The Chemical Synthesis of Biochemically Active Oligoribonucleotides Using Dimethylaminomethylene Protected Purine H-Phosphonates

Abstract

Dimethylaminomethylene was applied as the protecting group for the exocyclic amino groups of adenosine and guanosine in the automated chemical synthesis of oligoribonucleotides on a polymer bound support. The dimethyl-aminomethylene protecting group can be removed at room temperature under conditions where the concomitant loss of the 2′-protection group can be excluded. The transformation of 2′-O-(t-butyldimethylsilyl)-5′-O-(4,4′-dimethoxytrityl) protected nucleosides to 3′-H-phosphonates yields synthons, well suited for the automated chemical synthesis of oligoribonucleotides. Using these H-phosphonate monomers, a coupling time of two minute: is sufficient to obtain average coupling yields of more than 98 %. Synthesized RNA is recognized as a substrate in an enzymatic reaction, forms the expected secondary structures and is suitable for NMR structural investigations.     

Use of the 1-(2-fluorophenyl)-4-methoxypiperidin-4-yl (Fpmp) and related protecting groups in oligoribonucleotide synthesis: stability of internucleotide linkages to aqueous acid.

The internucleotide linkage of uridylyl-(3'-->5')-uridine (r[UpU]) does not undergo detectable hydrolytic cleavage or migration in ca. 24 hr in 0.01 mol dm-3 hydrochloric acid (pH 2.0) at 25 degrees C. However, unlike r[UpU] and previously examined relatively high molecular weight oligoribonucleotides, oligouridylic acids are very sensitive to aqueous acid under the latter conditions (pH 2.0, 25 degrees C). Thus when the 1-(2-fluorophenyl)-4-methoxypiperidin-4-yl (Fpmp) group is used to protect the 2'-hydroxy functions in the synthesis of r[(Up)9U] and r[(Up)19U], the final unblocking process must be carried out above pH 3 if hydrolytic cleavage and migration are to be avoided. It is demonstrated that the rate of acid-catalyzed hydrolysis of the internucleotide linkages of oligoribonucleotides is sequence dependent. As Fpmp groups may be virtually completely removed from average partially-protected oligoribonucleotides within ca. 24 hr at pH 3 and 25 degrees C, it is concluded that Fpmp is a suitable 2'-protecting group even in the synthesis of particularly acid-sensitive sequences.     

Effect of excess water on the desilylation of oligoribonucleotides using tetrabutylammonium fluoride.

The most commonly available 2' hydroxyl protecting group used in the synthesis of oligoribonucleotides is the tert-butyldimethylsilyl moiety. This protecting group is generally cleaved with 1 M tetrabutylammonium fluoride (TBAF) in tetrahydrofuran (THF). The efficiency of this reaction was tested on ribonucleotidyldeoxythymidine dinucleotides (AT, CT, GT, and UT). We have found that the efficiency of desilylation of uridine and cytidine is greatly dependent on the water content of the TBAF reagent. Conversely, the water content of the TBAF reagent [up to 17% (w/w)] had no detectable effect on the rate of desilylation of adenosine and guanosine. It was concluded that for effective desilylation of pyrimidine nucleosides the water content of the TBAF reagent must be 5% or less, which is readily achieved using molecular sieves. TBAF dried in such a manner was shown to be effective in deprotecting an oligoribonucleotide containing both purine and pyrimidine residues.     

Oxalyl-CPG: a labile support for synthesis of sensitive oligonucleotide derivatives.

A procedure is described for linking nucleosides covalently to controlled pore glass or cross-linked polystyrene supports by means of an oxalyl anchor. Though stable to triethylamine and diisopropylamine, the nucleoside-oxalyl link can be cleaved within a few minutes at room temperature with ammonium hydroxide in methanol. This new anchor can be used in automated synthesis of conventional oligonucleotides. The primary value, however, is that it enables one to employ solid support methodology to synthesize a variety of base-sensitive oligonucleotide derivatives, as illustrated here by synthesis of oligomers with base protecting groups intact and with methyl phosphotriester groups at the internucleoside links.     

An Improved Deprotection Procedure of Amine-Containing Oligonucleotides from Acrylonitrile Modification

Abstract

Alkylation of alkylamine by acrylonitrile via Michael addition¹ occurred when standard ammonium hydroxide deprotection was used. The alkylation was greatly reduced using an improved two-step procedure when BCE phosphotriester protecting groups were selectively removed with t-butylamine prior to ammonium hydroxide deprotection.     

Selective 2''-benzoylation at the cis 2'',3''-diols of protected ribonucleosides. New solid phase synthesis of RNA and DNA-RNA mixtures.

5'-0-(Dimethoxytrityl)-2'-0-(benzoyl or 3,4,5-trimethoxybenzoyl)-base protected ribonucleosides have been prepared by selective benzoylation of the 2'-hydroxyl group. The isomerization of the 2'-benzoates to the 3'-benzoates was studied. The protected ribonucleosides have been converted to either methylphosphochloridites or methylphosphoamidites and used to synthesize oligoribonucleotides on silica gel solid support. The synthetic RNA were deprotected and isolated using conditions that minimize internucleotide cleavage. The use of 2'-benzoates as protecting groups for ribonucleosides has made it possible to easily prepare and isolate mixtures of DNA and RNA.     

Studies on the t-butyldimethylsilyl group as 2''-O-protection in oligoribonucleotide synthesis via the H-phosphonate approach.

Two model compounds, 1 and 2, have been studied to test the stability of the t-butyldimethylsilyl (t-BDMSi) group towards conditions used during chemical synthesis of RNA fragments by the H-phosphonate approach. When 1 was treated with anhydrous acid for 16 h both the H-phosphonate diester and the t-BDMSi group remained intact. Removal of the t-BDMSi group from 2 with 1.0 M tetrabutylammonium fluoride (TBAF .3H2O) in THF was complete within 4 h and neither concomitant cleavage nor migration of the phosphodiester linkage could be detected even after 24 h. The dimer 2 was not completely stable towards concentrated aqueous ammonia and both loss of the t-BDMSi group and concomitant cleavage of the phosphodiester linkage occurred upon prolonged treatment. These reactions were substantialy suppressed in ethanol containing ammonia solutions, however to alleviate this problem during oligoribonucleotide synthesis, more labile protecting groups for heterocyclic bases would be desired. In conclusion, these studies indicate that 2'-O-t-BDMSi can be considered as a convenient and safe protecting group, which should secure synthesis of oligoribonucleotides with exclusively 3'-5' internucleotidic linkages.     

Synthesis of oligoribonucleotides by the N-phosphonate method using alkali-labile 2'-o-protective groups. II. Various aspects of using 2'-o-benzoyl and anisole protective groups

The N-acyl, 5'-O-trityl (MeOTr, (MeO)2Tr, Me3Tr), 2'-O-benzoyl (and anisole) nucleosides were prepared by selective aroylation of N,5'-protected nucleosides. By means of the reverse-phase microcolumn liquid chromatography it was shown that the rate of the aryl 2'----3'-isomerisation is lower in case of 2'-anisoylnucleosides and depends on structure of the 5'-O-protecting group. The prepared synthons were used for the manual H-phosphonate solid-phase synthesis of oligoribonucleotides (6-10-mers).     

Synthesis Of RNA by the Rapid Phosphotriester Method Using Azido-Based 2′-O-Protecting Groups

The azidomethyl and 2-(azidomethyl)benzoyl as 2′-OH protecting groups are reported for preparation of oligoribonucleotides by the phosphotriester solid-phase method using O-nucleophilic intramolecular catalysis. The procedures for the synthesis of the corresponding monomer synthons were developed and the usefulness of the application of 2′-O-azidomethyl and 2′-O-2-(azidomethyl)benzoyl groups was examined in the synthesis of different RNA fragments with a chain length of 15–22 nucleotides. The azidomethyl group was found to be more preferable for effective synthesis of oligoribonucleotides. Hybridization properties of RNAs toward their complementary oligonucleotides were examined before and after the removal of 2′-O-azidomethyl groups.     

Modification of guanine bases by nucleoside phosphoramidite reagents during the solid phase synthesis of oligonucleotides.

Nucleoside 3'-phosphoramidite and chlorophosphite reagents have been found to react with the lactam function of guanine. This reaction caused unsatisfactory results when oligodeoxyribonucleotides containing a large number of guanine bases were prepared in an automated solid phase synthesizer. The guanine modification is unstable, and leads to depurination and chain cleavage. This side reaction can be eliminated by protecting the O6-position. A new O6-p-nitrophenylethyldeoxyguanosine phosphoramidite derivative, 8, was used to prepare sequences containing up to 24 guanine bases with greatly improved results. A hexatriacontanucleotide, d(CGCGGGGTGGAGCAGCCTGGTAGCTCGTCGGGCTCA), was also prepared using O6-protected deoxyguanosine nucleosides.     

The chemical synthesis of oligoribonucleotides with selectively placed 2'-O-phosphates

A phosphoramidite, solid support method for the chemical synthesis of oligoribonucleotides containing 2'-O-phosphate at a selected position is presented. Synthesis of these oligoribonucleotides is based on uridine- and adenosine-(2'-O-phosphate)-3'-phosphoramidites, and a new condition for removal of 2'-O-phosphate protecting groups, which does not cleave internucleotide bonds. The structure of oligoribonucleotides with 2'-O-phosphate has been proven by enzymatic digestions and dephosphorylation by yeast 2'-phosphotransferase.     

Use of 2-diphenylmethylsilylethyl (DPSE) protecting group in oligonucleotide synthesis via phosphoramidite approach

2-Diphenylmethylsilylethyl (DPSE) is a new protecting group for the internucleotidic bonds in the synthesis of deoxyribooligonucleotides by the phosphoramidite approach. This group is stable to acidic conditions and can be removed under mild conditions using aqueous ammonium hydroxide.     

Physical consequences of chemical modification: circular dichroism of the kethoxalated oligoribonucleotides

Alterations in CD spectra are found in G-containing oligoribonucleotides after modification with kethoxal (beta-ethoxy--alpha-ketobutyraldehyde). Stacking interactions in kethoxalated oligomers are followed by temperature dependence of their CD amplitudes. It is shown that for oligomers with nucleosides in anti-conformation adduct formation destroys the stacking interaction with 3'-neighbour but not with a 5'-neighbour. For nucleosides in non-standard conformation (i.e. syn-conformation of guanine in GpGpCp) the physical alteractions may be seen in those cases, when the substituting group affects the initial conformation or the interplane base contacts via, for instance, blocking NH(2)-group of guanine in GpUp.The results demonstrated that even a single monomer modification in a polymer chain could not be considered as a local event having no influence on the three-dimensional structure. The degree of conformational disorders depends both on the conformation of single nucleotides in the stack and on the nature of the nearest neighbours of the modified base.     

Methoxymethyl and (p-nitrobenzyloxy)methyl groups in the synthesis of oligoribonucleotides by the phosphotriester method

An efficient synthetic method for monomer ribonucleotide synthons containing 2'-O-methoxymethyl and 2'O-(p-nitrobenzyloxy)methyl groups used for oligonucleotide phosphotriester method with O-nucleophilic intramolecular catalysis at the stage of formation of internucleotide bond is developed. It is shown that synthons containing protecting 2'-O-(p-nitrobenzyloxy)methyl group may be used for automatic synthesis of phosphotriester oligoribonucleotides with high yields and synthons containing methoxymethyl group--to get 2'-O-modified oligonucleotides.     

Synthetic approaches to a mononucleotide prodrug of cytarabine

Synthetic pathways to a mononucleotide prodrug of cytarabine (Ara-C) bearing S-pivaloyl-2-thioethyl (tBuSATE) groups, as biolabile phosphate protections, are reported. Using a common phosphoramidite approach, two different kinds of nucleoside protecting groups have been investigated. During this study, we observed an intermolecular migration of the Boc protecting group in the course of the tert-butyldimethylsilyl ether cleavage using tetrabutyl ammonium fluoride.     

Evaluation of 2'-hydroxyl protection in RNA-synthesis using the H-phosphonate approach.

A number of different protecting groups were compared with respect to their usefulness for protection of 2'-hydroxyl functions during synthesis of oligoribonucleotides using the H-phosphonate approach. The comparison was between the t-butyldimethylsilyl (t-BDMSi), the o-chlorobenzoyl (o-CIBz), the tetrahydropyranyl (THP), the 1-(2-fluorophenyl)-4-methoxypiperidin-4-yl (Fpmp), the 1-(2-chloro-4-methylphenyl)-4-methoxypiperidin-4-yl (Ctmp), and the 1-(2-chloroethoxy)ethyl (Cee) protecting groups. All these groups were tested in synthesis of dodecamers, (Up)11U and (Up)11A, using 5'-O-(4-monomethoxytrityl) or (4,4'-dimethoxytrityl) uridine H-phosphonate building blocks carrying the respective 2'-protection. The performance of the t-BDMSi and o-CIBz derivatives were also compared in synthesis of (Up)19U. The most successful syntheses were clearly those where the t-butyldimethylsilyl group was used. The o-chlorobenzoyl group also gave satisfactory results but seems somewhat limited with respect to synthesis of longer oligomers. The results with all tested acetal derivatives (Fpmp, Ctmp, Cee, THP) were much less successful due to some accompanying cleavage of internucleotidic H-phosphonate functions during removal of 5'-O-protection (DMT).     

The Chemical Synthesis of Oligoribonucleotides with Selectively Placed 2′-O-Phosphates

Abstract

A phosphoramidite, solid support method for the chemical synthesis of oligoribonucleotides containing 2′-O-phosphate at a selected position is presented. Synthesis of these oligoribonucleotides is based on uridine- and adenosine-(2′-O-phosphate)-3′-phosphoramidites, and a new condition for removal of 2′-O-phosphate protecting groups, which does not cleave internucleotide bonds. The structure of oligoribonucleotides with 2′-O-phosphate has been proven by enzymatic digestions and dephosphorylation by yeast 2′-phosphotransferase.     

Chemical synthesis of the 24 RNA fragments corresponding to hop stunt viroid.

A general and practical synthetic method of oligoribonucleotides (10-20 mers) by using the cyanoethyl phosphoramidite approach was described. In this experiment 9-phenylxanthen-9-yl (Pix) and 9-(4-methoxy)phenylxanthen-9-yl (Mox) groups were employed for the 5'-hydroxyls and tetrahydropyranyl (Thp) group was used for the 2'-hydroxyl protecting groups. In addition, suitable acyl groups were introduced for the protection of the lactam functions of guanine and uracil moieties.     

Configurationally defined phosphorothioate-containing oligoribonucleotides in the study of the mechanism of cleavage of hammerhead ribozymes.

The chemical synthesis is described of oligoribonucleotides containing a single phosphorothioate linkage of defined Rp and Sp configuration. The oligoribonucleotides were used as substrates in the study of the mechanism of cleavage of an RNA hammerhead domain having the phosphorothioate group at the cleavage site. Whereas the Rp isomer was cleaved only very slowly in the presence of magnesium ion, the rate of cleavage of the Sp isomer was only slightly reduced from that of the unmodified phosphodiester. This finding gives further evidence for the hypothesis that the magnesium ion is bound to the pro-R oxygen in the transition state of the hammerhead cleavage reaction. Also, inversion of configuration at phosphorus is confirmed for a two-stranded hammerhead.     

4-Cyano-2-butenyl Group: A New Type of Protecting Group in Oligonucleotide Synthesis via Phosphoramidite Approach

Abstract

4-Cyano-2-butenyl (CB) is a new type of protecting group for the intemucleotidic bonds in the synthesis of oligodeoxyribonucleotides by the phosphoramidite approach. This group is stable to acidic conditions and can be removed under mild conditions by a δ-elimination pathway using aqueous ammonium hydroxide.