The scientific impact of the Structural Genomics Consortium: a protein family and ligand-centered approach to medically-relevant human proteins

As many of the structural genomics centers have ended their first phase of operation, it is a good point to evaluate the scientific impact of this endeavour. The Structural Genomics Consortium (SGC), operating from three centers across the Atlantic, investigates human proteins involved in disease processes and proteins from Plasmodium falciparum and related organisms. We present here some of the scientific output of the Oxford node of the SGC, where the target areas include protein kinases, phosphatases, oxidoreductases and other metabolic enzymes, as well as signal transduction proteins. The SGC has aimed to achieve extensive coverage of human gene families with a focus on protein–ligand interactions. The methods employed for effective protein expression, crystallization and structure determination by X-ray crystallography are summarized. In addition to the cumulative impact of accelerated delivery of protein structures, we demonstrate how family coverage, generic screening methodology, and the availability of abundant purified protein samples, allow a level of discovery that is difficult to achieve otherwise. The contribution of NMR to structure determination and protein characterization is discussed. To make this information available to a wide scientific audience, a new tool for disseminating annotated structural information was created that also represents an interactive platform allowing for a continuous update of the annotation by the scientific community.     

Systematic localisation of proteins fused to the green fluorescent protein in Bacillus subtilis: identification of new proteins at the DNA replication factory

Construction and microscopic imaging of protein fusions to green fluorescent protein (GFP) have revolutionised our understanding of bacterial structure and function. We have undertaken a systematic study of the localisation of over 100 Bacillus subtilis proteins, following the development of high-throughput construction and analysis procedures. We focused on proteins linked in various ways to the DNA replication machinery, as well as on proteins exemplifying a range of other cellular functions and structures. The results validate the approach as a way of obtaining systematic protein localisation information. They also provide a range of novel biological insights, particularly through the identification of a number of proteins not previously known to be associated with the DNA replication factory.     

The evolution of proteins from random amino acid sequences. I. Evidence from the lengthwise distribution of amino acids in modern protein sequences

Summary We examine in this paper one of the expected consequences of the hypothesis that modern proteins evolved from random heteropeptide sequences. Specifically, we investigate the lengthwise distributions of amino acids in a set of 1,789 protein sequences with little sequence identity using the run test statistic (r _o) of Mood (1940,Ann. Math. Stat. 11, 367–392). The probability density ofr _o for a collection of random sequences has mean=0 and variance=1 [the N(0,1) distribution] and can be used to measure the tendency of amino acids of a given type to cluster together in a sequence relative to that of a random sequence. We implement the run test using binary representations of protein sequences in which the amino acids of interest are assigned a value of 1 and all others a value of 0. We consider individual amino acids and sets of various combinations of them based upon hydrophobicity (4 sets), charge (3 sets), volume (4 sets), and secondary structure propensity (3 sets). We find that any sequence chosen randomly has a 90% or greater chance of having a lengthwise distribution of amino acids that is indistinguishable from the random expectation regardless of amino acid type. We regard this as strong support for the random-origin hypothesis. However, we do observe significant deviations from the random expectation as might be expected after billions years of evolution. Two important global trends are found: (1) Amino acids with a strong α-helix propensity show a strong tendency to cluster whereas those with β-sheet or reverse-turn propensity do not. (2) Clustered rather than evenly distributed patterns tend to be preferred by the individual amino acids and this is particularly so for methionine. Finally, we consider the problem of reconciling the random nature of protein sequences with structurally meaningful periodic “patterns” that can be detected by sliding-window, autocorrelation, and Fourier analyses. Two examples, rhodopsin and bacteriorhodopsin, show that such patterns are a natural feature of random sequences.     

Lamins of the sea lamprey (Petromyzon marinus) and the evolution of the vertebrate lamin protein family

Lamin proteins are found in all metazoans. Most non-vertebrate genomes including those of the closest relatives of vertebrates, the cephalochordates and tunicates, encode only a single lamin. In teleosts and tetrapods the number of lamin genes has quadrupled. They can be divided into four sub-types, lmnb1, lmnb2, LIII, and lmna, each characterized by particular features and functional differentiations. Little is known when during vertebrate evolution these features have emerged. Lampreys belong to the Agnatha, the sister group of the Gnathostomata. They split off first within the vertebrate lineage. Analysis of the sea lamprey (Petromyzon marinus) lamin complement presented here, identified three functional lamin genes, one encoding a lamin LIII, indicating that the characteristic gene structure of this subtype had been established prior to the agnathan/gnathostome split. Two other genes encode lamins for which orthology to gnathostome lamins cannot be designated. Search for lamin gene sequences in all vertebrate taxa for which sufficient sequence data are available reveals the evolutionary time frame in which specific features of the vertebrate lamins were established. Structural features characteristic for A-type lamins are not found in the lamprey genome. In contrast, lmna genes are present in all gnathostome lineages suggesting that this gene evolved with the emergence of the gnathostomes. The analysis of lamin gene neighborhoods reveals noticeable similarities between the different vertebrate lamin genes supporting the hypothesis that they emerged due to two rounds of whole genome duplication and makes clear that an orthologous relationship between a particular vertebrate paralog and lamins outside the vertebrate lineage cannot be established.     

Characterization of the Trypanosoma cruzi ortholog of the SBDS protein reveals an intrinsically disordered extended C-terminal region showing RNA-interacting activity

The human SBDS gene and its yeast ortholog SDO1 encode essential proteins that are involved in ribosome biosynthesis. SDO1 has been implicated in recycling of the ribosomal biogenesis factor Tif6p from pre-66S particles as well as in translation activation of 60S ribosomes. The SBDS protein is highly conserved, containing approximately 250 amino acid residues in animals, fungi and Archaea, while SBDS orthologs of plants and a group of protists contain an extended C-terminal region. In this work, we describe the characterization of the Trypanosoma cruzi SBDS ortholog (TcSBDS). TcSBDS co-fractionates with polysomes in sucrose density gradients, which is consistent with a role in ribosome biosynthesis. We show that TcSBDS contains a C-terminal extension of 200 amino acids that displays the features of intrinsically disordered proteins as determined by proteolytic, circular dichroism and NMR analyses. Interestingly, the C-terminal extension is responsible for TcSBDS–RNA interaction activity in electrophoretic mobility shift assays. This finding suggests that Trypanosomatidae and possibly also other organisms containing SBDS with extended C-terminal regions have evolved an additional function for SBDS in ribosome biogenesis.     

Rapid evolution of great kiskadees on Bermuda: an assessment of the ability of the island rule to predict the direction of contemporary evolution in exotic vertebrates

Aim To determine whether an exotic bird species, the great kiskadee (Pitangus sulphuratus), has diverged in morphology from its native source population, and, if so, has done so in a manner predicted by the island rule. The island rule predicts that insular vertebrates will tend towards dwarfism or gigantism when isolated on islands, depending on their body size. For birds, the island rule predicts that species with body sizes below 70–120 g should increase in size. The great kiskadee has a mean mass of c. 60 g in its native range, therefore we predicted that it would increase in size within the exotic, and more insular, Bermudan range. Location The islands of Bermuda (exotic population) and Trinidad (native source population). Methods We took eight morphological measurements on 84 individuals captured in the exotic (Bermudan) population and 62 individuals captured in the native source (Trinidadian) population. We compared morphological metrics between populations using univariate and principal components analyses. We assessed whether the effects of genetic drift could explain observed differences in morphology. We calculated divergence rates in haldanes and darwins for comparison with published examples of contemporary evolution. Finally, we used mark–recapture analysis to determine the effects of the measured morphological characters on survivorship within the exotic Bermudan population. Results Individuals in the exotic Bermudan population have larger morphological dimensions than individuals in the native source population on Trinidad. The degree of divergence in body mass (g) and bill width (mm) is probably not due to genetic drift. This rate of divergence is nearly equal to that observed amongst well‐documented examples of contemporary bird evolution, and is within the mid‐range of rates reported across taxa. There is no clear effect of body size on survivorship as only one character (bill width) was found to have an influence on individual survivorship. Main conclusions Exotic species provide useful systems for examining evolutionary predictions over contemporary time‐scales. We found that divergence between the exotic and native populations of this bird species occurred over c. 17 generations, and was in the direction predicted by the island rule, a principle based on the study of native species.     

Addition of negatively charged residues can reverse the decrease in the solubility of an acidic protein caused by an artificially introduced non-polar surface patch

A non-polar patch on the surface of a protein can cause a reduction in the solubility and stability of the protein, and thereby induce aggregation. However, a non-polar patch may be required so that the protein can bind to another molecule. The mutant 6L—derived from the acidic, dimeric α-helical protein sulerythrin and containing six additional leucines arranged to form a non-polar patch on its surface when properly folded—has a substantially reduced solubility in comparison with that of wild-type sulerythrin. This reduced solubility appears to cause 6L to aggregate. To reverse this aggregation, we mutated 6L so that it contained three to six additional glutamates or aspartates that we predicted would surround the non-polar leucine patch on natively folded 6L. Although the introduction of three glutamates or aspartates increased solubility, the mutants still aggregate and have a reduced α-helical content. Conversely, mutants with six additional glutamates or aspartates appear to exist mostly as dimers and to have the same α-helical content as that of wild-type sulerythrin. Notably, the introduction of five lysines or five arginines at the positions held by the glutamates or aspartates did not recover solubility as effectively as did the negatively charged residues. These results demonstrate that negatively charged residues, but not positively charged ones, surrounding a non-polar patch on an acidic protein can completely reverse the decrease in its solubility caused by the patch of non-polar surface residues.     

The Saccharomyces cerevisiae genes ( CMP1 and CMP2 ) encoding calmodulin-binding proteins homologous to the catalytic subunit of mammalian protein phosphatase 2B

Summary Saccharomyces cerevisiae genomic clones that encode calmodulin-binding proteins were isolated by screening a λgt11 expression library using¹²⁵I-labeled calmodulin as probe. Among the cloned yeast genes, we found two closely related genes (CMP1 andCMP2) that encode proteins homologous to the catalytic subunit of phosphoprotein phosphatase. The presumed CMP1 protein (62999 Da) and CMP2 protein (68496 Da) contain a 23 amino acid sequence very similar to those identified as calmodulin-binding sites in many calmodulin-regulated proteins. The yeast genes encode proteins especially homologous to the catalytic subunit of mammalian phosphoprotein phosphatase type 213 (calcineurin). The products of theCMP1 andCMP2 genes were identified by immunoblot analysis of cell extracts as proteins of 62000 and 64000 Da, respectively. Gene disruption experiments demonstrated that elimination of either or both of these genes had no effect on cell viability, indicating that these genes are not essential for normal cell growth.     

Gene technology-based antimetabolite design: the use of an in vitro protein expression system to facilitate antimetabolite design for virally-induced human diseases and malignant conditions

A precondition for the chemotherapeutic treatment of a variety of virally-induced human diseases and malignant conditions is a highly selective interaction of the drug molecule to be used with it's biological target. To ensure the development of novel, effective drugs, it is essential that the biological target is well characterised with regard to it's structure and activity. Such characterisation relies upon adequate amounts of pure target being available. One of the most important enzymatic importers for antimetabolites is the enzyme thymidine kinase. In this article an in vitro protein expression system is described which facilitates the production of milligram amounts of pure and biologically active thymidine kinase, from a number of important biological sources. Results have shown that the in vitro produced enzyme has the exact biochemical propeties of the in vivo enzyme. Thus the in vitro protein expression system is an ideal vechicle to facilitate an in depth investigation of the enzyme's biological properties.     

Genome-wide analysis of transcription factor E2F1 mutant proteins reveals that N- and C-terminal protein interaction domains do not participate in targeting E2F1 to the human genome

Previous studies of E2F family members have suggested that protein-protein interactions may be the mechanism by which E2F proteins are recruited to specific genomic regions. We have addressed this hypothesis on a genome-wide scale using ChIP-seq analysis of MCF7 cell lines that express tagged wild type and mutant E2F1 proteins. First, we performed ChIP-seq for tagged WT E2F1. Then, we analyzed E2F1 proteins that lacked the N-terminal SP1 and cyclin A binding domains, the C-terminal transactivation and pocket protein binding domains, and the internal marked box domain. Surprisingly, we found that the ChIP-seq patterns of the mutant proteins were identical to that of WT E2F1. However, mutation of the DNA binding domain abrogated all E2F1 binding to the genome. These results suggested that the interaction between the E2F1 DNA binding domain and a consensus motif may be the primary determinant of E2F1 recruitment. To address this possibility, we analyzed the in vivo binding sites for the in vitro-derived consensus E2F1 motif (TTTSSCGC) and also performed de novo motif analysis. We found that only 12% of the ChIP-seq peaks contained the TTTSSCGC motif. De novo motif analysis indicated that most of the in vivo sites lacked the 5' half of the in vitro-derived consensus, having instead the in vivo consensus of CGCGC. In summary, our findings do not provide support for the model that protein-protein interactions are involved in recruiting E2F1 to the genome, but rather suggest that recognition of a motif found at most human promoters is the critical determinant.     

Disulfide bonds convert small heat shock protein Hsp16.3 from a chaperone to a non-chaperone: implications for the evolution of cysteine in molecular chaperones

Molecular chaperones mainly function in assisting newly synthesized polypeptide folding and protect non-native proteins from aggregation, with known structural features such as the ability of spontaneous folding/refolding and high conformational flexibility. In this report, we verified the assumption that the lack of disulfide bonds in molecular chaperones is a prerequisite for such unique structural features. Using small heat shock protein (one sub-class of chaperones) Hsp16.3 as a model system, our results show the following: (1) Cysteine-free Hsp16.3 wild type protein can efficiently exhibit chaperone activity and spontaneously refold/reassemble with high conformational flexibility. (2) Whereas Hsp16.3 G89C mutant with inter-subunit disulfide bonds formed seems to lose the nature of chaperone proteins, i.e., under stress conditions, it neither acts as molecular chaperone nor spontaneously refolds/reassembles. Structural analysis indicated that the mutant exists as an unstable molten globule-like state, which incorrectly exposes hydrophobic surfaces and irreversibly tends to form aggregates that can be suppressed by the other molecular chaperone (alpha-crystallin). By contrast, reduction of disulfide bond in the Hsp16.3 G89C mutant can significantly recover its character as a molecular chaperone. In light of these results, we propose that disulfide bonds could severely disturb the structure/function of molecular chaperones like Hsp16.3. Our results might not only provide insights into understanding the structural basis of chaperone upon binding substrates, but also explain the observation that the occurrence of cysteine in molecular chaperones is much lower than that in other protein families, subsequently being helpful to understand the evolution of protein family.     

Arabidopsis Zinc Ribbon 3 is the ortholog of yeast mitochondrial HSP70 escort protein HEP1 and belongs to an ancient protein family in mitochondria and plastids

ZR proteins belong to a phylogenetically conserved family of small zinc-ribbon proteins in plastids and mitochondria of higher plants. The function of these proteins is so far unclear. The mitochondrial proteins share sequence similarities with mitochondrial Hsp70 escort proteins (HEP) from Saccharomyces cerevisiae (HEP1) and human. Expression of the mitochondrial ZR protein from Arabidopsis, ZR3, rescued a hep1 knockout mutant from yeast. Accordingly, ZR3 was found to physically interact with mitochondrial Hsp70 from Arabidopsis. Our findings support the idea that mitochondrial and plastidic ZR proteins from higher plants are orthologs of HEP proteins.

Structured summary of protein interactions

ZR3physically interacts with mtHSC70-2 by pull down (View interaction)ZR3physically interacts with mtHSC70-1 by pull down (View interaction)     

The use of a water-in-oil adjuvanted vaccine in an attempt to immunize lambs against Taenia ovis cysts in the presence of maternal antibody

An attempt was made to actively immunize lambs during the period when they had maternally-acquired antibody, so that there would be no time when lambs were susceptible to Taenia ovis infection. A slow-release water-in-oil adjuvanted vaccine containing T. ovis oncosphere products was used. Half the ewes were vaccinated prior to parturition and lambs were vaccinated at approx. 5 weeks of age. At necropsy, after challenge infection, vaccinated lambs had a mean of 39 cysts, compared to 131 in unvaccinated control lambs (p < 0.05), but there was no effect on development or survival of the established cysts. The presence of passively-acquired anti-oncosphere antibody at the time of vaccination did appear to influence the degree of antibody response, and the level of protection induced. However, there was no correlation between levels of antibody at vaccination and levels of protection induced, because of the considerable individual variation between lambs. In non-vaccinated control lambs, the serological response to challenge infection was also highly variable.Some vaccinated lambs developed a strong primary serological response and were mostly (5/7) fully protected. Lesser degrees of primary response in other lambs did not fully protect. All vaccinated lambs gave a rapid secondary response after challenge, but it was too late to be protective. The immunization procedure, although effective in some lambs and partially effective in most, cannot be recommended.     

ProSAP/Shank proteins - a family of higher order organizing molecules of the postsynaptic density with an emerging role in human neurological disease

The postsynaptic density (PSD) is a specialized electron-dense structure underneath the postsynaptic plasmamembrane of excitatory synapses. It is thought to anchor and cluster glutamate receptors exactly opposite to the presynaptic neurotransmitter release site. Various efforts to study the molecular structure of the PSD identified several new proteins including membrane receptors, cell adhesion molecules, components of signalling cascades, cytoskeletal elements and adaptor proteins with scaffolding functions to interconnect these PSD components. The characterization of a novel adaptor protein family, the ProSAPs or Shanks, sheds new light on the basic structural organization of the PSD. ProSAPs/Shanks are multidomain proteins that interact directly or indirectly with receptors of the postsynaptic membrane including NMDA-type and metabotropic glutamate receptors, and the actin-based cytoskeleton. These interactions suggest that ProSAP/Shanks may be important scaffolding molecules of the PSD with a crucial role in the assembly of the PSD during synaptogenesis, in synaptic plasticity and in the regulation of dendritic spine morphology. Moreover the analysis of a patient with 22q13.3 distal deletion syndrome revealed a balanced translocation with a breakpoint in the human ProSAP2/Shank3 gene. This ProSAP2/Shank3 haploinsufficiency may cause a syndrome that is characterized by severe expressive language delay, mild mental retardation and minor facial dysmorphisms.     

Channeling of exogenous phenylalanine to the sites of storage and the sites of alkaloid and protein biosynthesis in Penicillium cyclopium

Externally applied l-phenylalanine rapidly equilibrates with the cytosolic pool(s) in hyphae of emerged cultures of Penicillium cyclopium. If not incorporated into protein it is accumulated in the so called expandable pool, which is presumably localized in the vacuolar compartment. At high concentrations of exogenous l-phenylalanine practically all of the amino acid needed for protein synthesis comes from the extracellular source, contrary to alkaloid synthesis which under all conditions recruits more than 90% of the required l-phenylalanine from intracellular sources. Two pathways of alkaloid labelling can be distinguished, by which externally applied l-phenylalanine reaches the sites of alkaloid synthesis: (1) a direct way from cytosolic pool (primary labelling) and (2) an indirect way via the expandable pool (secondary labelling).     

Predictive models for the accumulation of a fluorescent marker protein in tobacco leaves according to the promoter/5′UTR combination

The promoter and 5′‐untranslated region (5′UTR) play a key role in determining the efficiency of recombinant protein expression in plants. Comparative experiments are used to identify suitable elements but these are usually tested in transgenic plants or in transformed protoplasts/suspension cells, so their relevance in whole‐plant transient expression systems is unclear given the greater heterogeneity in expression levels among different leaves. Furthermore, little is known about the impact of promoter/5′UTR interactions on protein accumulation. We therefore established a predictive model using a design of experiments (DoE) approach to compare the strong double‐enhanced Cauliflower mosaic virus 35S promoter (CaMV 35SS) and the weaker Agrobacterium tumefaciens Ti‐plasmid nos promoter in whole tobacco plants transiently expressing the fluorescent marker protein DsRed. The promoters were combined with one of three 5′UTRs (one of which was tested with and without an additional protein targeting motif) and the accumulation of DsRed was measured following different post‐agroinfiltration incubation periods in all leaves and at different leaf positions. The model predictions were quantitative, allowing the rapid identification of promoter/5′UTR combinations stimulating the highest and quickest accumulation of the marker protein in all leaves. The model also suggested that increasing the incubation time from 5 to 8 days would reduce batch‐to‐batch variability in protein yields. We used the model to identify promoter/5′UTR pairs that resulted in the least spatiotemporal variation in expression levels. These ideal pairs are suitable for the simultaneous, balanced production of several proteins in whole plants by transient expression. Biotechnol. Bioeng. 2013; 110: 471–482. © 2012 Wiley Periodicals, Inc.     

Analysis of an abscisic acid (ABA)-responsive gene promoter belonging to the Asr gene family from tomato in homologous and heterologous systems

Asr is a family of genes that maps to chromosome 4 of tomato. Asr2, a recently reported member of this family, is believed to be regulated by abscisic acid (ABA), stress and ripening. A genomic Asr2 clone has been fully sequenced, and candidate upstream regulatory elements have been identified. To prove that the promoter region is functional in vivo, we fused it upstream of the β-glucuronidase (GUS) reporter gene. The resulting chimeric gene fusion was used for transient expression assays in papaya embryogenic calli and leaves. In addition, the same construct was used to produce transgenic tomato, papaya, tobacco, and potato plants. Asr2 upstream sequences showed promoter function in all of these systems. Under the experimental conditions tested, ABA stimulated GUS expression in papaya and tobacco, but not in tomato and potato systems. Received: 24 March 1997 / Accepted: 26 November 1997     

Bioinformatics evidence for the transfer of mycosporine-like amino acid core (4-deoxygadusol) synthesizing gene from cyanobacteria to dinoflagellates and an attempt to mutate the same gene (YP_324358) in Anabaena variabilis PCC 7937

We have identified a homologue of 4-deoxygadusol (core of mycosporine-like amino acids) synthesizing gene (ZP_05036788) from Synechococcus sp. PCC 7335 that was found to have additional functionally unknown N-terminal domain similar to homologues from dinoflagellates based on the ClustalW analysis. Phylogenetic analysis revealed that Synechococcus sp. (ZP_05036788) makes a clade together with dinoflagellates and was closest to the Oxyrrhis marina. This study shows for the first time that N-terminal additional sequences that possess upstream plastid targeting sequence in Heterocapsa triquetra and Karlodinium micrum were already evolved in cyanobacteria, and plastid targeting sequence were evolved later in dinoflagellates after divergence from chloroplast lacking Oxyrrhis marina. Thus, MAAs synthesizing genes were transferred from cyanobacteria to dinoflagellates and possibly Synechococcus sp. PCC 7335 acted as a donor during lateral gene transfer event. In addition, we also tried to mutate 4-deoxygadusol synthesizing gene (YP_324358) of Anabaena variabilis PCC 7937 by homologous recombination, however, all approaches to get complete segregation of the mutants from the wild-type were unsuccessful, showing the essentiality of YP_324358 for A. variabilis PCC 7937.     

Agouti signalling protein is an inverse agonist to the wildtype and agonist to the melanic variant of the melanocortin-1 receptor in the grey squirrel (Sciurus carolinensis)

The melanocortin-1 receptor (MC1R) is a key regulator of mammalian pigmentation. Melanism in the grey squirrel is associated with an eight amino acid deletion in the mutant melanocortin-1 receptor with 24 base pair deletion (MC1RΔ24) variant. We demonstrate that the MC1RΔ24 exhibits a higher basal activity than the wildtype MC1R (MC1R-wt). We demonstrate that agouti signalling protein (ASIP) is an inverse agonist to the MC1R-wt but is an agonist to the MC1RΔ24. We conclude that the deletion in the MC1RΔ24 leads to a receptor with a high basal activity which is further activated by ASIP. This is the first report of ASIP acting as an agonist to MC1R.     

Identification of a Bombyx mori gene encoding small heat shock protein BmHsp27.4 expressed in response to high-temperature stress

Elucidating the mechanisms underlying the response and resistance to high-temperature stress in the Lepidoptera is essential for understanding the effect of high-temperature on the regulation of gene expression. A tag (CATGAACGTGAAGAGATTCAG) matching the predicted gene BGIBMGA005823-TA in SilkDB identified the most significant response to high-temperature stress in a screen of the heat-treated digital gene expression library of Bombyx mori (B. mori) (Unpublished data). BLAST and RACE showed that the gene is located on chromosome 5 and has an open reading frame (ORF) of 741 bp. Phylogenetic analysis found that B. mori small heat shock protein 27.4 (BmHSP27.4) is in an evolutionary branch separate from other small heat shock proteins. Expression analysis showed that BmHsp27.4 is highly expressed in brain, eyes and fat bodies in B. mori. Its mRNA level was elevated at high-temperature and this increase was greater in females. The ORF without the signal peptide sequence was cloned into vector pET-28a(+), transformed and over-expressed in Escherichia coli Rosetta (DE3). Western blotting and immunofluorescence analysis with a polyclonal antibody, confirmed that the level of protein BmHSP27.4 increased at a high-temperature, in accordance with its increased mRNA level. In this study, BmHsp27.4 was identified as a novel B. mori gene with an important role in response to high-temperature stress.