Bone Gla protein messenger ribonucleic acid is regulated by both 1,25-dihydroxyvitamin D3 and 3',5'-cyclic adenosine monophosphate in rat osteosarcoma cells

1,25-Dihydroxyvitamin D3 [1,25-(OH)2D3] regulates the synthesis of bone gamma-carboxyglutamic acid (Gla) protein (BGP) by osteoblastic cells. In this study we examined the effect of cAMP, alone and in combination with 1,25-(OH)2D3, on the regulation of BGP mRNA levels in ROS 17/2 rat osteosarcoma cells. Elevation of intracellular cAMP levels by cAMP analogs or by isobutylmethylxanthine (IBMX), forskolin, or PTH, resulted in increased BGP mRNA levels and BGP secretion after 1 day of treatment. The effects of these agents were additive with 1,25-(OH)2D3 in stimulating BGP gene expression. After 4 days of treatment, pertussis toxin (PT) and 1,25-(OH)2D3 were synergistic in stimulating BGP mRNA, and the effect of PT could be mimicked by (Bu)2cAMP, IBMX, forskolin, cholera toxin, and to a lesser extent by PTH. The effect of 1-day treatment with cAMP alone and the synergistic effect with 1,25-(OH)2D3 on the stimulation of BGP mRNA were dependent on cell density, while basal and 1,25-(OH)2D3-stimulated synthesis were not. Cyclic AMP inhibited ROS 17/2 cell growth after 1 day of treatment, an effect that was also dependent on initial cell density. After 4 days of treatment, 1,25-(OH)2D3, cAMP, and PT all demonstrated inhibition of cell growth. When cells were treated with actinomycin D, both 1,25-(OH)2D3 and cAMP stimulation of BGP mRNA were blocked. In addition, neither agent was effective in enhancing BGP mRNA stability when prestimulated cells were exposed to actinomycin D.(ABSTRACT TRUNCATED AT 250 WORDS)     

Identification of a Vitamin D response element in the human insulin receptor gene promoter

The present study was designed to explore the possible presence and location of Vitamin D response elements (VDREs) in the human insulin receptor (hIR) gene promoter. To this end, the -1819 to -271 bp fragment of the hIR promoter (wild type promoter) and progressive 5' deletions of this promoter (up to -1473 and -876 bp) were linked to the luciferase pGL2-basic vector to construct the reported plasmids: phIR (-1819)-GL2, phIR(-1473)-GL2 and phIR(-876)-GL2, respectively. U-937 cells were transiently transfected with these plasmids, and then the cells were either untreated or treated for 24h with 10(-8) M 1,25-dihydroxyvitamin D(3) (1,25D(3)). Luciferase determinations revealed that, while the activity of the wild promoter was increased 1.6-fold by the hormone, the activities of progressive 5' deletions of this promoter were enhanced 1.7-, and 1.6-fold, respectively. Thus, the region extending from -876 to -271bp of the hIR promoter, appears to contain VDREs, and to be sufficient for induction by 1,25D(3). In order to identify these potential VDREs, we performed a computer search of candidate sequences by homology with a consensus VDRE sequence. This search yielded a sequence located between -761 and -732 bp (5'CGTCGGGCCTGTGGGGCGCCTCCGGGGGTC3'), which includes an overlapping AP-2 like sequence, as a good candidate. Electrophoretic mobility shift assays revealed that the Vitamin D receptor (VDR) specifically recognized this sequence, since a VDR-DNA complex was able to compete with the unlabeled probe and was cleared by the specific anti-VDR antibody 9A7. These data represent the first identification of a VDRE in the hIR gene promoter.     

Identification of a vitamin D responsive element in the promoter of the rat cytochrome P450(24) gene.

Mitochondrial cytochrome P450(24) expression in the vitamin D-degradation pathway is induced by 1,25-dihydroxyvitamin D3 [1,25-(OH)2D3]. The molecular basis of this enzyme regulation was investigated by isolating the rat P450(24) gene and examining the 5'-flanking region for possible cis-acting regulatory elements involved in the induction process. Constructs containing different lengths of 5'-flanking region of the gene were linked to a luciferase reporter gene and transiently co-transfected with a human vitamin D receptor (hVDR) expression vector (pRSV-hVDR) into COS-1 cells. These experiments showed that the flanking region from -298 to -122 directed a 24-fold increase in luciferase activity in response to 1,25-(OH)2D3 provided that the cells were co-transfected with pRSV-hVDR. Within this region, the sequence from position -171 to -123 conferred 1,25-(OH)2D3 responsiveness to both the native P450(24) promoter and the heterologous thymidine kinase promoter. Mutagenesis revealed that the sequence from position -150 to -136 is required for induction by 1,25-(OH)2D3 and that this sequence shares similarity to other vitamin D responsive elements (VDREs) reported for other genes. Gel shift mobility assays showed this region specifically bound a nuclear protein complex from 1,25-(OH)2D3 treated COS-1 cells that had been co-transfected with pRSV-hVDR. The retarded band was specifically competed with the well characterized VDRE from the mouse osteopontin gene. A VDRE at position -150 to -136 in the promoter of the rat P450(24) gene is identified in this study and found to be important in mediating the enhanced expression of the gene by 1,25-(OH)2D3.     

1,25-Dihydroxyvitamin D(3) induction of the tissue-type plasminogen activator gene is mediated through its multihormone-responsive enhancer.

Tissue-type plasminogen activator (t-PA) is a positive modulator of the plasminogen-plasmin system, which is involved in bone remodeling. In the present study, 1,25-dihydroxyvitamin D(3) [1,25(OH)(2)D(3)] was found to stimulate t-PA gene expression in ROS17/2.8 osteosarcoma cells. Transient transfection analysis and in vitro DNA binding studies identified two vitamin D-responsive elements (VDRE) in the human t-PA enhancer. The first VDRE (bp -7175 to -7146) comprised an inverted palindrome separated by 9 bp (IP9) overlapping a palindrome separated by 3 bp. The second VDRE (bp -7315 to -7302) is an IP2 element overlapping the previously identified retinoic acid-responsive element. 1,25(OH)(2)D(3) treatment of primary osteoblasts derived from t-PAlacZ transgenic mice containing 9 kb of 5' sequence of the human t-PA gene increased the number of lacZ-positive cells, fitting with the probability model of enhancer function.     

Bovine Tyrosine Hydroxylase Gene-Promoter Regions Involved in Basal and Angiotensin II-Stimulated Expression in Nontransformed Adrenal Medullary Cells

Abstract: The tyrosine hydroxylase gene is expressed specifically in catecholaminergic cells, and its activity is regulated by afferent stimuli. To characterize molecular mechanisms underlying those regulations, we have constructed chimeric genes consisting of bovine tyrosine hydroxylase gene promoters (wild-type or deletion mutants) and a luciferase reporter gene. The basal expression of these genes and their regulation by angiotensin II were examined in cultured bovine adrenal medullary cells. Luciferase activity was normalized to the amount of transfected plasmid DNA. A pTHgoodLUC plasmid containing the -428/+21-bp fragment of the tyrosine hydroxylase gene promoter expressed luciferase activity at severalfold higher levels than the promoterless pOLUC plasmid. Deletion of the -194/-54-bp promoter fragment containing POU/Oct, SP1, and other putative regulatory elements increased luciferase expression fivefold. An additional deletion further upstream (-269/-194 bp), including a 12-O-tetradecanoylphorbol 13-acetate (TPA)-responsive element (TRE)-like site, reduced promoter activity. These results indicate the presence of negatively and positively acting regions in the bovine tyrosine hydroxylase gene promoter controlling basal promoter activity in adrenal medullary cells. Angiotensin II stimulated the expression of endogenous tyrosine hydroxylase gene and pTHgood-LUC approximately threefold without affecting the expression of pOLUC. A comparable threefold stimulation was observed following the deletion of the -194/-54-bp promoter region, despite the increase in basal promoter activity. Additional deletion of the -269/-194-bp promoter fragment reduced stimulation by angiotensin II to 1.5-fold. These results indicate that the angiotensin II receptor-responsive element is located in the -269/-194-bp promoter region containing the TRE-like site. Additional angiotensin II-responsive site(s) may be present outside this region. Gel mobility shift assays demonstrated constitutive and angiotensin II-induced protein binding to the tyrosine hydroxylase gene promoter. Some DNA-protein complexes were displaced with c-Fos antibodies. The results suggest that c-Fos-related antigens support basal promoter activity and mediate activation of tyrosine hydroxylase by angiotensin II receptor.     

1,25-Dihydroxyvitamin D3 stimulates the synthesis of matrix gamma-carboxyglutamic acid protein by osteosarcoma cells. Mutually exclusive expression of vitamin K-dependent bone proteins by clonal osteoblastic cell lines

Several clonal rat osteosarcoma cell lines were tested for the ability to express and secrete matrix Gla protein (MGP), a small vitamin K-dependent protein found in bone and cartilage. Two independently derived cell lines, UMR 106-01 and ROS 25/1, expressed MGP mRNA and secreted MGP antigen identical in size with that found in bone. No MGP message could be detected in ROS 17/2 and 2/3 cells, cell lines previously shown to synthesize the other known vitamin K-dependent bone protein, bone Gla protein (BGP), and no BGP mRNA could be detected in the cell lines which synthesize MGP. Since UMR 106-01 and ROS 17/2 are presently the best characterized clonal osteoblastic cell lines, the discovery of the mutually exclusive expression of MGP and BGP by these cell lines indicates that osteosarcoma cells can be fixed in different phenotypic states and that MGP and BGP should be useful markers for the analysis of phenotypic expression in bone. Treatment of UMR 106-01 cells with 1,25-dihydroxyvitamin D3 (1,25(OH)2D3) dramatically increased MGP mRNA within 4 h and, by 24 h, increased MGP secretion 15-fold. This is only the second example of a bone matrix protein whose synthesis is dramatically increased by vitamin D, the first being the 6-fold stimulation of BGP synthesis by 1,25(OH)2D3 in ROS 17/2 cells. The discovery that MGP and BGP are similarily regulated by 1,25(OH)2D3 was unexpected since the two proteins differ markedly in structure, physical properties, and tissue distribution. Since the synthesis of MGP is rapidly and dramatically increased by 1,25(OH)2D3, it is probable that MGP plays a role in the normal bone response to the hormone. MGP may also be the vitamin K-dependent protein whose abnormal synthesis in the Warfarin-treated animal modifies the bone response to 1,25(OH)2D3.