The Osmolyte TMAO Stabilizes Native RNA Tertiary Structures in the Absence of Mg: Evidence for a Large Barrier to Folding from Phosphate Dehydration

The stabilization of RNA tertiary structures by ions is well known, but the neutral osmolyte trimethylamine oxide (TMAO) can also effectively stabilize RNA tertiary structure. To begin to understand the physical basis for the effects of TMAO on RNA, we have quantitated the TMAO-induced stabilization of five RNAs with known structures. So-called m values, the increment in unfolding free energy per molal of osmolyte at constant KCl activity, are ∼ 0 for a hairpin secondary structure and between 0.70 and 1.85 kcal mol^− 1m^− 1 for four RNA tertiary structures (30-86 nt). Further analysis of two RNAs by small-angle X-ray scattering and hydroxyl radical probing shows that TMAO reduces the radius of gyration of the unfolded ensemble to the same endpoint as seen in titration with Mg²⁺ and that the structures stabilized by TMAO and Mg²⁺ are indistinguishable. Remarkably, TMAO induces the native conformation of a Mg²⁺ ion chelation site formed in part by a buried phosphate, even though Mg²⁺ is absent. TMAO interacts weakly, if at all, with KCl, ruling out the possibility that TMAO stabilizes RNA indirectly by increasing salt activity. TMAO is, however, strongly excluded from the vicinity of dimethylphosphate (unfavorable interaction free energy, + 211 cal mol^− 1m^− 1 for the potassium salt), an ion that mimics the RNA backbone phosphate. We suggest that formation of RNA tertiary structure is accompanied by substantial phosphate dehydration (loss of 66-173 water molecules in the RNA structures studied) and that TMAO works principally by reducing the energetic penalty associated with this dehydration. The strong parallels we find between the effects of TMAO and Mg²⁺ suggest that RNA sequence is more important than specific ion interactions in specifying the native structure.     

Stability of β-Lactoglobulin A in the Presence of Sugar Osmolytes Estimated from Their Guanidinium Chloride-Induced Transition Curves

The stabilizing role of Trehalose, Sucrose, Sorbitol and Mannitol as sugar osmolytes and polyols on beta-lactoglobulin A (β-lgA) against its chemical denaturation at pH 2.0 and 25 °C has been explored by means of UV–vis spectroscopy. It has been observed that ΔG _D ^o of β-lgA in the presence of 10% (w/v) Trehalose, Sucrose, Sorbitol and Mannitol is increased. We report that the functional dependence of ΔG _D of proteins in the absence and the presence of sugar osmolytes on denaturant concentration is linear. Trehalose is found to induce remarkable stability of β-lgA against chemical denaturation. Furthermore, we assumed sugar osmolytes do not affect the secondary and tertiary structures of the native and GdnHCl-denatured states.     

Mg2+ Impacts the Twister Ribozyme through Push-Pull Stabilization of Nonsequential Phosphate Pairs

RNA molecules perform a variety of biological functions for which the correct three-dimensional structure is essential, including as ribozymes where they catalyze chemical reactions. Metal ions, especially Mg²⁺, neutralize these negatively charged nucleic acids and specifically stabilize RNA tertiary structures as well as impact the folding landscape of RNAs as they assume their tertiary structures. Specific binding sites of Mg²⁺ in folded conformations of RNA have been studied extensively; however, the full range of interactions of the ion with compact intermediates and unfolded states of RNA is challenging to investigate, and the atomic details of the mechanism by which the ion facilitates tertiary structure formation is not fully known. Here, umbrella sampling combined with oscillating chemical potential Grand Canonical Monte Carlo/molecular dynamics simulations are used to capture the energetics and atomic-level details of Mg²⁺-RNA interactions that occur along an unfolding pathway of the Twister ribozyme. The free energy profiles reveal stabilization of partially unfolded states by Mg²⁺, as observed in unfolding experiments, with this stabilization being due to increased sampling of simultaneous interactions of Mg²⁺ with two or more nonsequential phosphate groups. Notably, these results indicate a push-pull mechanism in which the Mg²⁺-RNA interactions actually lead to destabilization of specific nonsequential phosphate-phosphate interactions (i.e., pushed apart), whereas other interactions are stabilized (i.e., pulled together), a balance that stabilizes unfolded states and facilitates the folding of Twister, including the formation of hydrogen bonds associated with the tertiary structure. This study establishes a better understanding of how Mg²⁺-ion interactions contribute to RNA structural properties and stability.     

Influence of the A15 mutation on the conformational energy balance in Escherichia coli tRNA Tyr.

The A15 mutation in Escherichia coli tRNA_su3^Tyr produces a transfer RNA whose tertiary structure has either a higher or lower t_m than the wild type, depending on Mg²⁺ concentration. The enthalpy that stabilizes the tertiary structure is greatly reduced by the A15 mutation, but there are large compensating entropy changes. At 37 °C the mutation decreases the magnitude of the free energy stabilizing the tertiary structure for all Mg²⁺ concentrations. The nucleotide modifications s⁴U, iA and G¹ do not contribute detectably to tertiary structure stability. The results can be interpreted in terms of a tertiary pairing between A15 and C57 in tRNA_{su3 A15}^Tyr, of a form suggested by the unusual bonding between G15 and C48 found in crystallographic studies of yeast tRNA^phe. The observed disturbance in the conformational energy balance should contribute to the defective function of tRNA_{su3 A15}^Tyr.     

Molecular crowders and cosolutes promote folding cooperativity of RNA under physiological ionic conditions

Folding mechanisms of functional RNAs under idealized in vitro conditions of dilute solution and high ionic strength have been well studied. Comparatively little is known, however, about mechanisms for folding of RNA in vivo where Mg²⁺ ion concentrations are low, K⁺ concentrations are modest, and concentrations of macromolecular crowders and low-molecular-weight cosolutes are high. Herein, we apply a combination of biophysical and structure mapping techniques to tRNA to elucidate thermodynamic and functional principles that govern RNA folding under in vivo–like conditions. We show by thermal denaturation and SHAPE studies that tRNA folding cooperativity increases in physiologically low concentrations of Mg²⁺ (0.5–2 mM) and K⁺ (140 mM) if the solution is supplemented with physiological amounts (∼20%) of a water-soluble neutral macromolecular crowding agent such as PEG or dextran. Low-molecular-weight cosolutes show varying effects on tRNA folding cooperativity, increasing or decreasing it based on the identity of the cosolute. For those additives that increase folding cooperativity, the gain is manifested in sharpened two-state-like folding transitions for full-length tRNA over its secondary structural elements. Temperature-dependent SHAPE experiments in the absence and presence of crowders and cosolutes reveal extent of cooperative folding of tRNA on a nucleotide basis and are consistent with the melting studies. Mechanistically, crowding agents appear to promote cooperativity by stabilizing tertiary structure, while those low molecular cosolutes that promote cooperativity stabilize tertiary structure and/or destabilize secondary structure. Cooperative folding of functional RNA under physiological-like conditions parallels the behavior of many proteins and has implications for cellular RNA folding kinetics and evolution.     

Stabilities of HIV-1 DIS type RNA loop-loop interactions in vitro and in vivo

RNA loop–loop interactions are a prevalent motif in the formation of tertiary structure and are well suited to trigger molecular recognition between RNA molecules. We determined the stabilities of several loop–loop interactions with a constant 6 bp core sequence and varying unpaired flanking nucleotides and found that the flanking bases have a strong influence on the stability and ion dependence of the kissing complex. In general, the stabilities determined in 1 M Na⁺ are equivalent to those in the presence of near physiological Mg²⁺ concentrations. Therefore we further tested whether the stabilities determined in vitro and within yeast cells correlate, using a recently developed yeast RNA-hybrid system. For the majority of the loop types analyzed here, the melting temperatures determined in vitro are in good agreement with the relative β-galactosidase activity in yeast cells, showing that data derived from in vitro measurements reflect in vivo properties. The most stable interactions are the naturally occurring HIV-1 DIS MAL and LAI derived loops with the motif (5′ A^A/_GN₆A 3′), emphasizing the crucial role of stable kissing complexes in HIV genome dimerization.     

Determination of thermodynamic parameters for HIV DIS type loop-loop kissing complexes

The HIV-1 type dimerization initiation signal (DIS) loop was used as a starting point for the analysis of the stability of Watson–Crick (WC) base pairs in a tertiary structure context. We used ultraviolet melting to determine thermodynamic parameters for loop–loop tertiary interactions and compared them with regular secondary structure RNA helices of the same sequences. In 1 M Na⁺ the loop–loop interaction of a HIV-1 DIS type pairing is 4 kcal/mol more stable than its sequence in an equivalent regular and isolated RNA helix. This difference is constant and sequence independent, suggesting that the rules governing the stability of WC base pairs in the secondary structure context are also valid for WC base pairs in the tertiary structure context. Moreover, the effect of ion concentration on the stability of loop–loop tertiary interactions differs considerably from that of regular RNA helices. The stabilization by Na⁺ and Mg²⁺ is significantly greater if the base pairing occurs within the context of a loop–loop interaction. The dependence of the structural stability on salt concentration was defined via the slope of a T_m/log [ion] plot. The short base-paired helices are stabilized by 8°C/log [Mg²⁺] or 11°C/log [Na⁺], whereas base-paired helices forming tertiary loop–loop interactions are stabilized by 16°C/log [Mg²⁺] and 26°C/log [Na⁺]. The different dependence on ionic strength that is observed might reflect the contribution of specific divalent ion binding to the preformation of the hairpin loops poised for the tertiary kissing loop–loop contacts.     

Molecular crowding overcomes the destabilizing effects of mutations in a bacterial ribozyme

The native structure of the Azoarcus group I ribozyme is stabilized by the cooperative formation of tertiary interactions between double helical domains. Thus, even single mutations that break this network of tertiary interactions reduce ribozyme activity in physiological Mg²⁺ concentrations. Here, we report that molecular crowding comparable to that in the cell compensates for destabilizing mutations in the Azoarcus ribozyme. Small angle X-ray scattering, native polyacrylamide gel electrophoresis and activity assays were used to compare folding free energies in dilute and crowded solutions containing 18% PEG1000. Crowder molecules allowed the wild-type and mutant ribozymes to fold at similarly low Mg²⁺ concentrations and stabilized the active structure of the mutant ribozymes under physiological conditions. This compensation helps explains why ribozyme mutations are often less deleterious in the cell than in the test tube. Nevertheless, crowding did not rescue the high fraction of folded but less active structures formed by double and triple mutants. We conclude that crowding broadens the fitness landscape by stabilizing compact RNA structures without improving the specificity of self-assembly.     

Global Stabilization of rRNA Structure by Ribosomal Proteins S4, S17, and S20

Ribosomal proteins stabilize the folded structure of the ribosomal RNA and enable the recruitment of further proteins to the complex. Quantitative hydroxyl radical footprinting was used to measure the extent to which three different primary assembly proteins, S4, S17, and S20, stabilize the three-dimensional structure of the Escherichia coli 16S 5′ domain. The stability of the complexes was perturbed by varying the concentration of MgCl₂. Each protein influences the stability of the ribosomal RNA tertiary interactions beyond its immediate binding site. S4 and S17 stabilize the entire 5′ domain, while S20 has a more local effect. Multistage folding of individual helices within the 5′ domain shows that each protein stabilizes a different ensemble of structural intermediates that include nonnative interactions at low Mg²⁺ concentration. We propose that the combined interactions of S4, S17, and S20 with different helical junctions bias the free-energy landscape toward a few RNA conformations that are competent to add the secondary assembly protein S16 in the next step of assembly.     

The effect of some osmolytes on the activity and stability of mushroom tyrosinase

The thermodynamical stability and remained activity of mushroom tyrosinase (MT) fromAgaricus bisporus in 10 mM phosphate buffer, pH 6.8, stored at two temperatures of 4 and 40°C were investigated in the presence of three different amino acids (His, Phe and Asp) and also trehalose as osmolytes, for comparing with the results obtained in the absence of any additive. Kinetics of inactivation obeye the first order law. Inactivation rate constant (k_inact) value is the best parameter describing effect of osmolytes on kinetic stability of the enzyme. Trehalose and His have the smallest value of k_inact(0.7×10⁻⁴s⁻¹) in comparison with their absence (2.5×10⁻⁴s⁻¹). Moreover, to obtain effect of these four osmolytes on thermodynamical stability of the enzyme, protein denaturation by dodecyl trimethylammonium bromide (DTAB) and thermal scanning was investigated. Sigmoidal denaturation curves were analysed according to the two states model of Pace theory to find the Gibbs free energy change of denaturation process in aqueous solution at room temperature, as a very good thermodynamic criterion indicating stability of the protein. Although His, Phe and Asp induced constriction of MT tertiary structure, its secondary structure had not any change and the result was a chemical and thermal stabilization of MT. The enzyme shows a proper coincidence of thermodyanamic and structural changes with the presence of trehalose. Thus, among the four osmolytes, trehalose is an exceptional protein stabilizer.     

A large collapsed-state RNA can exhibit simple exponential single-molecule dynamics

The process of large RNA folding is believed to proceed from many collapsed structures to a unique functional structure requiring precise organization of nucleotides. The diversity of possible structures and stabilities of large RNAs could result in non-exponential folding kinetics (e.g. stretched exponential) under conditions where the molecules have not achieved their native state. We describe a single-molecule fluorescence resonance energy transfer (FRET) study of the collapsed-state region of the free energy landscape of the catalytic domain of RNase P RNA from Bacillus stearothermophilus (C_thermo). Ensemble measurements have shown that this 260 residue RNA folds cooperatively to its native state at ≥1 mM Mg²⁺, but little is known about the conformational dynamics at lower ionic strength. Our measurements of equilibrium conformational fluctuations reveal simple exponential kinetics that reflect a small number of discrete states instead of the expected inhomogeneous dynamics. The distribution of discrete dwell times, collected from an “ensemble” of 300 single molecules at each of a series of Mg²⁺ concentrations, fit well to a double exponential, which indicates that the RNA conformational changes can be described as a four-state system. This finding is somewhat unexpected under [Mg²⁺] conditions in which this RNA does not achieve its native state. Observation of discrete well-defined conformations in this large RNA that are stable on the seconds timescale at low [Mg²⁺] (<0.1 mM) suggests that even at low ionic strength, with a tremendous number of possible (weak) interactions, a few critical interactions may produce deep energy wells that allow for rapid averaging of motions within each well, and yield kinetics that are relatively simple.     

Site-resolved stabilization of a DNA triple helix by magnesium ions

Proton exchange and NMR spectroscopy have been used to define the effects of Mg²⁺ ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The rates of exchange of individual Watson–Crick and Hoogsteen imino protons in the DNA triple helix were measured in the absence and in the presence of Mg²⁺ ions. The results reveal that Mg²⁺ lowers the exchange rates of most imino protons in the structure by stabilizing the corresponding base pairs in their native closed conformation. Comparison of the DNA triple helix containing Na⁺ counterions to the same helix containing Mg²⁺ counterions shows that these stabilizing effects result, in large part, from Mg²⁺ ions closely associated with the DNA. Moreover, the effects are site-specific and depend on the number and location of protonated cytosines relative to the observed base. These findings provide new insights into the molecular roles of C⁺·GC triads in determining the stability of DNA triple-helical structures.     

Thermodynamic analysis of ligand binding and ligand binding-induced tertiary structure formation by the thiamine pyrophosphate riboswitch

The thi-box riboswitch regulates gene expression in response to the intracellular concentration of thiamine pyrophosphate (TPP) in archaea, bacteria, and eukarya. To complement previous biochemical, genetic, and structural studies of this phylogenetically widespread RNA domain, we have characterized its interaction with TPP by isothermal titration calorimetry. This shows that TPP binding is highly dependent on Mg²⁺ concentration. The dissociation constant decreases from ∼200 nM at 0.5 mM Mg²⁺ concentration to ∼9 nM at 2.5 mM Mg²⁺ concentration. Binding is enthalpically driven, but the unfavorable entropy of binding decreases as Mg²⁺ concentration rises, suggesting that divalent cations serve to pre-organize the RNA. Mutagenesis, biochemical analysis, and a new crystal structure of the riboswitch suggest that a critical element that participates in organizing the riboswitch structure is the tertiary interaction formed between the P3 and L5 regions. This tertiary contact is distant from the TPP binding site, but calorimetric analysis reveals that even subtle mutations in L5 can have readily detectable effects on TPP binding. The thermodynamic signatures of these mutations, namely decreased favorable enthalpy of binding and small effects on entropy of binding, are consistent with the P3–L5 association contributing allosterically to TPP-induced compaction of the RNA.     

Hinge stiffness is a barrier to RNA folding

Cation-mediated RNA folding from extended to compact, biologically active conformations relies on a temporal balance of forces. The Mg^2 +-mediated folding of the Tetrahymena thermophila ribozyme is characterized by rapid nonspecific collapse followed by tertiary-contact-induced compaction. This article focuses on an autonomously folding portion of the Tetrahymena ribozyme, its P4-P6 domain, in order to probe one facet of the rapid collapse: chain flexibility. The time evolution of P4-P6 folding was followed by global and local measures as a function of Mg^2 + concentration. While all concentrations of Mg^2 + studied are sufficient to screen the charge on the helices, the rates of compaction and tertiary contact formation diverge as the concentration of Mg^2 + increases; collapse is greatly accelerated by Mg^2 +, while tertiary contact formation is not. These studies highlight the importance of chain stiffness to RNA folding; at 10 mM Mg^2 +, a stiff hinge limits the rate of P4-P6 folding. At higher magnesium concentrations, the rate-limiting step shifts from hinge bending to tertiary contact formation.     

Stabilities of intrastrand pyrimidine motif DNA and RNA triple helices

Nucleic acid triple helices have provoked interest since their discovery more than 40 years ago, but it remains unknown whether such structures occur naturally in cells. To pursue this question, it is important to determine the stabilities of representative triple helices at physiological temperature and pH. Previous investigations have concluded that while both DNA and RNA can participate in the pyrimidine triplex motif under mildly acidic conditions, these structures are often relatively unstable at neutral pH. We are now explorin g the stability of intrastrand DNA and RNA pyrimidine motif triplexes at physiological temperature and pH. Duplex and triplex formation were monitored by thermal denaturation analysis, circular dichroism spectroscopy and gel shift experiments. Short intrastrand triplexes were observed to form in the pyrimidine motif in both DNA and RNA. In the presence of physiological concentrations of Mg²⁺ and at physiological pH, all detected triplexes were sufficiently stable to persist at physiological temperature. If sequences specifying such intrastrand triplexes are encoded in genomes, the potential exists for the formation of stable structures in RNA or DNA in vivo.     

Predicting Ion Binding Properties for RNA Tertiary Structures

Recent experiments pointed to the potential importance of ion correlation for multivalent ions such as Mg²⁺ ions in RNA folding. In this study, we develop an all-atom model to predict the ion electrostatics in RNA folding. The model can treat ion correlation effects explicitly by considering an ensemble of discrete ion distributions. In contrast to the previous coarse-grained models that can treat ion correlation, this new model is based on all-atom nucleic acid structures. Thus, unlike the previous coarse-grained models, this new model allows us to treat complex tertiary structures such as HIV-1 DIS type RNA kissing complexes. Theory-experiment comparisons for a variety of tertiary structures indicate that the model gives improved predictions over the Poisson-Boltzmann theory, which underestimates the Mg²⁺ binding in the competition with Na⁺. Further systematic theory-experiment comparisons for a series of tertiary structures lead to a set of analytical formulas for Mg²⁺/Na⁺ ion-binding to various RNA and DNA structures over a wide range of Mg²⁺ and Na⁺ concentrations.     

Dissecting the influence of Mg2+ on 3D architecture and ligand-binding of the guanine-sensing riboswitch aptamer domain

Long-range tertiary interactions determine the three-dimensional structure of a number of metabolite-binding riboswitch RNA elements and were found to be important for their regulatory function. For the guanine-sensing riboswitch of the Bacillus subtilis xpt-pbuX operon, our previous NMR-spectroscopic studies indicated pre-formation of long-range tertiary contacts in the ligand-free state of its aptamer domain. Loss of the structural pre-organization in a mutant of this RNA (G37A/C61U) resulted in the requirement of Mg²⁺ for ligand binding. Here, we investigate structural and stability aspects of the wild-type aptamer domain (Gsw) and the G37A/C61U-mutant (Gsw^loop) of the guanine-sensing riboswitch and their Mg²⁺-induced folding characteristics to dissect the role of long-range tertiary interactions, the link between pre-formation of structural elements and ligand-binding properties and the functional stability. Destabilization of the long-range interactions as a result of the introduced mutations for Gsw^loop or the increase in temperature for both Gsw and Gsw^loop involves pronounced alterations of the conformational ensemble characteristics of the ligand-free state of the riboswitch. The increased flexibility of the conformational ensemble can, however, be compensated by Mg²⁺. We propose that reduction of conformational dynamics in remote regions of the riboswitch aptamer domain is the minimal pre-requisite to pre-organize the core region for specific ligand binding.     

Loop dependence of the stability and dynamics of nucleic acid hairpins

Hairpin loops are critical to the formation of nucleic acid secondary structure, and to their function. Previous studies revealed a steep dependence of single-stranded DNA (ssDNA) hairpin stability with length of the loop (L) as ~L^{8.5 ± 0.5}, in 100 mM NaCl, which was attributed to intraloop stacking interactions. In this article, the loop-size dependence of RNA hairpin stabilities and their folding/unfolding kinetics were monitored with laser temperature-jump spectroscopy. Our results suggest that similar mechanisms stabilize small ssDNA and RNA loops, and show that salt contributes significantly to the dependence of hairpin stability on loop size. In 2.5 mM MgCl₂, the stabilities of both ssDNA and RNA hairpins scale as ~L^{4 ± 0.5}, indicating that the intraloop interactions are weaker in the presence of Mg²⁺. Interestingly, the folding times for ssDNA hairpins (in 100 mM NaCl) and RNA hairpins (in 2.5 mM MgCl₂) are similar despite differences in the salt conditions and the stem sequence, and increase similarly with loop size, ~L^{2.2 ± 0.5} and ~L^{2.6 ± 0.5}, respectively. These results suggest that hairpins with small loops may be specifically stabilized by interactions of the Na⁺ ions with the loops. The results also reinforce the idea that folding times are dominated by an entropic search for the correct nucleating conformation.     

Mechanical Unfolding of Two DIS RNA Kissing Complexes from HIV-1

An RNA kissing complex formed by the dimerization initiation site plays a critical role in the survival and infectivity of human immunodeficiency virus. Two dimerization initiation site kissing sequences, Mal and Lai, have been found in most human immunodeficiency virus 1 variants. Formation and stability of these RNA kissing complexes depend crucially on cationic conditions, particularly Mg²⁺. Using optical tweezers, we investigated the mechanical unfolding of single RNA molecules with either Mal-type (GUGCAC) or Lai-type (GCGCGC) kissing complexes under various ionic conditions. The force required to disrupt the kissing interaction of the two structures, the rip force, is sensitive to concentrations of KCl and MgCl₂; addition of 3 mM MgCl₂ to 100 mM KCl changes the rip force of Mal from 21 ± 4 to 46 ± 3 pN. From the rip force distribution, the kinetics of breaking the kissing interaction is calculated as a function of force and cation concentration. The two kissing complexes have distinct unfolding transition states, as shown by different values of ΔX^‡, which is the distance from the folded structure to the unfolding transition state. The ΔX^‡ of Mal is ∼ 0.6 nm smaller than that of Lai, suggesting that fewer kissing base pairs are broken at the transition state of the former, consistent with observations that the Lai-type kissing complex is more stable and requires significantly more force to unfold than the Mal type. More importantly, neither K⁺ nor Mg²⁺ significantly changes the position of the transition state along the reaction coordinate. However, increasing concentrations of cations increase the kinetic barrier. We derived a cation-specific parameter, m, to describe how the height of the kinetic barrier depends on the concentration of cations. Our results suggest that Mg²⁺ greatly slows down the unfolding of the kissing complex but has moderate effects on the formation kinetics of the structure.     

Comparison of crystal structure interactions and thermodynamics for stabilizing mutations in the Tetrahymena ribozyme

Although general mechanisms of RNA folding and catalysis have been elucidated, little is known about how ribozymes achieve structural stability at high temperature. A previous in vitro evolution experiment identified a small number of mutations that significantly increase the thermostability of the tertiary structure of the Tetrahymena ribozyme. Because we also determined the crystal structure of this thermostable ribozyme, we have for the first time the opportunity to compare the structural interactions and thermodynamic contributions of individual nucleotides in a ribozyme. We investigated the contribution of five mutations to thermostability by using temperature gradient gel electrophoresis. Unlike the case with several well-studied proteins, the effects of individual mutations on thermostability of this RNA were highly context dependent. The three most important mutations for thermostability were actually destabilizing in the wild-type background. A269G and A304G contributed to stability only when present as a pair, consistent with their proximity in the ribozyme structure. In an evolutionary context, this work supports and extends the idea that one advantage of protein enzyme systems over an RNA world is the ability of proteins to accumulate stabilizing single-site mutations, whereas RNA may often require much rarer double mutations to improve the stability of both its tertiary and secondary structures.