Retroviral Oligonucleotide Distributions Correlate with Biased Nucleotide Compositions of Retrovirus Sequences,Suggesting a Duplicative Stepwise Molecular Evolution

A computer-assisted analysis was made of 24 complete nucleotide sequences selected from the vertebrate retroviruses to represent the ten viral groups. The conclusions of this analysis extend and strengthen the previously made hypothesis on the Moloney murine leukemia virus: The evolution of the nucleotide sequence appears to have occurred mainly through at least three overlapping levels of duplication: (1) The distributions of overrepresented (3–6)-mers are consistent with the universal rule of a trend toward TG/CT excess and with the persistence of a certain degree of symmetry between the two strands of DNA. This suggests one or several original tandemly repeated sequences and some inverted duplications. (2) The existence of two general core consensuses at the level of these (3–6)-mers supports the hypothesis of a common evolutionary origin of vertebrate retroviruses. Consensuses more specific to certain sequences are compatible with phylogenetic trees established independently. The consensuses could correspond to intermediary evolutionary stages. (3) Most of the (3–6)-mers with a significantly higher than average frequency appear to be internally repeated (with monomeric or oligomeric internal iterations) and seem to be at least partly the cause of the bias observed by other researchers at the level of retroviral nucleotide composition. They suggest a third evolutionary stage by slippage-like stepwise local duplications. Received: 3 January 1996 / Accepted: 27 March 1996     

The 3'-orf protein of human immunodeficiency virus 2 shows sequence homology with the bel3 gene of the human spumaretrovirus

The primary amino acid sequence within a domain of 89 residues of the central part of the 3'-orf protein (p27 3'-orf) of human immunodeficiency virus (HIV-2) shares homology with the middle and carboxy-terminal portion of the bel3 gene product of human spumaretrovirus (HSRV). In addition, a limited region of the tat protein of HIV-2 but not HIV-1 shows a 28% degree of homology to the deduced protein sequence of the bel1 gene product of HSRV. Comparison between the viral sequences suggests that the 3'-orf and bel1 gene product of HSRV could serve similar functions to those in HIV-2.     

The Ds1 controlling element family in maize andTripsacum

Summary Hybridization experiments indicated that the maize genome contains a family of sequences closely related to the Ds1 element originally characterized from theAdh1-Fm335 allele of maize. Examples of these Ds1-related segments were cloned and sequenced. They also had the structural properties of mobile genetic elements, i.e., similar length and internal sequence homology with Ds1, 10- or 11-bp terminal inverted repeats, and characteristic duplications of flanking genomic DNA. All sequences with 11-bp terminal inverted repeats were flanked by 8-bp duplications, but the duplication flanking one sequence with 10-bp inverted repeats was only 6 bp. Similar Ds1-related sequences were cloned fromTripsacum dactyloides. They showed no more divergence from the maize sequences than the individual maize sequences showed when compared with each other. No consensus sequence was evident for the sites at which these sequences had inserted in genomic DNA.     

The evolution of protein sequences by repetitious gene duplication: Clostridial flavodoxin

Summary Internal regularities of amino acid sequences of flavodoxins, FMN-containing, low molecular weight flavoproteins, were statistically examined using the minimum mutation method. The sequence ofClostridium pasteurianum flavodoxin shows statistically significant evidence of repetitious internal gene duplications at different levels of structure. Peptide pairs with a low chance probability of occurrence were frequently observed at a shift of 5 residues. The pairs with the lowest chance probabilites are a pair of heptapeptides at positions 39–45 vs. 44–50, a 5 residue shift (p = 9 × 10^–6). Most of the related pairs are consistent and could best be explained by the repeating pentapeptide sequence: (Lys-Gly-Ala-Asp-Val-)_n and appropriate gaps. Internal repetitions with longer shifts were also suggested for other flavodoxins. Repetitious gene duplication is proposed for the early stages of flavodoxin evolution.     

Structure of simian virus 40 recombinants that contain both host and viral DNA sequences. I. The structure of variant CVPS/1/P2 (EcoRI res).

The entire nucleotide sequence (1210-base-pair repeating units) of a defective variant of simian virus 40 is presented. Within this variant there are deletions of large portions of the wild type genome and an inversion within the remaining wild type viral sequences. In addition, the defective variant contains DNA sequences derived from the permissive monkey cells in which the virus was propagated. The monkey sequences include a portion that is homologous to sequences within highly repeated monkey DNA (alpha component) as well as portions derived from sequences that are infrequently repeated in the monkey genome. One out of every three to four of the tandem 1210-base-pair repeat units contains in addition, a duplication of a part of the monkey sequences. The sequence information defines the structures of a number of recombinational joints which result from deletions, inversions, duplications, and insertions of host sequences into the viral genome. The data demonstrate that the various recombinational events that resulted in the formation of this defective variant did not depend on extensive homology between recombining segments.     

Molecular characterization and sequencing of antifreeze proteins from larvae of the beetle Dendroides canadensis

The deduced amino acid sequences of antifreeze proteins (AFPs) from larvae of the beetle Dendroides canadensis were determined from both complementary DNAs (cDNAs) and from peptide sequencing. These consisted of proteins with a 25-residue signal peptide and mature proteins 83 (Dendroides antifreeze protein; DAFP-1) or 84 (DAFP-2) amino acids in length which differed at only two positions. Peptide sequencing yielded sequences which overlapped exactly with those of the deduced cDNA sequences of DAFP-1 and DAFP-2, while the partial sequence of another AFP (DAFP-3) matched 21 of 28 residues. Seven 12- or 13-mer repeating units are present in these antifreeze proteins with a consensus sequence consisting of: Cys-Thr-X₃-Ser-X₅-X₆-Cys-X₈-X₉-Ala-X₁₁-Thr-X₁₃, where X₃ and X₁₁ tend toward charged residues, X₅ tends toward threonine or serine, X₆ toward asparagine or aspartate, X₉ toward asparagine or lysine, and X₁₃ toward alanine in the 13-mers. The most interesting feature of these proteins is that throughout the length of the mature antifreeze proteins every sixth residue is a cysteine. These sequences are not similar to any of the known fish AFPs, but they are similar to AFPs from the beetle Tenebrio molitor. Accepted: 14 November 1997     

Genus specificity and extensive methylation of the W chromosome-specific repetitive DNA sequences from the domestic fowl,Gallus gallus domesticus

Two female-specific repeating DNA units of 0.6 kilobase pairs (kb) and 1.1 kb, produced by digesting the genomic DNA of the White Leghorn chicken with Xho I, were cloned by inserting them into the Xho I site of an Escherichia coli plasmid vector pACYC177. Two such recombinant plasmids, pAGD0601 and pAGD1101, containing a single 0.6-kb and 1.1-kb sequence, respectively, were used as molecular probes. In situ hybridization of the ³Hprobes to the metaphase chromosomes from the female White Leghorn embryos revealed their localization in the W chromosome. Semiquantitative Southern blot hybridization with ³²P-probes in excess indicated that the 0.6-kb unit and 1.1-kb unit were repeated approximately 14,000 and 6,000 times, respectively, in the W chromosome. The two units comprised about 46% of the W chromosomal DNA. These two repeating units were found in the female genomes of every line of Gallus g. domesticus tested and in the female genomes of three jungle fowl species (G. gallus, G. sonneratii, and G. varius) but not in three species belonging to other genera in the suborder Galli. Hha I sites in the 0.6-kb and 1.1-kb repeating units were shown to be extensively methylated and a significant fraction of the Hpa II sites in the 0.6-kb repeating units were also shown to be methylated in the female genome of the White Leghorn. Methylation patterns of Hpa II sites in or around the 0.6-kb repeating units examined by the Msp I digestion were similar in the various lines of domestic fowls and the two species of jungle fowls, but G. varius (black or green jungle fowl) produced a different pattern of digestion with Msp I.     

Molecular Characterization of Lengthy Mitochondrial DNA Duplications from the Parasitic Nematode Romanomermis Culicivorax

Complete nucleotide sequences, precise endpoints and coding potential of several 3.0-kilobase mitochondrial DNA (mtDNA) repeating units derived from two isofemale lineages of the mermithid nematode Romanomermis culicivorax have been determined. Endpoint analysis has allowed us to infer deletion and inversion events that most likely generated the present day repeat configuration. Each amplified unit contains the genes for NADH dehydrogenase subunits 3 and 6 (ND3 and ND6), an open reading frame (ORF 1) that represents a cytochrome P450-like gene, and three additional unidentified open reading frames. The primary nucleotide sequences of the R. culicivorax mt-repeat copies within individual haplotypes are highly conserved; three nearly complete copies of the repeat unit vary by 0.01% at the nucleotide level. These observations suggest that concerted evolution mechanisms may be active, resulting in sequence homogenation of these lengthy duplications.     

Sequence analysis of bovine satellite I DNA (1.715 gm/cm3).

The 1402 bp Eco RI repeating unit of bovine satellite I DNA (rho CsCl = 1.715 gm/cm3) has been cloned in pBR322. The sequence of this cloned repeat has been determined and is greater than 97% homologous to the sequence reported for another clone of satellite I (48) and for uncloned satellite I DNA (49). The internal sequence structure of the Eco RI repeat contains imperfect direct and inverted repeats of a variety of lengths and frequencies. The most outstanding repeat structures center on the hexanucleotide CTCGAG which, at a stringency of greater than 80% sequence homology, occurs at 26 locations within the RI repeat. Two of these 6 bp units are found within the 31 bp consensus sequence of a repeating structure which spans the entire length of the 1402 bp repeat (49). The 31 bp consensus sequence contains an internal dodecanucleotide repeat, as do the consensus sequences of the repeat units determined for 3 other bovine satellite DNAs (rho CsCl = 1.706, 1.711a, 1.720 gm/cm3). Based on this evidence, we present a model for the evolutionary relationship between satellite I and the other bovine satellites.     

Novel Repetitive Structures, Deviant Protein-Encoding Sequences andUnidentified ORFs in the Mitochondrial Genome of the BrachiopodLingula anatina

Complete sequence determination of the brachiopod Lingula anatina mtDNA (28,818 bp) revealed an organization that is remarkably atypical for an animal mt-genome. In addition to the usual set of 37 animal mitochondrial genes, which make up only 57% (16,555 bp) of the entire sequence, the genome contains lengthy unassigned sequences. All the genes are encoded in the same DNA strand, generally in a compact way, whereas the overall gene order is highly divergent in comparison with known animal mtDNA. Individual genes are generally longer and deviate considerably in sequence from their homologues in other animals. The genome contains two major repeat regions, in which 11 units of unassigned sequences and six genes (atp8, trnM, trnQ, trnV, and part of cox2 and nad2) are found in repetition, in the form of nested direct repeats of unparalleled complexity. One of the repeat regions contains unassigned repeat units dispersed among several unique sequences, novel repetitive structure for animal mtDNAs. Each of those unique sequences contains an open reading frame for a polypeptide between 80 and 357 amino acids long, potentially encoding a functional molecule, but none of them has been identified with known proteins. In both repeat regions, tRNA genes or tRNA gene-like sequences flank major repeated units, supporting the view that those structures play a role in the mitochondrial gene rearrangements. Although the intricate repeated organization of this genome can be explained by recurrent tandem duplications and subsequent deletions mediated by replication errors, other mechanisms, such as nonhomologous recombinations, appear to explain certain structures more easily.     

Analysis of a 1963-bp polymorphic region flanking the human insulin gene

The nucleotide sequence of a long polymorphic region located 365 bp upstream from the human insulin gene is reported. The region is composed of 139 repeating sequences whose consensus structure is related to ACAGGGGTGTGGGG. Expansion in the number of repeating sequences appears to have taken place through duplication and triplication of 112–141-bp regions. However, ancestral polymorphic regions containing additions or deletions of 50 bp or more were not detected in two previous generations.     

Cloning and molecular characterization of a novel x-type glutenin gene Glu-D(t)1 from Aegilops tauschii

A novel gene encoding an x-type high molecular weight glutenin subunit (HMW-GS), designated 1Dx1.1 ^t , was isolated from Aegilops tauschii. It is the largest HMW-GS gene reported so far in this species and its product has a slower mobility than that of subunit 1Ax1 in SDS-PAGE. The open reading frame (ORF) of the gene was 2,628 bp, encoding a protein of 874 amino acid residues. Comparisons of amino acid sequences showed that subunit 1Dx1.1^t had high similarity with other 1Dx subunits but also had two unique characteristics. Firstly, a tripeptide of consensus LQE present in the N-terminal domains of other 1Dx subunits was absent from subunit Dx1.1^t. Secondly, three copies of tandem duplications of the tripeptide motif GQQ and a novel tripeptide sequence (GQL) were present in its central repetitive domain. Phylogenetic analysis showed that subunit 1Dx1.1^t clustered with other known 1Dx subunits.     

Sequence analysis of Vicia faba highly repeated DNA: the BamHI repeated sequence families

Cleavage of Vicia faba nuclear DNA with the restriction endonuclease BamHI yielded discrete size classes of 250, 850, 900, 990, 1 150, 1 500 and 1 750 bp of highly repetitive DNA. Each of these sequence families comprised about 3% of the total genomic DNA. Some sequence members from each sequence family were cloned in pBR322 and their primary structures determined. Computer analyses of nucleotide sequences suggested the existence of about 60 bp sequence periodicity within the repeating unit of the 990 bp sequence family, though the extent of homology among the surmised shorter subrepeat units was very low. With other BamHI sequence families, however, the data did not show any clear internal sequence periodicity. The repeat units of the 850 bp and 1 750 bp sequence families contained nucleotide sequences homologous to the 250 bp family sequence. No sequence relationship between or among other sequence families was observed. There was 13–25% sequence variation among 6 cloned members of the 250 bp family and probably also among those of other BamHI repeat families. DNA sequences homologous to these V. faba BamHI repeat families were detected in Pisum sativum DNA by Southern blot hybridization. Furthermore, very weak cross-hybridization was observed with plant DNAs from Phaseolus vulgaris, Triticum aestivum, Cucumis sativus and Trillium kamtschaticum.     

The wheat ribosomal DNA spacer region: Its structure and variation in populations and among species

Summary The wheat rDNA clone pTA250 was examined in detail to provide a restriction enzyme map and the nucleotide sequence of two of the eleven, 130 bp repeating units found within the spacer region. The 130 bp units showed some sequence heterogeneity. The sequence difference between the two 130 bp units analysed (130.6 and 130.8) was at 7 positions and could be detected as a 4 °C shift in Tm when heterologous and homologous hybrids were compared. This corresponded to a 1.2% change in nucleotide sequence per Tm of 1 °C. The sensitivity of the Tm analysis using cloned sequences facilitated the analysis of small sequence variations in the spacer region of different Triticum aestivum cultivars and natural populations of T. turgidum ssp. dicoccoides (referred to as T. dicoccoides). In addition spacer length variation was assayed by restriction enzyme digestion and hybridization with spacer sequence probes.Extensive polymorphism was observed for the spacer region in various cultivars of T. aestivum, although within each cultivar the rDNA clusters were homogeneous and could be assigned to particular chromosomes. Within natural populations of T. dicoccoides polymorphism was also observed but, once again, within any one individual the rDNA clusters appeared to be homogeneous. The polymorphism, at the sequence level (assayed by Tm analysis), was not so great as to prevent the use of spacer sequence variation as a probe for evolutionary relationships. The length variation as assayed by restriction enzyme digestion did not appear to be as useful in this regard, since its range of variation was extensive even within populations of a species.     

Evidence for a modular structure of the homologous repetitive C-terminal carbohydrate-binding sites of Clostridium difficile toxins and Streptococcus mutans glucosyltransferases.

The homologous C-terminal repeats of Clostridium difficile toxins (ToxA and ToxB) and streptococcal glucosyltransferases appear to mediate protein-carbohydrate interactions at cellular binding sites with sugar moieties as substrates. A consensus sequence of 134 repeating units from gram-positive bacteria indicates that these repeats have a modular design with (i) a stretch of aromatic amino acids proposed to be involved in the primary carbohydrate-protein interaction, (ii) an amplification of this interaction by repetition of the respective sequences, and (iii) a second domain, not characterized, that is responsible for carbohydrate specificity.     

Characterization of four VNTR loci on human Chromosome 6

We have determined DNA sequences of four VNTR loci; three in the peritelomeric region of Chromosome (Chr) 6q and one at 6p21. Heterozygosities of these loci among 80 CEPH parents are 78% (D6S139), 69% (D6S149), 76% (D6S161), and 94% (D6S193), respectively. The consensus sequences of repeating units at these VNTR loci are GAGCGGGCAGGGGCAGCGGGGCCTGGCCAGAGAG-(34 bp) at D6S139, CCAGGCTGGTTCACAGGCTGTGGGGTGTGATGGGTGATG (39 bp) at D6S149, GGATGGGGTTGGAGGAACTACAGAGCGGTGGTGAAGAGGA (40 bp) at D6S161, and GAGGAGGTGGGGCCT (16 bp) at D6S193. The GC content of the consensus sequences is 62% as high as reported previously. Furthermore, we have established a PCR assay for D6S193 locus and this will be useful for individual identification or for a study of loss of heterozygosity on the long arm of Chr 6 in malignant tumors.     

TA-periodic (“601”-like) centromeric nucleosomes of A. thaliana

The bulk of strong nucleosomes (SNs, with visibly periodic DNA sequences) is described by consensus pattern of 5 or 6 base runs of purines alternating with similar runs of pyrimidines – RR/YY SNs. Yet, the strongest known nucleosome positioning sequence, the 601 clone of Lowary and Widom, is rather periodic repetition of TA dinucleotides following one another every 10 bases. We located “601”-like TA-periodic sequences in the genome of A. thaliana. Several families of such sequences are discovered repeating almost exclusively in centromeres. Thus, while A. thaliana SNs of RR/YY type have strong affinity to pericentromeric regions, as it has been previously found, the SNs of TA periodic type concentrate rather in centromeres.     

Heat Shock Protein 70 Family: Multiple Sequence Comparisons, Function, and Evolution

The heat shock protein 70 kDa sequences (HSP70) are of great importance as molecular chaperones in protein folding and transport. They are abundant under conditions of cellular stress. They are highly conserved in all domains of life: Archaea, eubacteria, eukaryotes, and organelles (mitochondria, chloroplasts). A multiple alignment of a large collection of these sequences was obtained employing our symmetric-iterative ITERALIGN program (Brocchieri and Karlin 1998). Assessments of conservation are interpreted in evolutionary terms and with respect to functional implications. Many archaeal sequences (methanogens and halophiles) tend to align best with the Gram-positive sequences. These two groups also miss a signature segment [about 25 amino acids (aa) long] present in all other HSP70 species (Gupta and Golding 1993). We observed a second signature sequence of about 4 aa absent from all eukaryotic homologues, significantly aligned in all prokaryotic sequences. Consensus sequences were developed for eight groups [Archaea, Gram-positive, proteobacterial Gram-negative, singular bacteria, mitochondria, plastids, eukaryotic endoplasmic reticulum (ER) isoforms, eukaryotic cytoplasmic isoforms]. All group consensus comparisons tend to summarize better the alignments than do the individual sequence comparisons. The global individual consensus ``matches' 87% with the consensus of consensuses sequence. A functional analysis of the global consensus identifies a (new) highly significant mixed charge cluster proximal to the carboxyl terminus of the sequence highlighting the hypercharge run EEDKKRRER (one-letter aa code used). The individual Archaea and Gram-positive sequences contain a corresponding significant mixed charge cluster in the location of the charge cluster of the consensus sequence. In contrast, the four Gram-negative proteobacterial sequences of the alignment do not have a charge cluster (even at the 5% significance level). All eukaryotic HSP70 sequences have the analogous charge cluster. Strikingly, several of the eukaryotic isoforms show multiple mixed charged clusters. These clusters were interpreted with supporting data related to HSP70 activity in facilitating chaperone, transport, and secretion function. We observed that the consensus contains only a single tryptophan residue and a single conserved cysteine. This is interpreted with respect to the target rule for disaggregating misfolded proteins. The mitochondrial HSP70 connections to bacterial HSP70 are analyzed, suggesting a polyphyletic split of Trypanosoma and Leishmania protist mitochondrial (Mt) homologues separated from Mt-animal/fungal/plant homologues. Moreover, the HSP70 sequences from the amitochondrial Entamoeba histolytica and Trichomonas vaginalis species were analyzed. The E. histolytica HSP70 is most similar to the higher eukaryotic cytoplasmic sequences, with significantly weaker alignments to ER sequences and much diminished matching to all eubacterial, mitochondrial, and chloroplast sequences. This appears to be at variance with the hypothesis that E. histolytica rather recently lost its mitochondrial organelle. T. vaginalis contains two HSP70 sequences, one Mt-like and the second similar to eukaryotic cytoplasmic sequences suggesting two diverse origins. Received: 29 January 1998 / Accepted: 14 May 1998     

Structure of the human hemopexin gene and evidence for intron-mediated evolution

Summary The human hemopexin gene was isolated and its structure determined. The gene spans approximately 12 kb and is interrupted by nine introns. When the intron/exon pattern was examined with respect to the polypeptide segments they encode, a direct correspondence between exons and the 10 repeating units in the protein was observed. The introns are not randomly placed; they fall in the middle of the region of amino acid sequence homology in strikingly similar locations in 6 of the 10 units and in a symmetrical position in the two halves of the coding sequence. These features strongly support the hypothesis that the gene evolved through intron-mediated duplications of a primordial sequence to a five-exon cluster. A more recent gene duplication led to the present-day gene organization.