Complete nucleotide sequences of all three poliovirus serotype genomes. Implication for genetic relationship, gene function and antigenic determinants

The complete nucleotide sequences of the genomes of the type 2 ( P712 , Ch, 2ab ) and type 3 (Leon 12a1b ) poliovirus vaccine strains were determined. Comparison of the sequences with the previously established genome sequence of type 1 (LS-c, 2ab ) poliovirus vaccine strain revealed that 71% of the nucleotides in the genome RNAs were common, that the 5' and 3' termini of the genomes were highly homologous, and that more than 80% of the nucleotide differences in the coding region occurred in the third letter position of in-phase codons, resulting in a low frequency of amino acid difference. These results strongly suggested that the serotypes of poliovirus derived from a common prototype. A comparison of the amino acid sequences predicted from the genome sequences showed highest variation in the capsid protein region, whereas non-structural proteins are highly conserved. Initiation of polyprotein synthesis occurs in all three strains more than 740 nucleotides downstream from the 5' end. An analysis of the non-coding region suggests that small peptides that could potentially originate from this region are conserved. The amino acid sequences immediately surrounding the cleavage signals, however, show a higher than average degree of variation. The analysis of the amino acid sequences of the capsid protein VP1 of all serotypes has led to the prediction of potential antigenic sites on the virion involved in neutralization.     

Sequence and translation of the murine coronavirus 5''-end genomic RNA reveals the N-terminal structure of the putative RNA polymerase.

A 28-kilodalton protein has been suggested to be the amino-terminal protein cleavage product of the putative coronavirus RNA polymerase (gene A) (M.R. Denison and S. Perlman, Virology 157:565-568, 1987). To elucidate the structure and mechanism of synthesis of this protein, the nucleotide sequence of the 5' 2.0 kilobases of the coronavirus mouse hepatitis virus strain JHM genome was determined. This sequence contains a single, long open reading frame and predicts a highly basic amino-terminal region. Cell-free translation of RNAs transcribed in vitro from DNAs containing gene A sequences in pT7 vectors yielded proteins initiated from the 5'-most optimal initiation codon at position 215 from the 5' end of the genome. The sequence preceding this initiation codon predicts the presence of a stable hairpin loop structure. The presence of an RNA secondary structure at the 5' end of the RNA genome is supported by the observation that gene A sequences were more efficiently translated in vitro when upstream noncoding sequences were removed. By comparing the translation products of virion genomic RNA and in vitro transcribed RNAs, we established that our clones encompassing the 5'-end mouse hepatitis virus genomic RNA encode the 28-kilodalton N-terminal cleavage product of the gene A protein. Possible cleavage sites for this protein are proposed.     

3'' Terminal labelling of RNA of RNA with beta-32P-pyrophosphate group and its application to the sequence analysis of 5S RNA from Streptomyces griseus.

Nucleotide pyrophosphate transferase isolated from Streptomyces griseus is used to transfer pyrophosphate group from gamma-32P-ATP to the 3'-OH of tRNA, generating a strictly terminal label at its 3' end. Using yeast tRNAPhe as model compound, it is demonstrated that the labelled molecule is suitable for rapid gel sequencing by both enzymatic and chemical methods. RNA molecules terminated by pyrimidine nucleoside are poor pyrophosphate acceptors. To label RNAs of this kind, first guanosine 5'-phosphate 3'-(beta-32P)-pyrophosphate (pGpp) is prepared from gamma-32P-ATP and GMP by nucleotide pyrophosphate transferase. pGpp is then ligated to the 3' end of RNA by T4 RNA ligase. The complete nucleotide sequence of 5S RNA from Streptomyces griseus is established by rapid gel sequencing methods performed on 3'-(beta-32P)-pyrophosphate labelled molecule.     

Nucleotide sequence of cucumber mosaic virus RNA. 1. Presence of a sequence complementary to part of the viral satellite RNA and homologies with other viral RNAs

The nucleotide sequence of the 3389 residues of RNA 1 (Mr 1.15 X 10(6) of the Q strain of cucumber mosaic virus (CMV) was determined, completing the primary structure of the CMV genome (8617 nucleotides). CMV RNA 1 was sequenced by the dideoxy-chain-termination method using M13 clones carrying RNA 1 sequences as well as synthetic oligonucleotide primers on RNA 1 as a template. At the 5' end of the RNA there are 97 noncoding residues between the cap structure and the first AUG (98-100), which is the start of a single long open-reading frame. This reading frame encodes a translation product of 991 amino acid residues (Mr 110791) and stops 319 nucleotide residues from the 3' end of RNA 1. In addition to the conserved 3' region present in all CMV RNAs (307 residues in RNA 1), RNAs 1 and 2 have highly homologous 5' leader sequences, a 12-nucleotide segment of which is also conserved in the corresponding RNAs of brome mosaic virus (BMV). CMV satellite RNA can form stable base pairs with a region of CMV RNAs 1 and 2 including this 12-nucleotide sequence, implying a regulatory function. This conserved sequence is part of a hairpin structure in RNAs 1 and 2 of CMV and BMV and in CMV satellite RNA. The entire translation products of RNA 1 of CMV and BMV could be aligned with significant homology. Less prominent homologies were found with alfalfa mosaic virus RNA 1 translation product and with tobacco mosaic virus Mr-126000 protein.     

The nucleotide sequence at the 5'' end of foot and mouth disease virus RNA.

Foot and mouth disease virus RNA has been treated with RNase H in the presence of oligo (dG) specifically to digest the poly(C) tract which lies near the 5' end of the molecule (10). The short (S) fragment containing the 5' end of the RNA was separated from the remainder of the RNA (L fragment) by gel electrophoresis. RNA ligase mediated labelling of the 3' end of S fragment showed that the RNase H digestion gave rise to molecules that differed only in the number of cytidylic acid residues remaining at their 3' ends and did not leave the unique 3' end necessary for fast sequence analysis. As the 5' end of S fragment prepared form virus RNA is blocked by VPg, S fragment was prepared from virus specific messenger RNA which does not contain this protein. This RNA was labelled at the 5' end using polynucleotide kinase and the sequence of 70 nucleotides at the 5' end determined by partial enzyme digestion sequencing on polyacrylamide gels. Some of this sequence was confirmed from an analysis of the oligonucleotides derived by RNase T1 digestion of S fragment. The sequence obtained indicates that there is a stable hairpin loop at the 5' terminus of the RNA before an initiation codon 33 nucleotides from the 5' end. In addition, the RNase T1 analysis suggests that there are short repeated sequences in S fragment and that an eleven nucleotide inverted complementary repeat of a sequence near the 3' end of the RNA is present at the junction of S fragment and the poly(C) tract.     

At least 104 nucleotides are transposed from the 5' terminus of the avian sarcoma virus genome to the 5' termini of smaller viral mRNAs.

Cells producing avian sarcoma virus (ASV) contain at least three virus-specific mRNAs, two of which are encoded within the 3' half of the viral genome. Each of these viral RNAs can hybridize with single-stranded DNA(cDNA5') that is complementary to a sequence of 101 nucleotides found at the 5' terminus of the ASV genome, but not within the 3' half of the genome. We proposed previously (Weiss, Varmus and Bishop, 1977) that this nucleotide sequence may be transposed to the 5' termini of viral mRNAs during the genesis of these RNAs. We now substantiate this proposal by reporting the isolation and chemical characterization of the nucleotide sequences complementary to cDNA5' in the genome and mRNAs of the Prague B strain of ASV. We isolated the three identified classes of ASVmRNA (38, 28 and 21S) by molecular hybridization; each class of RNA contained a "capped" oligonucleotide identical to that found at the 5' terminus of the ASV genome. When hybridized with cDNA5', each class of RNA gave rise to RNAase-resistant duplex hybrids that probably encompassed the full extent of cDNA5'. The molar yields of duplex conformed approximately to the number of virus-specific RNA molecules in the initial samples; hence most if not all of the molecules of virus-specific RNA could give rise to the duplexes. The duplexes prepared from the various RNAs all contained the capped oligonucleotide found at the 5' terminus of the viral genome and had identical "fingerprints" when analyzed by two-dimensional fractionation following hydrolysis with RNAase T1. In contrast, RNA representing the 3' half of the ASV genome did not form hybrids with cDNA5'. We conclude that a sequence of more than 100 nucleotides is transposed from the 5' end of the ASV genome to the 5' termini of smaller viral RNAs during the genesis of these RNAs. Transposition of nucleotide sequences during the production of mRNA has now been described for three families of animal viruses and may be a common feature of mRNA biogenesis in eucaryotic cells. The mechanism of transposition, however, and the function of the transposed sequences are not known.     

Identification of a domain required for autoproteolytic cleavage of murine coronavirus gene A polyprotein.

The 5'-most gene of the murine coronavirus genome, gene A, is presumed to encode viral RNA-dependent RNA polymerase. It has previously been shown that the N-terminal portion of this gene product is cleaved into a protein of 28 kilodaltons (p28). To further understand the mechanism of synthesis of the p28 protein, cDNA clones representing the 5'-most 5.3 kilobases of murine coronavirus mouse hepatitis virus strain JHM were sequenced and subcloned into pT7 vectors from which RNAs were transcribed and translated in vitro. The sequence was found to encode a single long open reading frame continuing from near the 5' terminus of the genome. Although p28 is encoded from the first 1 kilobase at the 5' end of the genome, translation of in vitro-transcribed RNAs indicated that this protein was not detected unless the product of the entire 5.3-kilobase region was synthesized. Translation of RNAs of 3.9 kilobases or smaller yielded proteins which contained the p28 sequence, but p28 was not cleaved. This suggests that the sequence in the region between 3.9 and 5.3 kilobases from the 5' end of the genomic RNA is essential for proteolytic cleavage and contains autoproteolytic activity. The p28 protein could not be cleaved from the smaller primary translation products of gene A, even in the presence of the larger autocleaving protein. Cleavage of the p28 protein was inhibited by addition of the protease inhibitor ZnCl2. This study thus identified a protein domain essential for autoproteolytic cleavage of the gene A polyprotein.     

Molecular cloning and nucleotide sequence of the 30K and the coat protein cistron of TMV (tomato strain) genome.

The cDNA copies of tobacco mosaic virus (TMV)-tomato strain (L) genome were cloned by the method of Okayama and Berg (Mol. Cell. Biol. 2, 161-170. (1982)) and the sequence of 1,614 nucleotides at the 3' end was determined. The sequence encompasses the 30K and the coat protein cistron which are located in residues 685-1, 479 and 203-682 from the 3' end of the genome respectively. The close relationship between the tomato and the common strain was shown on the level of the nucleotide sequence. Highly homologous regions are found in the 3' non-coding region, the assembly origin and the 5' flanking region of the 30K protein cistron. The comparison of the deduced amino acid sequence between the tomato and the common strain shows that the 30K protein is composed of the conserved N-terminal four-fifth and the highly divergent region near the C-terminus.     

Effects of mutations of the initiation nucleotides on hepatitis C virus RNA replication in the cell

Replication of nearly all RNA viruses depends on a virus-encoded RNA-dependent RNA polymerase (RdRp). Our earlier work found that purified recombinant hepatitis C virus (HCV) RdRp (NS5B) was able to initiate RNA synthesis de novo by using purine (A and G) but not pyrimidine (C and U) nucleotides (G. Luo et al., J. Virol. 74:851-863, 2000). For most human RNA viruses, the initiation nucleotides of both positive- and negative-strand RNAs were found to be either an adenylate (A) or guanylate (G). To determine the nucleotide used for initiation and control of HCV RNA replication, a genetic mutagenesis analysis of the nucleotides at the very 5' and 3' ends of HCV RNAs was performed by using a cell-based HCV replicon replication system. Either a G or an A at the 5' end of HCV genomic RNA was able to efficiently induce cell colony formation, whereas a nucleotide C at the 5' end dramatically reduced the efficiency of cell colony formation. Likewise, the 3'-end nucleotide U-to-C mutation did not significantly affect the efficiency of cell colony formation. In contrast, a U-to-G mutation at the 3' end caused a remarkable decrease in cell colony formation, and a U-to-A mutation resulted in a complete abolition of cell colony formation. Sequence analysis of the HCV replicon RNAs recovered from G418-resistant Huh7 cells revealed several interesting findings. First, the 5'-end nucleotide G of the replicon RNA was changed to an A upon multiple rounds of replication. Second, the nucleotide A at the 5' end was stably maintained among all replicon RNAs isolated from Huh7 cells transfected with an RNA with a 5'-end A. Third, initiation of HCV RNA replication with a CTP resulted in a >10-fold reduction in the levels of HCV RNAs, suggesting that initiation of RNA replication with CTP was very inefficient. Fourth, the 3'-end nucleotide U-to-C and -G mutations were all reverted back to a wild-type nucleotide U. In addition, extra U and UU residues were identified at the 3' ends of revertants recovered from Huh7 cells transfected with an RNA with a nucleotide G at the 3' end. We also determined the 5'-end nucleotide of positive-strand RNA of some clinical HCV isolates. Either G or A was identified at the 5' end of HCV RNA genome depending on the specific HCV isolate. Collectively, these findings demonstrate that replication of positive-strand HCV RNA was preferentially initiated with purine nucleotides (ATP and GTP), whereas the negative-strand HCV RNA replication is invariably initiated with an ATP.     

The complete sequence of a unique RNA species synthesized by a DI particle of VSV.

The 2S RNA synthesized in vitro by the RNA polymerase of a defective interfering (DI) particle of vesicular stomatitis virus was labeled at its 3' terminus with 32P-cytidine 3', 5' bisphosphate and RNA ligase. Analysis of the labeled RNA showed that it was a family of RNAs of different length but all sharing the same 5' terminal sequence. The largest labeled RNA was purified by gel electrophoresis, and the sequence of 41 of its 46 nucleotides was determined by rapid RNA sequencing methods. The assignment of the remaining 5 nucleotides was made on the basis of an analysis of one of the smaller RNAs and published data. A new approach in RNA sequencing based on the identification of 3' terminal nucleotides of rna fragments originally present in the DI product or generated during the ligation reaction confirmed most of the sequence. The complete sequence of this 46 nucleotide long plus-sense RNA is: ppACGAAGACCACAAAACCAGAUAAAAAA UAAAAACCACAAGAGGGUC-OH. This RNA anneals to the RNA of the DI particle from which it was synthesized, indicating that its synthesis is template-specified. At least the first 17 and possibly all of the nucleotides are also complementary to sequences at the 3' end of two other VSV DI particles which were derived independently and whose genomes differ significantly in length. These data suggest a common 3' terminal sequence among all VSV DI particles which contain part of the Lgene region of the parental genome.     

Characterization of poliovirus clones containing lethal and nonlethal mutations in the genome-linked protein VPg.

Viral RNA synthesis was assayed in HeLa cells transfected with nonviable poliovirus RNA mutated in the genome-linked protein VPg-coding region. The transfecting RNA was transcribed in vitro from full-length poliovirus type 1 (Mahoney) cDNA containing a VPg mutagenesis cartridge. Hybridization experiments using ribonucleotide probes specific for the 3' end of positive- and negative-sense poliovirus RNA indicated that all mutant RNAs encoding a linking tyrosine in position 3 or 4 of VPg were replicated even though no virus was produced. VPg, but no VPg precursor, was found to be linked to the 5' end of the newly synthesized RNA. Encapsidated mutant RNAs were not found in transfected-cell lysates. After extended maintenance of transfected HeLa cells, a viable revertant of one of the nonviable RNAs was recovered; the revertant lost the lethal lesion in VPg by restoring the wild-type amino acid, but it retained all other nucleotide changes introduced during construction of the mutagenesis cartridge. Mutant RNA encoding phenylalanine or serine rather than tyrosine, the linking amino acid in VPg, was not replicated in transfected cells. A chimeric mutant containing the VPg-coding region of coxsackievirus within the poliovirus genome was viable but displayed impaired multiplication. A poliovirus-coxsackievirus chimera lacking a linking tyrosine in VPg was nonviable and replication-negative. The results indicate that a linkage-competent VPg is necessary for poliovirus RNA synthesis to occur but that a step in poliovirus replication other than initiation of RNA synthesis can be interrupted by lethal mutations in VPg.     

3''End labelling of RNA with 32P suitable for rapid gel sequencing.

A new general method of labelling the 2',3'-diol end of RNA with 32P has been devised suitable for gel sequencing. Poly(A) polymerase (E. coli) is incubated with the RNA and limiting amounts of alpha-32P-ATP. The mono-addition product is then cleaved with periodate and beta-eliminated with aniline, leaving the RNA terminally labelled with 3' 32P-phosphate. When applied to a model compound, tRNAPhe from E. coli, over 28 residues could be read from the 3' end.     

Serial passage of tobacco rattle virus under different selection conditions results in deletion of structural and nonstructural genes in RNA 2.

The RNA genome of tobacco rattle virus (TRV) is bipartite. RNA 2 of the nematode-transmissible TRV isolate PPK20 encodes the viral coat protein (cp) and proteins with molecular weights of 29,400 and 32,800 (29.4K and 32.8K proteins). When this isolate was serially passaged in tobacco by using phenol-extracted RNA as the inoculum in each transfer, defective interfering (DI) RNAs rapidly accumulated. A number of these DI RNAs were cloned. Six DI RNAs had single internal deletions in RNA 2 that removed most of the cp gene, the 29.4K gene, and the 5' half of the 32.8K gene. The borders of the deletions in these DI RNAs were found to be flanked in the genomic RNA 2 by short nucleotide repeats or sequences resembling the 5' end of TRV genomic and subgenomic RNAs. Two DI RNAs were found to be recombinants containing a 5' sequence derived from RNA 2 and a 3' sequence derived from RNA 1. When serial passage of TRV isolate PPK20 was carried out by using leaf homogenates as inocula in each transfer, accumulation of a DI RNA (designated D7) with a functional cp gene was observed. The deletion in D7 covered the 3' end of the cp gene, the 29.4K gene, and the 5' half of the 32.8K gene. An infectious cDNA clone of D7 RNA was made. In mixed infections, D7 RNA rapidly outcompeted RNA 2 but did not compete with RNA 1. The deletion in D7 RNA abolished the nematode transmissibility of the PPK20 isolate. These results may explain the observation that many laboratory isolates of tobraviruses have lost their nematode transmissibility and contain RNA 2 molecules of widely different lengths.     

Complete Genome Sequences of Two Chinese Beet soil-borne virus Isolates Provide Evidence that the Genome is Highly Conserved

The complete nucleotide sequences of two Chinese isolates of Beet soil-borne virus (BSBV) from the Inner Mongolia and Xinjiang provinces (designated BSBV-IM and BSBV-XJ, respectively) were found to share around 99% sequence identity with that of a previously reported German isolate (BSBV-G). The genome organization of the three isolates was identical. A diversity index (Pi) analysis indicated that the overall nucleotide variability of all RNAs among the three isolates was <7%, only for the 5' part of the first triple gene block gene on RNA3 was it >6%. Although the 3' end of BSBV RNA 3 was previously reported to be highly variable, the results of this study show that the total BSBV genomes are considerably conserved, especially RNAs 1 and 2.