The regulatory region of MS2 phage RNA replicase cistron. Functional activity of individual MS2 RNA fragments

The present work deals with the structural-functional organization of regulatory regions of messenger RNAs. Some principles of the action of a translational repressor (coat protein) and the formation of the ribosomal initiation complex at the replicase cistron have been studied with MS2 phage RNA. When the complex of MS2 RNA with the coat protein is treated with T₁ ribonuclease, the coat protein selectively protects mainly two fragments (59 and 103 nucleotides in length) from digestion; these fragments contain the intercistronic regulatory region and the beginning of the MS2 replicase cistron. These polynucleotides have been isolated in a pure state and their primary structure has been established.It has been established that both MS2 RNA fragments contain all the necessary information for specific interaction with MS2 coat protein and form a complex with it with an efficiency close to that observed in the case of native MS2 RNA. They also provide the normal polypeptide chain initiation at the replicase cistron. Enzymatic binding of the second aminoacyl-tRNA and electrophoretic analysis of N-terminal dipeptides prove that only the true initiator codon of the replicase cistron is recognized by a ribosome despite the presence of a few additional AUG triplets within the polynucleotides. Under conditions of limited hydrolysis by T₁ ribonuclease, the beginning of the replicase cistron has been removed from the shortest polynucleotide leading to a complete loss of its ability to bind both the coat protein and a ribosome.Some principles of the functioning of the regulatory region in MS2 RNA as well as the nature of the initiator signal of protein biosynthesis are discussed.     

Regulatory region of fr phage replicase cistron. II. Isolation and structure of specific fr RNA fragments

A new set of short RNA templates has been prepared for functional studies in initiation of translation in vitro. Number of individual RNA fragments which contain complete or part of the initiatory region of phage fr replicase cistron were isolated from complex fr RNA--fr coat protein. Their primary structure were determined by using standard fingerprint technique and rapid gel sequencing. Secondary structure of several RNA fragments and their binding activity with phage fr and MS2 coat proteins has been also studied.     

The binding site for coat protein on bacteriophage Qbeta RNA.

The site of interaction of phage Qbeta coat protein with Qbeta RNA was determined by ribonuclease T1 degradation of complexes of coat protein and [32P]-RNA obtained by codialysis of the components from urea into buffer solutions. The degraded complexes were recovered by filtration through nitrocellulose filters, and bound [32P]RNA fragments were extracted and separated by polyacrylamide gel electrophoresis. Fingerprinting and further sequence analysis established that the three main fragments obtained (chain lengths 88, 71 and 27 nucleotides) all consist of sequences extending from the intercistronic region to the beginning of the replicase cistron. These results suggest that in the replication of Qbeta, as in the case of R17, coat protein acts as a translational repressor by binding to the ribosomal initiation site of the replicase cistron.     

Synthesis and functional activity of translation initiation regions in mRNA. 20-base polyribonucleotides from the replicase gene of phage MS2 and fr

Three 20-base polyribonucleotides, AAACAUGAGGAAUACCCAUG (I), AAACAUGAGGAAAACCCAUG (II), AAACAUGAAGAAUACCCAUG (III), corresponding to the minimal initiation region for the replicase gene of phage MS2 and fr or having some differences were synthesized using enzymatic methods. The template activity of the synthesized polynucleotides in initiation and their capacity to bind phage coat protein were studied under conditions optimal for native mRNA. Polynucleotides I and II exhibit template activity comparable to that of the native phage RNA fragments. Polynucleotide III with the destroyed SD sequence dit not manifest any functional activity either as template or in binding to MS2 phage coat protein.     

The regulatory region of MS2 phage RNA replicase cistron. III. Characterization of fragments resulting from S1 nuclease digestion.

The functionally active fragments MS2 R(-53 leads to 6) and MS2 R(-53 leads to 3) comprising the regulatory region for the replicase cistron have been isolated from MS2 RNA-coat protein complex following T1 RNase digestion. In order to obtain shorter fragments, active in coat protein binding and initiation of translation, MS2 R(-53 leads to 6) was cleaved with S1 nuclease. The results indicate that S1 nuclease attacks the most susceptible loop regions of the two hairpin helices of MSZ R(-53) leads to 6). Among the three fragments which have been isolated, only MS2 R(-35/33 leads to 6) containing the intact hairpin (b) region with initiation codon AUG is active in the coat protein binding. Functional activity exerted by another polynucleotide MS R(-17 leads to 6) supports the assumption that specific binding with the coat protein is determined by the hairpin (b) region prior to the replicase cistron.     

The regulatory region of MS2 phage RNA replicase cistron. IV. Functional activity of specific MS2 RNA fragments in formation of the 70 S initiation complex of protein biosynthesis.

The initiation region of the MS2 replicase cistron can be isolated as a fragment 59 bases in length protected from RNAase by the binding of the coat protein which serves as a translational repressor. This fragment MS2 R(-53 leads to 6) starts 53 bases before the initiation codon and retains full activity in binding ribosomes. We have investigated the functional activity in initiation of a series of fragments from this region variously shortened from the 5'-end. Ribosome protected fragments starting 17 or 21 bases before the AUG are unable to rebind to ribosomes. The shortest fragment which has this activity was produced by partial S1 nuclease digestion and starts 33 to 35 bases before the AUG. The initiation signal comprises some nucleotides between 21 and 33 bases before the initiation codon and the regulatory region responsible for initiation is longer than that protected by the ribosome in the final initiation complex.     

Escherichia coli ribosomes bind to non-initiator sites of Q beta RNA in the absence of formylmethionyl-tRNA.

Escherichia coli ribosomes and Qβ [³²P]RNA were incubated with or without fMet-tRNA under protein initiation conditions, treated with RNase A, and centrifuged through a sucrose density gradient. The sample incubated with fMet-tRNA gave a main radioactivity peak in the 70 S region, which consisted predominantly of coat cistron initiator fragments. After incubation without fMet-tRNA, equal amounts of radioactivity were found in the 70 S and the 30 S regions, but in both peaks almost all of the radioactivity was duo to three RNase A-resistant oligonucleotides, A-G-A-G-G-A-G-G-Up (P-2a), A-G-G-G-G-G-Up (P-15) and G-G-A-A-G-G-A-G-Cp (P-4). These three oligonucleotides are derived from three different RNA regions, none of which is close to a protein initiation site. All three fragments show striking complementarity to the 3′-terminal region of E. coli 16 S RNA. Ribosomes incubated with an RNase A digest of Qβ [³²P]RNA bound almost exclusively oligonucleotide P-2a; treatment with cloacin DF13 cleaved off a complex consisting of a 49-nucleotide long segment of 16 S rRNA and oligonucleotide P-2a. These experiments show that the interaction of 30 S ribosomes with the “Shine-Dalgarno” region preceding the initiator codon of the Qβ coat cistron is insufficient to direct correct placement of the ribosome on the viral RNA, and that an additional contribution from the interaction of fMet-tRNA with the initiator triplet is required for ribosome binding to the initiator region.     

Resynchronization of RNA synthesis by coliphage Qbeta replicase at an internal site of the RNA template

In previous work Qβ replicase has been used to synthesize labelled 5′ terminal segments of Qβ plus or minus strands of defined length. A procedure has now been developed which allows resynchronization of Qβ replicase at an internal position and synthesis of a labelled minus-strand segment complementary to the coat cistron ribosome binding site and the intercistronic region between the A₂ (maturation) and the coat cistron. Resynchronization is accomplished by binding a ribosome to Qβ RNA and allowing Qβ replicase to initiate and elongate up to the ribosome, using unlabelled ribonucleoside triphosphates. The ribosome is dissociated by EDTA treatment and the EDTA is removed. The replicating complex remains functional after this treatment, and addition of labelled substrates leads to synchronized elongation. The radioactive part of the product recovered after a short elongation period with labelled substrates was shown to be complementary to the coat protein ribosome binding site.     

Mechanism of translational coupling between coat protein and replicase genes of RNA bacteriophage MS2.

We have analyzed the molecular mechanism that makes translation of the MS2 replicase cistron dependent on the translation of the upstream coat cistron. Deletion mapping on cloned cDNA of the phage shows that the ribosomal binding site of the replicase cistron is masked by a long distance basepairing to an internal coat cistron region. Removal of the internal coat cistron region leads to uncoupled replicase synthesis. Our results confirm the model as originally proposed by Min Jou et al. (1). Activation of the replicase start is sensitive to the frequency of upstream translation, but never reaches the level of uncoupled replicase synthesis.     

Q beta RNA bacteriophage: mapping cis-acting elements within an RNA genome

We have identified, for the first time, regions of cis-acting RNA elements within the bacteriophage Q beta replicase cistron by analyzing the infectivities of 76 replicase gene mutant phages in the presence of a helper replicase. Two separate classes of mutant Q beta phage genomes (35 different insertion mutants, each containing an insertion of 3 to 15 nucleotides within the replicase gene, and 41 deletion genomes, each having from 15 to 935 nucleotides deleted from different regions of the gene) were constructed, and their corresponding RNAs were tested for the ability to direct the formation of progeny virus particles. Each mutant phage was tested for plaque formation in an Escherichia coli (F+) host strain that supplied helper Q beta replicase in trans from a plasmid DNA. Of the 76 mutant genomes, 34% were able to direct virus production at or close to wild-type levels (with plaque yield ratios of greater than 0.5), another 36% also produced virus particles, but at much lower levels than those of wild-type virus (with plaque yield ratios of less than 0.05), and the remaining 30% produced no virus at all. From these data, we have been able to define regions within the Q beta replicase gene that contain functional cis-acting RNA elements and further correlate them with regions of RNA that are solely required to code for functional RNA polymerase.     

Ribosomal protein S1 in the complex of E. coli ribosomal subunit 30S with phage MS2 RNA interacts with internal region of the replicase gene

The MS2 RNA fragments bound to ribosomal protein S1 within the complex of MS2 RNA with 30S ribosomal subunit have been isolated using a specially developed procedure and sequenced by the base-specific enzymatic method. The S1-binding site on MS2 RNA was identified as UUUCUUACAUGACAAAUCCUUGUCAUG and mapped within the replicase gene at positions 2030-2056. This finding suggests that ribosome-MS2 RNA interaction involves at least two different regions of the phage RNA--the internal region of the replicase gene (S1-binding site) and ribosome-binding site of the coat protein gene. The possible spatial proximity between these two regions is discussed.     

Binding of mammalian ribosomes to MS2 phage RNA reveals an overlapping gene encoding a lysis function.

The main binding site for mammalian ribosomes on the single-stranded RNA of bacteriophage MS2 is located nine tenths of the way through the coat protein gene. Translation initiated at an AUG triplet in the +1 frame yields a 75 amino acid polypeptide which terminates within the synthetase gene at a UAA codon, also in the +1 frame. Partial amino acid sequence analysis of the product synthesized in relatively large amounts by mammalian ribosomes confirms this assignment of the overlapping cistron. The same protein is made in an E. coli cell-free system, but only in very small amounts. Analysis of the translation products directed by RNA from op3, a UGA nonsense mutant of phage f2, identifies the overlapping cistron as a lysis gene. In this paper we show that the op3 mutation is a C yield U transition occurring in the second codon of the synthetase cistron, which explains the lowered production of phage replicase (as well as lack of lysis) upon op3 infection of nonpermissive cells. We discuss the properties of the overlapping gene in relation to its lysis function, recognition of the lysis initiator region by E. coli versus eucaryotic ribosomes and op3 as a ribosome binding site mutant for the f2 synthetase cistron.     

Escherichia coli ribosomal protein S1 recognizes two sites in bacteriophage Qbeta RNA.

As a component of bacteriophage Qbeta replicase, S1 is required both for initiation of Qbeta minus strand RNA synthesis and for translational repression, which has been traced to the ability of the enzyme to bind to an internal site in the Qbeta RNA molecule. Previously, Senear and Steitz (Senear, A. W., and Steitz, J. A. (1976) J. Biol. Chem. 251, 1902-1912) found that isolated S1 protein binds specifically to an oligonucleotide spanning residues -38 to -63 from the 3' terminus of Qbeta RNA. Here we report that S1 also interacts strongly with a second oligonucleotide in Qbeta RNA, which is derived from the region recognized by replicase just 5' to the Qbeta coat protein cistron. Both sequences exhibit pyrimidine-rich regions.     

Regulation of RNA replication in RNA-containing bacteriphages. RNA synthesis in coat protein polar mutants]

The synthesis of RNA by polar coat protein mutants f2sus3 and Qbetaam12 under suppressor (Escherichia coli S26R1E, Su+-1; H12R8a Su+-3) and non-suppressor (E. coli AB259; S26) conditions was examined. It was demonstrated that the synthesis of viral RNA under non-suppressor conditions in the presence of rifamycin produced the same gaussian pattern of rates as the synthesis of RNA by wild type phage or non-polar coat protein mutants. However, the total amount of RNA was decreased approximately 10-fold and the peak of RNA synthesis was displaced 7--10 min later. The number of infective centers was reduced also 10-fold indicating that a certain time-lapse was required to overcome the polarity of the parental RNA, this process being of single occurrence, exclusively on the parental RNA, but not on the progeny strains. As a consequence, it was concluded that the initiation of translation at the replicase cistron starts on the nascent RNA chains within the replicative complexes and not on the fully-synthesized templates with their complete secondary structure. The data obtained are not in contradiction with the hypothesis concerning the role of the repressor complex II (replicase-RNA) to slow down the synthesis of replicase and RNA in the coat protein mutants. The polarity can not be responsible probably for the blocking of the replicase cistron on the nascent chain following the block of coat protein cistron. Therefore, it appears appropriate to assume the existence of two binding sites for the replicase as repressor which is in keeping with the conclusions of Weissmann and co-workers.     

Interactions of Q beta replicase with Q beta RNA

The interactions of Qβ replicase with Qβ RNA were investigated by treating replicase-Qβ RNA complexes under various conditions with ribonuclease T₁, and by characterizing enzyme-bound RNA fragments recovered by a filter binding technique. Evidence for replicase binding at two internal regions of Qβ RNA was obtained. One region (at about 1250 to 1350 nucleotides from the 5′ end) overlaps with the initiation site for coat protein synthesis; this interaction is thought to be inessential for template activity but rather to be involved in the regulation of protein synthesis. Binding to this site (called the S-site) requires moderate concentrations of salt but no magnesium ions. The other region (at about 2550 to 2870 nucleotides from the 5′ end) is probably essential for template activity; binding to this site (called the M-site) is dependent on the presence of magnesium ions. The nucleotide sequences of the RNA fragments from the two sites were determined and found to have no common features. Under the conditions tested, replicase binding at the 3′ end of Qβ RNA could not be demonstrated, except when initiation of RNA synthesis was allowed to occur in the presence of GTP and host factor. If instead of intact Qβ RNA, a complete RNAase T₁ digest of Qβ RNA was allowed to bind to replicase, oligonucleotides from the S-site and the M-site, and oligonucleotides from a region close to the 3′ end, were found to have the highest affinity to the enzyme.The RNA fragments recovered in highest yield, M-2 and S-3 from the M and S-site, respectively, were isolated on a preparative scale and their enzyme binding properties were studied. In competition assays with random RNA fragments of the same size, selective binding was observed both for the M and the S-site fragment. Partial competition for replicase binding was found if M-2 and S-3 were presented simultaneously to the enzyme. Either fragment, if preincubated with replicase, caused a specific inhibition of initiation of Qβ RNA-directed RNA synthesis, without inhibiting the poly(rC)-directed reaction.The results are discussed in terms of a model of replicase-Qβ RNA recognition. Template specificity is attributed to binding of internal RNA regions to replicase, resulting in a specific spatial orientation of the RNA by which the inherently weak, but essential, interaction at the 3′ end is allowed to occur and to lead to the initiation of RNA synthesis.     

Nucleotide sequences of similar size from the coliphage R17 genome

A sequence of 33 nucleotides from the coliphage R17 RNA genome was determined. It constitutes the main component of a mixture of fragments that migrate together on electrophoresis in a separation according to molecular weight. Fragments of comparable chain length from 3' end of RNA from coliphage R17, from a region preceding and overlapping the coat-protein cistron ribosome binding site and from the beginning of the A-protein cistron, were also found and characterized. ;Hairpin'-like secondary structures are proposed for the longer fragments, one of which appears to have a tetranucleotide excised in the loop region.     

Differential requirements for polypeptide chain initiation complex formation at the three bacteriophage R17 initiator regions.

The initiation specificity of washed E. coli ribosomes in the presence and absence of purified initiation factors and/or S1 protein has been examined in protection experiments using 32P-labelled R17 RNA. We find that the three bacteriophage initiator regions do not exhibit equal requirements for either of these components during initiation complex formation. Specifically, both factors and S1 stimulate ribosome binding to the beginnings of the coat and replicase cistrons to a greater extent than they promote recognition of the A protein initiation site. The differential effects are therefore inversely correlated with the degree of mRNA-16S rRNA complementarity exhibited by the three initiator regions. We also observe that S1 suppresses ribosome binding to spurious sites in the R17 RNA.     

Replicase-binding sites on plus- and minus-strand brome mosaic virus RNAs and their roles in RNA replication in plant cells

The cis-acting elements for Brome mosaic virus (BMV) RNA synthesis have been characterized primarily for RNA3. To identify additional replicase-binding elements, nested fragments of all three of the BMV RNAs, both plus- and minus-sense fragments, were constructed and tested for binding enriched BMV replicase in a template competition assay. Ten RNA fragments containing replicase-binding sites were identified; eight were characterized further because they were more effective competitors. All eight mapped to noncoding regions of BMV RNAs, and the positions of seven localized to sequences containing previously characterized core promoter elements (C. C. Kao, Mol. Plant Pathol. 3:55-62, 2001), thus suggesting the identities of the replicase-binding sites. Three contained the tRNA-like structures that direct minus-strand RNA synthesis, three were within the 3' region of each minus-strand RNA that contained the core promoter for genomic plus-strand initiation, and one was in the core subgenomic promoter. Single-nucleotide mutations known previously to abolish RNA synthesis in vitro prevented replicase binding. When tested in the context of the respective full-length RNAs, the same mutations abolished BMV RNA synthesis in transfected barley protoplasts. The eighth site was within the intercistronic region (ICR) of plus-strand RNA3. Further mapping showed that a sequence of 22 consecutive adenylates was responsible for binding the replicase, with 16 being the minimal required length. Deletion of the poly(A) sequence was previously shown to severely debilitate BMV RNA replication in plants (E. Smirnyagina, Y. H. Hsu, N. Chua, and P. Ahlquist, Virology 198:427-436, 1994). Interestingly, the B box motif in the ICR of RNA3, which has previously been determined to bind the 1a protein, does not bind the replicase. These results identify the replicase-binding sites in all of the BMV RNAs and suggest that the recognition of RNA3 is different from that of RNA1 and RNA2.     

Defective lysis of streptomycin-resistant escherichia coli cells infected with bacteriophage f2

A lysis defect was found to account for the failure of a streptomycin-resistant strain of Escherichia coli to form plaques when infected with the male-specific bacteriophage f2. The lysis defect was associated with the mutation to streptomycin resistance. Large amounts of apparently normal bacteriophage accumulated in these cells. Cell-free extracts from both the parental and mutant strains synthesized a potential lysis protein in considerable amounts in response to formaldehyde-treated f2 RNA but not in response to untreated RNA. As predicted from the nucleotide sequence of the analogous MS2 phage, the protein synthesized in vitro had the expected molecular weight and lacked glycine. The cistron for the lysis protein overlapped portions of the coat and replicase cistrons and was translated in the +1 reading frame. Initiation at the lysis protein cistron may be favored by translation errors that expose the normally masked initiation site, and streptomycin-resistant ribosomes, known to have more faithful translation properties, may be unable to efficiently synthesize the lysis protein.