Identification and characterization of two upstream elements that regulate adrenocortical expression of steroid 11 beta-hydroxylase

We have studied the mechanisms that regulate the expression of the mouse gene encoding steroid 11 beta-hydroxylase (11 beta-OHase), a steroidogenic cytochrome P450 enzyme that is expressed only in the adrenal cortex. DNase I footprinting and gel-mobility shift analyses revealed potential regulatory elements at -370 and -310 in the 11 beta-OHase promoter region. To determine the contributions of these elements to expression, we altered their sequences by site-selected mutagenesis and studied promoter activity after transfection into Y1 mouse adrenocortical tumor cells. Mutation of either element markedly decreased basal promoter activity but did not affect the response to treatment with 8-bromo cAMP. These experiments thus document the functional roles of these elements, within the context of the intact promoter, in constitutive expression of 11 beta-OHase. Moreover, addition of either of these elements to p-40GH, a 5'-deletion plasmid containing 11 beta-OHase sequences from -40 to +8 upstream of a growth hormone reporter gene, significantly increased promoter activity but did not confer cAMP responsiveness. Finally, increased expression was seen after transfection of Y1 derivatives deficient in cAMP-dependent protein kinase, indicating that neither element required cAMP-dependent protein kinase activity. These studies thus define two regulatory elements that play important roles in 11 beta-OHase expression.     

Novel cAMP regulatory elements in the promoter region of bovine P-450(11 beta) gene

In order to elucidate the cAMP regulatory elements in the promoter region of bovine P-450(11 beta) genes, we analyzed the promoter region using chloramphenicol acetyltransferase (CAT) gene as the reporter. Various deletion plasmids were constructed using the promoter region of CB11 beta-7, which is one of the two normal genes. Examination of the effects of Bt2cAMP on the CAT activities of mouse adrenal tumor cells (Y-1 cells) transfected with these deletion plasmids suggested that two elements named Ad3 and Ad4 play major roles in the induction by cAMP. Ad3(AAGATAAGGCACCCATCCATCTT) is located at -306 bp to -284 bp and Ad4 (CCAAGGTC) is located at -331 bp to -324 bp in the promoter region of the P-450(11 beta) gene. Deletions of both Ad3 and Ad4 resulted in a large decrease of the induction ratio from 9- to 3-fold. Coexistence of Ad3 and Ad4 is essential for their function, because any mutations introduced into either one of them resulted in a decrease of the cAMP induction ratio. These two elements are highly conserved among bovine, mouse, and human P-450(11 beta) genes and have no similarity with known cAMP regulatory elements. DNase I footprint analysis indicated that factors which specifically bind to the two elements exist in the nuclear extract of bovine adrenal cortex cells. Ad3 and Ad4 showed different patterns in gel shift analysis using probes which contained Ad3 or Ad4 sequence, suggesting their interaction with different nuclear factors. We also found two other protected regions by DNase I footprint analysis of the promoter regions of P-450(11 beta) gene, and named them Ad5 and Ad6.(ABSTRACT TRUNCATED AT 250 WORDS)     

Cyclic AMP-dependent and -independent regulation of cholesterol side chain cleavage cytochrome P-450 (P-450scc) in rat ovarian granulosa cells and corpora lutea. cDNA and deduced amino acid sequence of rat P-450scc

We report the isolating and sequencing of three cDNA clones encoding rat P-450scc, the nucleotide and protein sequences of which are highly homologous to those of bovine and human P-450scc, especially in the putative heme and steroid binding domains. We document that different molecular mechanisms regulate P-450scc in granulosa cells of preovulatory (PO) follicles prior to and after luteinization. Luteinizing hormone/human chorionic gonadotropin (LH/hCG) and cAMP are obligatory to induce P-450scc mRNA in PO granulosa cells in vivo and in vitro. Once P-450scc mRNA is induced as a consequence of the LH/hCG surge it is constitutively maintained by luteinized cells in vivo (0-4 days) and in vitro (0-9 days) in the absence of gonadotropins, is susceptible to modulation by prolactin and is no longer regulated by cAMP. Exposure to elevated concentrations of hCG in vivo for 5-7 h was required for PO granulosa cells to undergo a functional transition establishing the stable luteal cell phenotype. Transient exposure of PO + hCG (7 h) follicles in vitro to the RNA synthesis inhibitor actinomycin D (1 microgram/ml) or the protein synthesis inhibitor cycloheximide (10 micrograms/ml), for 1-5 h prior to culturing the granulosa cells failed to disrupt the induction of P-450scc mRNA, progesterone biosynthesis, and appearance of the luteal cell morphology. Inhibitors of protein kinase A (Rp-cAMPS; 1-500 microM and N-[2-(methylamino)ethyl]-5-isoquinolinesulfonamide dihydrochloride (H8); 1-200 microM) added directly to the luteinized cell cultures also failed to alter P-450scc mRNA in these cells, although the cells contain in vivo amounts of mRNA for RII beta, RI alpha, and C alpha, the primary subunits of protein kinase A found in the rat ovary. These data suggest that expression of the P-450scc gene in rat ovarian follicular cells is regulated in a sequential manner by cAMP-dependent and cAMP-independent mechanisms associated with granulosa cells and luteal cells, respectively.