations converged to a stable STX structure in close accord with the crystal structure. Our MD beginning in the OPN form converts to the STX form spontaneously at both high and low salt conditions, providing a model for the conformational transition. Thus, these simulations provide a successful account of the dynamical structure of the STX form of d(CCGGTACCGG)₄ in solution, and provide new, to our knowledge, information on the conformational stability of the junction and distribution of counterions in the junction interior.     

Molecular dynamics simulations of DNA and a protein-DNA complex including solvent

The results of a recent nanosecond (ns) molecular dynamics (MD) simulation of the d(CGCGAATTCGCG) double helix in water and a 100 ps MD study of the repressor-operator complex are described. The DNA simulations are analyzed in terms of the structural dynamics, fluctuations in the groove width and bending of the helical axis. The results indicate that the ns dynamical trajectory progresses through a series of three substates of B form DNA, with lifetimes of the order of hundreds of picoseconds (ps). An incipient dynamical equilibrium is evident. A comparison of the calculated axis bending with that observed in corresponding crystal structure data is presented. Simulation of the DNA in complex with the protein and that of the free DNA in solution, starting from the crystal conformation, reveal the dynamical changes that occur on complex formation.     

Assessment of the molecular dynamics structure of DNA in solution based on calculated and observed NMR NOESY volumes and dihedral angles from scalar coupling constants

To assess the accuracy of the molecular dynamics (MD) models of nucleic acids, a detailed comparison between MD-calculated and NMR-observed indices of the dynamical structure of DNA in solution has been carried out. The specific focus of our comparison is the oligonucleotide duplex, d(CGCGAATTCGCG)(2), for which considerable structural data have been obtained from crystallography and NMR spectroscopy. An MD model for the structure of d(CGCGAATTCGCG)(2) in solution, based on the AMBER force field, has been extended with a 14 ns trajectory. New NMR data for this sequence have been obtained in order to allow a detailed and critical comparison between the calculated and observed parameters. Observable two-dimensional (2D) nuclear Overhauser effect spectroscopy (NOESY) volumes and scalar coupling constants were back-calculated from the MD trajectory and compared with the corresponding NMR data. The comparison of these results indicate that the MD model is in generally good agreement with the NMR data, and shows closer accord with experiment than back-calculations based on the crystal structure of d(CGCGAATTCGCG)(2) or the canonical A or B forms of the sequence. The NMR parameters are not particularly sensitive to the known deficiency in the AMBER MD model, which is a tendency toward undertwisting of the double helix when the parm.94 force field is used. The MD results are also compared with a new determination of the solution structure of d(CGCGAATTCGCG)(2) using NMR dipolar coupling data.     

DNA structure: what's in charge?

DNA structure is well known to be sensitive to hydration and ionic strength. Recent theoretical predictions and experimental observations have raised the idea of the intrusion of monovalent cations into the minor groove spine of hydration in B-form DNA. To investigate this further, extensions and further analysis of molecular dynamics (MD) simulations on d(CGCCGAATTCGCG), d(ATAGGCAAAAAATAGGCAAAAATGG) and d(G(5)-(GA(4)T(4)C)(2)-C(5)), including counterions and water, have been performed. To examine the effective of minor groove ions on structure, we analyzed the MD snapshots from a 15 ns trajectory on d(CGCGAATTCGCG) as two subsets: those exhibiting a minor groove water spine and those with groove-bound ions. The results indicate that Na(+) at the ApT step of the minor groove of d(CGCCGAATTCGCG) makes only small local changes in the DNA structure, and these changes are well within the thermal fluctuations calculated from the MD. To examine the effect of ions on the differential stability of a B-form helix, further analysis was performed on two longer oligonucleotides, which exhibit A-tract-induced axis bending localized around the CpG step in the major groove. Plots of axis bending and proximity of ions to the bending locus were generated as a function of time and revealed a strong linear correlation, supporting the idea that mobile cations play a key role in local helix deformations of DNA and indicating ion proximity just precedes the bending event. To address the issue of "what's in charge?" of DNA structure more generally, the relative free energy of A and B-form d(CGCGAATTCGCG) structures from MD simulations under various environmental circumstances were estimated using the free energy component method. The results indicate that the dominant effects on conformational stability come from the electrostatic free energy, but not exclusively from groove bound ions per se, but from a balance of competing factors in the electrostatic free energy, including phosphate repulsions internal to the DNA, the electrostatic component of hydration (i.e. solvent polarization), and electrostatic effects of the counterion atmosphere. In summary, free energy calculations indicate that the electrostatic component is dominant, MD shows temporal proximity of mobile counterions to be correlated with A-track-induced bending, and thus the mobile ion component of electrostatics is a significant contributor. However, the MD structure of the dodecamer d(CGCGAATTCGCG) is not highly sensitive to whether there is a sodium ion in the minor groove.     

Conformational interconversion in compstatin probed with molecular dynamics simulations

Compstatin is a 13-residue cyclic peptide that has the potential to become a therapeutic agent against unregulated complement activation. In our effort to understand the structural and dynamic characteristics of compstatin that form the basis for rational and combinatorial optimization of structure and activity, we performed 1-ns molecular dynamics (MD) simulations. We used as input in the MD simulations the ensemble of 21 lowest energy NMR structures, the average minimized structure, and a global optimization structure. At the end of the MD simulations we identified five conformations, with populations ranging between 9% and 44%. These conformations are as follows: 1) coil with alphaR-alphaR beta-turn, as was the conformation of the initial ensemble of NMR structures; 2) beta-hairpin with epsilon-alphaR beta-turn; 3) beta-hairpin with alphaR-alphaR beta-turn; 4) beta-hairpin with alphaR-beta beta-turn; and 5) alpha-helical. Conformational switch was possible with small amplitude backbone motions of the order of 0.1-0.4 A and free energy barrier crossing of 2-11 kcal/mol. All of the 21 MD structures corresponding to the NMR ensemble possessed a beta-turn, with 14 structures retaining the alphaR-alphaR beta-turn type, but the average minimized structure and the global optimization structures were converted to alpha-helical conformations. Overall, the MD simulations have aided to gain insight into the conformational space sampled by compstatin and have provided a measure of conformational interconversion. The calculated conformers will be useful as structural and possibly dynamic templates for optimization in the design of compstatin using structure-activity relations (SAR) or dynamics-activity relations (DAR).     

Conformational transitions of flanking purines in HIV-1 RNA dimerization initiation site kissing complexes studied by CHARMM explicit solvent molecular dynamics

Dimerization of HIV-1 genomic RNA is initiated by kissing loop interactions at the Dimerization Initiation Site (DIS). Dynamics of purines that flank the 5' ends of the loop-loop helix in HIV-1 DIS kissing complex were explored using explicit solvent molecular dynamics (MD) simulations with the CHARMM force field. Multiple MD simulations (200 ns in total) of X-ray structures for HIV-1 DIS Subtypes A, B, and F revealed conformational variability of flanking purines. In particular, the flanking purines, which in the starting X-ray structures are bulged-out and stack in pairs, formed a consecutive stack of four bulged-out adenines at the beginning of several simulations. This conformation is seen in the crystal structure of DIS Subtype F with no interference from crystal packing, and was frequently reported in our preceding MD studies performed with the AMBER force field. However, as CHARMM simulations progressed, the four continuously stacked adenines showed conformational transitions from the bulged-out into the bulged-in geometries. Although such an arrangement has not been seen in any X-ray structure, it has been suggested by a recent NMR investigation. In CHARMM simulations, in the longer time scale, the flanking purines display the tendency to move to bulged-in conformations. This is in contrast with the AMBER simulations, which indicate a modest prevalence for bulged-out flanking base positions in line with the X-ray data. The simulations also suggest that the intermolecular stacking between purines from the opposite hairpins can additionally stabilize the kissing complex.     

In meso crystal structure and docking simulations suggest an alternative proteoglycan binding site in the OpcA outer membrane adhesin

OpcA is an integral outer membrane adhesin protein from Neisseria meningitidis, the causative agent of meningococcal meningitis and septicemia. It binds to sialic acid (SA)-containing polysaccharides on the surface of epithelial cells. The crystal structure of OpcA showed that the protein adopts a 10-stranded beta-barrel structure, with five extensive loop regions on the extracellular side of the membrane. These form a crevice structure, lined with basic residues, which was hypothesized to act as the binding site for polysaccharide ligands. In the current study, a distinctly different OpcA structure has been obtained using crystals grown from a lipidic mesophase. Comparison of the two structures shows that the largest loop (L2), which closes over the end of the beta-barrel in the original crystal form, adopts a much more extended structure by reaching outward and away from the protein. The difference in conformation may be attributable to the absence of zinc ions from the crystallization conditions for the in meso crystal form: in the original structure, two zinc ions were bound to the external loops. Molecular dynamics (MD) simulations performed on the two OpcA models in a lipid bilayer environment demonstrated pronounced loop mobility. These observations support the view that the loop regions of OpcA are capable of a high degree of conformational flexibility. The original binding site for polysaccharide is not present in the in meso crystal form, and is disrupted during MD simulations. Docking analysis suggests a putative alternative location for the SA ligand in the new crystal form of OpcA.     

X-ray structure of the nucleosome core particle

Two monoclinic crystal forms (P2(1),C2) of chicken erythrocyte nucleosomes have been under study in this laboratory. The x-ray structure of the P2(1) crystal form has been solved to 15 A resolution. The B-DNA superhelix has a relatively uniform curvature, with only several local distortions observed in the superhelix. The individual histone domains have been localized and specific contacts between each histone and the DNA can be observed. Histone contacts to the inner surface of the DNA superhelix occur predominantly at the minor groove sites. Most of the histone core is contained within the inner surface of the superhelical DNA, except for part of H2A which extends between the DNA gyres near the terminus of the DNA. No part of H2A blocks the DNA terminus or would prevent a smooth exit of the DNA into the linker region. A similar extension of a portion of histone H4 between the DNA gyres occurs close to the dyad axis. Both unique nucleosomes in the P2(1) asymmetric unit demonstrate good dyad symmetry and are similar to each other throughout the histone core and DNA regions.     

Dynamics of Ca2+-saturated calmodulin D129N mutant studied by multiple molecular dynamics simulations

Fifteen independent 1-nsec MD simulations of fully solvated Ca(2+) saturated calmodulin (CaM) mutant D129N were performed from different initial conditions to provide a sufficient statistical basis to gauge the significance of observed dynamical properties. In all MD simulations the four Ca(2+) ions remained in their binding sites, and retained a single water ligand as observed in the crystal structure. The coordination of Ca(2+) ions in EF-hands I, II, and III was sevenfold. In EF-hand IV, which was perturbed by the mutation of a highly conserved Asp129, an anomalous eightfold Ca(2+) coordination was observed. The Ca(2+) binding loop in EF-hand II was observed to dynamically sample conformations related to the Ca(2+)-free form. Repeated MD simulations implicate two well-defined conformations of Ca(2+) binding loop II, whereas similar effect was not observed for loops I, III, and IV. In 8 out of 15 MD simulations Ca(2+) binding loop II adopted an alternative conformation in which the Thr62 >C=O group was displaced from the Ca(2+) coordination by a water molecule, resulting in the Ca(2+) ion ligated by two water molecules. The alternative conformation of the Ca(2+) binding loop II appears related to the "closed" state involved in conformational exchange previously detected by NMR in the N-terminal domain fragment of CaM and the C-terminal domain fragment of the mutant E140Q. MD simulations suggest that conformations involved in microsecond exchange exist partially preformed on the nanosecond time scale.     

Crystal structure of a Z-DNA hexamer d(CGCICG) at 1.7 A resolution: inosine.cytidine base-pairing, and comparison with other Z-DNA structures.

The crystal structure of the deoxyhexamer, d(CGCICG), has been determined and refined to a resolution of 1.7A. The DNA hexamer crystallises in space group P2(1)2(1)2(1) with unit cell dimensions of a = 18.412 +/- .017 A, b = 30.485 +/- .036A, and c = 43.318 +/- .024 A. The structure has been solved by rotation and translation searches and refined to an R-factor of 0.148 using 2678 unique reflections greater than 1.0 sigma (F) between 10.0-1.7 A resolution. Although the crystal parameters are similar to several previously reported Z-DNA hexamers, this inosine containing Z-DNA differs in the relative orientation, position, and crystal packing interactions compared to d(CGCGCG) DNA. Many of these differences in the inosine form of Z-DNA can be explained by crystal packing interactions, which are responsible for distortions of the duplex at different locations. The most noteworthy features of the inosine form of Z-DNA as a result of such distortions are: (1) sugar puckers for the inosines are of C4'-exo type, (2) all phosphates have the Zl conformation, and (3) narrower minor grove and compression along the helical axis compared to d(CGCGCG) DNA. In addition, the substitution of guanosine by inosine appears to have resulted in Watson-Crick type base-pairing between inosine and cytidine with a potential bifurcated hydrogen bond between inosine N1 and cytidine N3 (2.9 A) and O2 (3.3-3.A).     

Molecular dynamics simulations of Alzheimer's beta-amyloid protofilaments

Filamentous amyloid aggregates are central to the pathology of Alzheimer's disease. We use all-atom molecular dynamics (MD) simulations with explicit solvent and multiple force fields to probe the structural stability and the conformational dynamics of several models of Alzheimer's beta-amyloid fibril structures, for both wild-type and mutated amino acid sequences. The structural models are based on recent solid state NMR data. In these models, the peptides form in-register parallel beta-sheets along the fibril axis, with dimers of two U-shaped peptides located in layers normal to the fibril axis. Four different topologies are explored for stacking the beta-strand regions against each other to form a hydrophobic core. Our MD results suggest that all four NMR-based models are structurally stable, and we find good agreement with dihedral angles estimated from solid-state NMR experiments. Asp23 and Lys28 form buried salt-bridges, resulting in an alternating arrangement of the negatively and positively charged residues along the fibril axis that is reminiscent of a one-dimensional ionic crystal. Interior water molecules are solvating the buried salt-bridges. Based on data from NMR measurements and MD simulations of short amyloid fibrils, we constructed structural models of long fibrils. Calculated X-ray fiber diffraction patterns show the characteristics of packed beta-sheets seen in experiments, and suggest new experiments that could discriminate between various fibril topologies.     

Molecular dynamics simulations of the d(CCAACGTTGG)(2) decamer: influence of the crystal environment

Molecular dynamics (MD) simulations of the DNA duplex d(CCAACGTTGG)(2) were used to study the relationship between DNA sequence and structure. Two crystal simulations were carried out; one consisted of one unit cell containing two duplexes, and the other of two unit cells containing four duplexes. Two solution simulations were also carried out, one starting from canonical B-DNA and the other starting from the crystal structure. For many helicoidal parameters, the results from the crystal and solution simulations were essentially identical. However, for other parameters, in particular, alpha, gamma, delta, (epsilon - zeta), phase, and helical twist, differences between crystal and solution simulations were apparent. Notably, during crystal simulations, values of helical twist remained comparable to those in the crystal structure, to include the sequence-dependent differences among base steps, in which values ranged from 20 degrees to 50 degrees per base step. However, in the solution simulations, not only did the average values of helical twist decrease to approximately 30 degrees per base step, but every base step was approximately 30 degrees, suggesting that the sequence-dependent information may be lost. This study reveals that MD simulations of the crystal environment complement solution simulations in validating the applicability of MD to the analysis of DNA structure.     

The ABCs of molecular dynamics simulations on B-DNA, circa 2012

This article provides a retrospective on the ABC initiative in the area of all-atom molecular dynamics (MD) simulations including explicit solvent on all tetranucleotide steps of duplex B-form DNA duplex, ca. 2012. The ABC consortium has completed two phases of simulations, the most current being a set of 50-100 trajectories based on the AMBER ff99 force field together with the parmbsc0 modification. Some general perspectives on the field of MD on DNA and sequence effects on DNA structure are provided, followed by an overview our MD results, including a detailed comparison of the ff99/parmbsc0 results with crystal and NMR structures available for d(CGCGAATTCGCG). Some projects inspired by or related to the ABC initiative and database are also reviewed, including methods for the trajectory analyses, informatics of dealing with the large database of results, compressions of trajectories for efficacy of distribution, DNA solvation by water and ions, parameterization of coarse-grained models with applications and gene finding and genome annotation.