Characterization of the polyadenylation signal of influenza virus RNA.

It has been shown that a stretch of uridines (U's) near the 5' end of the virion RNA of influenza A virus is the polyadenylation site for viral mRNA synthesis. In addition, the RNA duplex made up the 3' and 5' terminal sequences adjacent to the U stretch is also involved in polyadenylation. We have further characterized the polyadenylation signal of influenza virus RNA with a ribonucleoprotein transfection system. We found that the optimal length of the U stretch is 5 to 7 uridine residues. We also showed that the upstream sequence at the 5' end is not involved in polyadenylation and that the optimal distance between the 5' end and the U stretch is 16 nucleotides. The combination of these features defines the polyadenylation site and differentiates this signal from other U stretches scattered throughout the genomes of influenza viruses.     

Molecular structure and flanking nucleotide sequences of the natural chicken ovomucoid gene

Five independent clones containing the natural chicken ovomucoid gene have been isolated from a chicken gene library. One of these clones, CL21, contains the complete ovomucoid gene and includes more than 3 kb of DNA sequences flanking both termini of the gene. Restriction endonuclease mapping, electron microscopy and direct DNA sequencing analyses of this clone have revealed that the ovomucoid gene is 5.6 kb long and codes for a messenger RNA of 821 nucleotides. The structural gene sequence coding Ifor the mature messenger RNA is split into at least eight segments by a minimum of seven intervening sequences of various sizes. The shortest structural gene segment is only 20 nucleotides long. All seven intervening sequences are located within the peptide coding region of the gene, and the sequences at the 5' and 3' untranslated regions of the mRNA are not interrupted by intervening sequences. The DNA sequences of the regions flanking the 5' and 3' termini of the gene have been determined. Thirty nucleotides before the start of the messenger RNA coding sequence is the heptanucleotide TATATAT, which is also present in a similar location relative to the chicken ovalbumin gene and other unique sequence eucaryotic genes. This sequence resembles that of the Pribnow box in procaryotic genes where a promoter function has been implicated. Seven nucleotides past the 3' end of the gene is the tetranucleotide TTGT, a sequence found to be present at identical locations as either TTTT or TTGT in other eucaryotic genes that have been sequenced. These conserved DNA sequences flanking eucaryotic genes may serve some regulator function in the expression of these genes.     

Evidence that the respiratory syncytial virus polymerase is recruited to nucleotides 1 to 11 at the 3' end of the nucleocapsid and can scan to access internal signals

The 3'-terminal end of the respiratory syncytial virus genomic RNA contains a 44-nucleotide leader (Le) region adjoining the gene start signal of the first gene. Previous mapping studies demonstrated that there is a promoter located at the 3' end of Le, which can signal initiation of antigenome synthesis. The aim of this study was to investigate the role of the 3' terminus of the RNA template in (i) promoter recognition and (ii) determining the initiation site for antigenome synthesis. A panel of minigenomes containing additional sequence at the 3' end of the Le were analyzed for their ability to direct antigenome and mRNA synthesis. Minigenomes containing heterologous extensions of 6 nucleotides or more were unable to support efficient RNA synthesis. However, the activity of a minigenome with a 56-nucleotide extension could be restored by insertion of Le nucleotides 1 to 11 or 1 to 13 at the 3' end, indicating that these nucleotides, in conjunction with the 3' terminus, are sufficient to recruit polymerase to the template. Northern blot and 5' rapid amplification of cDNA ends analysis of antigenome RNA indicated that antigenome initiation occurred at the first position of Le, irrespective of the terminal extension. This finding demonstrates that the 3' terminus of the RNA is not necessary for determining the antigenome initiation site. Data are presented which suggest that following recruitment to a promoter at the 3' end of Le, the polymerase is able to scan and respond to a promoter signal embedded within the RNA template.     

Influenza B virus genome: sequences and structural organization of RNA segment 8 and the mRNAs coding for the NS1 and NS2 proteins.

Double-stranded DNA derived from influenza B virus genome RNA segment 8, which codes for the NS1 and NS2 proteins, was constructed by hybridization of full-length cDNA copies of RNA segment 8 and of the NS1 mRNA. This DNA was cloned in plasmid pBR322 and sequenced. The NS1 mRNA (approximately 1,080 viral nucleotides) contains nonviral nucleotides at its 5' end and is capable of coding for a protein of 281 amino acids. Sequencing of the NS2 mRNA has shown that it contains an interrupted sequence of 655 nucleotides and is most likely synthesized by a splicing mechanism. The first approximately 75 virus-specific nucleotides at the 5' end of the NS2 mRNA are the same as are found at the 5' -end of the NS1 mRNA. This region contains the initiation codon for protein synthesis and coding information for 10 amino acids common to the two proteins. The approximately 350-nucleotide body region of the NS2 mRNA can be translated in the +1 reading frame, and the sequence indicates that the NS1 and NS2 protein-coding regions overlap by 52 amino acids translated from different reading frames. Thus, between the influenza A and B viruses, the organization of the NS1 and NS2 mRNAs and the sizes of the NS2 mRNA and protein are conserved despite the larger size of the influenza B virus RNA segment, NS1 mRNA, and NS1 protein.     

The sequence of 967 amino acids at the carboxyl-end of rat thyroglobulin. Location and surroundings of two thyroxine-forming sites

The entire rat thyroglobulin mRNA sequence (about 8500 nucleotides) has been cloned in five recombinant plasmids containing overlapping cDNA inserts. The 3' end of the mRNA is precisely defined by the poly (A) tail found in the furthest 3' end clone. Evidence that most of the 5' end is cloned come from size considerations and from a primer extension experiment. At the 3' end of the mRNA only one long open reading frame is present in the sequence of 3018 nucleotides that has been established. In the deduced protein sequence we have localized two thyroxine-forming sites in a region containing a high concentration of tyrosine residues.     

Binding of ribosomes to the 5' leader sequence (N = 258) of RNA 3 from alfalfa mosaic virus.

RNA 3 of alfalfa mosaic virus (AlMV) contains information for two genes: near the 5' end an active gene coding for a 35 Kd protein and, near the 3' end, a silent gene coding for viral coat protein. We have determined a sequence of 318 nucleotides which contains the potential initiation codon for the 35 Kd protein at 258 nucleotides from the 5' end. This long leader sequence can form initiation complexes containing three 80 S ribosomes. A shorter species of RNA, corresponding to a molecule of RNA 3 lacking the cap and the first 154 nucleotides (RNA 3') has been isolated. The remaining leader sequence of 104 nucleotides in RNA 3' forms a single 80 S initiation complex with wheat germ ribosomes. The location of the regions of the leader sequence of RNA 3 involved in initiation complex formation with 80 S ribosomes is reported.     

Direct analysis of the mini-exon donor RNA of Trypanosoma brucei: detection of a novel cap structure also present in messenger RNA.

The mini-exon, a short segment found at the 5' end of trypanosome mRNAs, is contributed by a small RNA, the mini-exon donor (medRNA). In vivo 32P-labeled medRNA, a set of smaller RNAs related to it, and mRNA, were purified from Trypanosoma brucei by hybrid selection and gel electrophoresis. Using RNA fingerprinting and sequencing techniques, mini-exon oligonucleotides were identified and characterized. We detected a novel 5' terminal capped oligonucleotide present in both medRNA and mRNA. This structure contained m7G and at least four modified nucleotides, not identified previously. If the T. brucei mini-exon has exactly four transcribed nucleotides upstream from its originally designated 5' end, it would begin with the sequence: m7GpppA*A*C*U*AA*CG (asterisks denote modification) and medRNA would be 140 nucleotides long, excluding the m7G residue. The mini-exon contains, and retains during its transfer to mRNA, a novel 5' terminal structure whose presence could confer unique functional attributes.     

Size analysis and relationship of murine leukemia virus-specific mRNA''s: evidence for transposition of sequences during synthesis and processing of subgenomic mRNA.

Virus-specific mRNA from purified polyribosomes of mouse cells infected with Moloney murine leukemia virus (M-MuLV) was analyzed by electrophoresis in agarose gels, followed by hybridization of gel slices with M-MuLV-specific complementary DNA (cDNA). The size resolution of the gels was better than that of sucrose gradients used in previous analyses, and two virus-specific mRNA's of 38S and 24S were detected. The 24S virus-specific mRNA is predominantly derived from the 3' half of the M-MuLV genome, since cDNAgag(pol) (complementary to the 5' half of the M-MuLV genome) could not efficiently anneal with this mRNA. However, sequences complementary to cDNA synthesized from the extreme 5' end of M-MuLV 38S RNA (cDNA 5') are present in the 24S virus-specific mRNA, since cDNA 5' (130 nucleotides) efficiently annealed with this mRNA. The annealing of cDNA 5' was not due to repetition of 5' terminal nucleotide sequences at the 3' end of M-MuLV 38S RNA, since smaller cDNA 5' molecules (60 to 70 nucleotides), which likely lack the terminal repetition, also efficiently annealed with the 24S mRNA. The sequences in 24S virus-specific mRNA recognized by cDNA 5' are not present in 3' fragments of virion RNA that are the same length. Therefore, it appears that RNA sequences from the extreme 5' end of the M-MuLV genome may be transposed to sequences from the 3' half of the M-MuLV 38S RNA during synthesis and processing of the 24S virus-specific mRNA. These results may indicate a phenomenon similar to the RNA splicing processes that occur during synthesis of adenovirus and papovavirus mRNA's.     

Nucleotide sequence of the gene encoding respiratory syncytial virus matrix protein.

The amino acid sequence of the matrix protein of the human respiratory syncytial virus (RS virus) was deduced from the sequence of a cDNA insert in a recombinant plasmid harboring an almost full-length copy of this gene. It specifically hybridized to a single 1,050-base mRNA from infected cells. The recombinant containing 944 base pairs of RS viral matrix protein gene sequence lacked five nucleotides corresponding to the 5' end of the mRNA. The nucleotide sequence of the 5' end of the mRNA was determined by the dideoxy sequencing method and found to be 5' NGGGC, wherein the C residue is one nucleotide upstream of the cloned viral sequence. The initiator ATG codon for the matrix protein is embedded in an AATATGG sequence similar to the canonical PXXATGG sequence present around functional eucaryotic translation initiation codons. There is no conserved sequence upstream of the polyadenylate tail, unlike vesicular stomatitis virus and Sendai virus, in which four nucleotides upstream of the polyadenylate tail are conserved in all genes. There is no equivalent of the eucaryotic polyadenylation signal AAUAAA upstream of the polyadenylate tail. The matrix protein of 28,717 daltons has 256 amino acids. It is relatively basic and moderately hydrophobic. There are two clusters of hydrophobic amino acid residues in the C-terminal third of the protein that could potentially interact with the membrane components of the infected cell. The matrix protein has no homology with the matrix proteins of other negative-strand RNA viruses, implying that RS virus has undergone extensive evolutionary divergence. A second open reading frame potentially encoding a protein of 75 amino acids and partially overlapping the C terminus of the matrix protein was also identified.     

Complete DNA sequence coding for the large ribosomal RNA of yeast mitochondria.

The mitochondrial gene coding for the large ribosomal RNA (21S) has been isolated from a rho- clone of Saccharomyces cerevisiae. A DNA segment of about 5500 base pairs has been sequenced which included the totality of the sequence coding for the mature ribosomal RNA and the intron. The mature RNA sequence corresponds to a length of 3273 nucleotides. Despite the very low guanine-cytosine content (20.5%), many stretches of sequence are homologous to the corresponding Escherichia coli 23S ribosomal RNA. The sequence can be folded into a secondary structure according to the general models for prokaryotic and eukaryotic large ribosomal RNAs. Like the E.coli gene, the mitochondrial gene contains the sequences that look like the eukaryotic 5.8S and the chloroplastic 4.5S ribosomal RNAs. The 5' and 3' end regions show a complementarity over fourteen nucleotides.     

The complete sequence of a unique RNA species synthesized by a DI particle of VSV.

The 2S RNA synthesized in vitro by the RNA polymerase of a defective interfering (DI) particle of vesicular stomatitis virus was labeled at its 3' terminus with 32P-cytidine 3', 5' bisphosphate and RNA ligase. Analysis of the labeled RNA showed that it was a family of RNAs of different length but all sharing the same 5' terminal sequence. The largest labeled RNA was purified by gel electrophoresis, and the sequence of 41 of its 46 nucleotides was determined by rapid RNA sequencing methods. The assignment of the remaining 5 nucleotides was made on the basis of an analysis of one of the smaller RNAs and published data. A new approach in RNA sequencing based on the identification of 3' terminal nucleotides of rna fragments originally present in the DI product or generated during the ligation reaction confirmed most of the sequence. The complete sequence of this 46 nucleotide long plus-sense RNA is: ppACGAAGACCACAAAACCAGAUAAAAAA UAAAAACCACAAGAGGGUC-OH. This RNA anneals to the RNA of the DI particle from which it was synthesized, indicating that its synthesis is template-specified. At least the first 17 and possibly all of the nucleotides are also complementary to sequences at the 3' end of two other VSV DI particles which were derived independently and whose genomes differ significantly in length. These data suggest a common 3' terminal sequence among all VSV DI particles which contain part of the Lgene region of the parental genome.