Primary and secondary structure of rat 28 S ribosomal RNA.

The primary structure of rat (Rattus norvegicus) 28 S rRNA is determined inferred from the sequence of cloned rDNA fragments. The rat 28 S rRNA contains 4802 nucleotides and has an estimated relative molecular mass (Mr, Na-salt) of 1.66 X 10(6). Several regions of high sequence homology with S. cerevisiae 25 S rRNA are present. These regions can be folded in characteristic base-paired structures homologous to those proposed for Saccharomyces and E. coli. The excess of about 1400 nucleotides in the rat 28 S rRNA (as compared to Saccharomyces 25 S rRNA) is accounted for mainly by the presence of eight distinct G+C-rich segments of different length inserted within the regions of high sequence homology. The G+C content of the four insertions, containing more than 200 nucleotides, is in the range of 78 to 85 percent. All G+C-rich segments appear to form strongly base-paired structures. The two largest G+C-rich segments (about 760 and 560 nucleotides, respectively) are located near the 5'-end and in the middle of the 28 S rRNA molecule. These two segments can be folded into long base-paired structures, corresponding to the ones observed previously by electron microscopy of partly denatured 28 S rRNA molecules.     

Multiple gene genealogies reveal recent dispersion and hybridization in the human pathogenic fungus Cryptococcus neoformans

Cryptococcus neoformans (= Filobasidiella neoformans) is a significant emerging fungal pathogen of humans. To understand the evolution of this pathogen, 34 strains were obtained from various locations around the world and fragments of four genes were sequenced from each. These strains represented all three varieties and five serotypes. The four sequenced genes are: (i) the mitochondrial large ribosomal subunit RNA; (ii) the internal transcribed spacer region of the nuclear rRNA, including ITS1, 5.8S rRNA subunit and ITS2; (iii) orotidine monophosphate pyrophosphorylase; and (iv) diphenol oxidase. Phylogenetic analyses indicated considerable divergence among lineages, which corresponded to the current classification of C. neoformans into three varieties. However, there is no apparent phylogeographic pattern. Significant incongruences were observed among gene genealogies. The analyses indicated that the major lineages in C. neoformans diverged tens of millions of years ago but have undergone recent dispersion and hybridization.     

Phylogenetic placement of the basidiomycetous yeastsKondoa malvinella andRhodosporidium dacryoidum,and the anamorphic yeastSympodiomycopsis paphiopedili by means of 18S rRNA gene sequence analysis

The 18S ribosomal RNA gene sequences of the basidiomycetous yeastsKondoa malvinella andRhodosporidium dacryoidum, and an anamorphic yeastSympodiomycopsis paphiopedili were determined. The 18S rRNA gene ofR. dacryodium IAM 13522 (ex type) revealed the presence of an intron-like region with a length of 404 nucleotides, which is presumably assigned to a group I intron. The phylogenetic tree, including 34 published reference sequences, was inferred from 1493 sites which could be unambiguously aligned. The molecular phylogeny, using the ascomycetes as an outgroup, divided the basidiomycetes into three major lineages. The first lineage was composed of the smut fungi (Ustilaginales), represented byUstilago maydis, U. hordei, andTilletia caries, includingS. paphiopedili. The second lineage included the type species of teliospore-forming yeast generaLeucosporidium, Rhodosporidium, andSporidiobolus, and the generaErythrobasidium andKondoa, both previously included in the Filobasidiaceae.Rhodosporidium dacryodium showed a close relationship withE. hasegawianum, which was backed by a high bootstrap support. The rust fungiCronartium ribicola andPeridermium harknessii were also included in this lineage. The last lineage was formed by the filobasidiaceous yeasts,Cystofilobasidium capitatum, Mrakia frigida, Filobasidium floriforme, andFilobasidiella neoformans, and the anamorphic yeastsBullera alba (the anamorph ofBulleromyces albus) andTrichosporon cutaneum. Members ofTremella and selected hymenomycetous genera were also included in this lineage.The nucleotide sequence data reported in this paper will appear in the GSDB, DDBJ, EMBL and NCBI nucleotide sequence databases with the following accession numbers D13459 (Rhodosporidium dacryodium), D13776 (Kondoa malvinella), and D14006 (Sympodiomycopsis paphiopedili).     

Organization of the nuclear ribosomal DNA of Chlamydomonas reinhardii

Summary Hybridization of cytoplasmic ribosomal RNA (rRNA) to restriction endonuclease digests of nuclear DNA of Chlamydomonas reinhardii reveals two BamHI ribosomal fragments of 2.95 and 2.35×10⁶ d and two SalI ribosomal fragments of 3.8 and 1.5×10⁶ d. The ribosomal DNA (rDNA) units, 5.3×10⁶ d in size, appear to be homogeneous since no hybridization of rDNA to other nuclear DNA fragments can be detected. The two BamHI and SalI ribosomal fragments have been cloned and a restriction map of the ribosomal unit has been established. The location of the 25S, 18S and 5.8S rRNA genes has been determined by hibridizing the rRNAs to digests of the ribosomal fragments and by observing RNA/DNA duplexes in the electron microscope. The data also indicate that the rDNA units are arranged in tandem arrays. The 5S rRNA genes are not closely located to the 25S and 18S rRNA genes since they are not contained within the nuclear rDNA unit. In addition no sequence homology is detectable between the nuclear and chloroplast rDNA units of C. reinhardii.Abbreviations used rRNA ribosomal RNA - rDNA ribosomal DNA d, dalton     

Do major species concepts support one, two or more species within Cryptococcus neoformans?

Cryptococcus neoformans, the agent of cryptococcosis, had been considered a homogeneous species until 1949 when the existence of four serotypes was revealed based on the antigenic properties of its polysaccharide capsule. Such heterogeneity of the species, however, remained obscure until the two morphologically distinct teleomorphs of C. neoformans were discovered during the mid 1970s. The teleomorph Filobasidiella neoformans was found to be produced by strains of serotype A and D, and Filobasidiella bacillispora was found to be produced by strains of serotype B and C. Ensuing studies revealed numerous differences between the anamorphs of the two Filobasidiella species with regard to their ecology, epidemiology, pathobiology, biochemistry and genetics. At present, the etiologic agent of cryptococcosis is classified into two species, C. neoformans (serotypes A and D) and Cryptococcus gattii (serotypes B and C). Intraspecific genetic diversity has also been revealed as more genotyping methods have been applied for each serotype. As a result, the number of scientifically valid species within C. neoformans has become a controversial issue because of the differing opinions among taxonomists as to the appropriate definition of a species. There are three major species concepts that govern classification of organisms: phenetic (morphologic, phenotypic), biologic (interbreeding) and cladistic (evolutionary, phylogenetic). Classification of the two C. neoformans species has been based on the phenetic as well as the biologic species concept, which is also supported by the cladistic species concept. In this paper, we review and attest to the validity of the current two-species system in light of the three major species concepts.     

Mating types and serotypes of Cryptococcus neoformans isolated in Japan

Thirty-two isolates of Cryptococcus neoformans from patients and one from the wild obtained in Japan were characterized for their serotype, self-fertility, and mating behaviour by crossing them with two mating types of Filobasidiella neoformans var. neoformans and F. neoformans var. bacillispora. Of the 32 isolates from patients, 31 were of serotype A and the remaining one was of serotype D. Although these 32 isolates were all self-sterile, 23 serotype A and one serotype D isolates produced a complete sexual state when mixed with the alpha mating type of F. neoformans var. neoformans. The one natural isolate was of serotype A-D and self-fertile. The Japanese clinical isolates of C. neoformans appear to be predominantly serotype A and alpha mating type of F. neoformans var. neoformans as is the case in the U.S.A.     

Isolation and characterization of Chinese hamster ribosomal DNA clones

We have examined the ribosomal RNA (rRNA) genes of the Chinese hamster ovary (CHO) cell line. A partial EcoRI library of genomic CHO DNA was prepared using lambda Charon-4A. We isolated two recombinants containing the region transcribed as 45S pre-rRNA and 13 kb of external spacer flanking 5' and 3' to the transcribed region. These sequences show restriction site homology with the vast majority of the genomic sequences complementary to rRNA. In addition to this form of rDNA, Southern blot analysis of EcoRI-cut CHO genomic DNA reveals numerous minor fragments ranging from 2 to 19 kb which are complementary to 18S rRNA. We isolated one clone which contains the 18S rRNA gene and sequences 5' which appear to contain length heterogeneity within the non-transcribed spacer region. We have nine additional cloned EcoRI fragments in which the homology with 18S rRNA is limited to a 0.9-kb EcoRI-HindIII fragment. This EcoRI-HindIII fragment is present in each of the cloned EcoRI fragments, and is flanked on both sides by apparently nonribosomal sequences which bear little restriction site homology with each other or the major cloned rDNA repeat.     

A survey of yeast ureases and characterisation of partially purified Rhodosporidium paludigenum urease

Cell-free extracts of a selection of yeasts were analysed for urease activity. Species in the genera Filobasidiella, Rhodotorula and Rhodosporidium had the highest specific activities. Immune inactivation experiments showed widely different degrees of cross-reactivity between antiserum to jack bean urease and yeast ureases, with Rhodosporidium paludigenum (71%) the most and Schizosaccharomyces pombe (3%) the least affected. Only R. paludigenum urease was detected with anti-jack bean urease antiserum on Western blots. The urease of Rhodosporidium paludigenum was partially purified by column chromatography. The native enzyme was found to have a subunit size of 72 +/- 7 kDa probably in an octamer arrangement of 560 +/- 8 kDa, having a specific activity of 62.5 mumol urea hydrolysed min-1 (mg protein)-1. The enzyme was stable in the pH range 5-11 with optimum activity at pH 7.8. Vmax and Km values were determined as 65.2 +/- 3.8 mumol min-1 (mg protein)-1 and 3.81 +/- 0.47 mM, respectively.     

Interaction of ribosomal proteins S5, S6, S11, S12, S18 and S21 with 16 S rRNA

We have examined the effects of assembly of ribosomal proteins S5, S6, S11, S12, S18 and S21 on the reactivities of residues in 16 S rRNA towards chemical probes. The results show that S6, S18 and S11 interact with the 690-720 and 790 loop regions of 16 S rRNA in a highly co-operative manner, that is consistent with the previously defined assembly map relationships among these proteins. The results also indicate that these proteins, one of which (S18) has previously been implicated as a component of the ribosomal P-site, interact with residues near some of the recently defined P-site (class II tRNA protection) nucleotides in 16 S rRNA. In addition, assembly of protein S12 has been found to result in the protection of residues in both the 530 stem/loop and the 900 stem regions; the latter group is closely juxtaposed to a segment of 16 S rRNA recently shown to be protected from chemical probes by streptomycin. Interestingly, both S5 and S12 appear to protect, to differing degrees, a well-defined set of residues in the 900 stem/loop and 5'-terminal regions. These observations are discussed in terms of the effects of S5 and S12 on streptomycin binding, and in terms of the class III tRNA protection found in the 900 stem of 16 S rRNA. Altogether these results show that many of the small subunit proteins, which have previously been shown to be functionally important, appear to be associated with functionally implicated segments of 16 S rRNA.     

Development of a CRISPR/Cas9 system for high efficiency multiplexed gene deletion in Rhodosporidium toruloides

The oleaginous yeast Rhodosporidium toruloides is considered a promising candidate for production of chemicals and biofuels thanks to its ability to grow on lignocellulosic biomass, and its high production of lipids and carotenoids. However, efforts to engineer this organism are hindered by a lack of suitable genetic tools. Here we report the development of a CRISPR/Cas9 system for genome editing in R. toruloides based on a fusion 5S rRNA–tRNA promoter for guide RNA (gRNA) expression, capable of greater than 95% gene knockout for various genetic targets. Additionally, multiplexed double-gene knockout mutants were obtained using this method with an efficiency of 78%. This tool can be used to accelerate future metabolic engineering work in this yeast.     

DNA sequence of the 16S rRNA/23S rRNA intercistronic spacer of two rDNA operons of the archaebacterium Methanococcus vannielii

The DNA sequence of the spacer (plus flanking) regions separating the 16S rRNA and 23S rRNA genes of two presumptive rDNA operons of the archaebacterium Methanococcus vannielii was determined. The spacers are 156 and 242 base pairs in size and they share a sequence homology of 49 base pairs following the 3' terminus of the 16S rRNA gene and of about 60 base pairs preceding the 5' end of the 23S rRNA gene. The 242 base pair spacer, in addition contains a sequence which can be transcribed into tRNAAla, whereas no tRNA-like secondary structure can be delineated from the 156 base pair spacer region. Almost complete sequence homology was detected between the end of the 16S rRNA gene and the 3' termini of either Escherichia coli or Halobacterium halobium 16S rRNA, whereas the putative 5' terminal 23S rRNA sequence shared partial homology with E. coli 23S rRNA and eukaryotic 5.8S rRNA.     

Taxonomy of the Clostridia: ribosomal ribonucleic acid homologies among the species.

rRNA homologies have been determined on reference strains representing 56 species of Clostridium. Competition experiments using tritium-labelled 23S rRNA were employed. The majority of the species had DNA with 27 to 28% guanine plus cytosine (%GC). These fell into rRNA homology groups I and II, which were well defined, and a third group which consisted of species which did not belong in groups I and II. Species whose DNA was 41 to 45% GC comprised a fourth group. Thirty species were placed into rRNA homology group I on the basis of having 50% or greater homology with Clostridium butyricum, C. perfringens, C. carnis, C. sporogenes, C. novyi or C. pasteurianum. Ten subgroups were delineated in homology group I. Species in each subgroup either had high homology with a particular reference species or a similar pattern of homologies to all of the reference organisms. The eleven species in rRNA homology group II had 69% or greater homology to C. lituseburense. Species in groups I and II had intergroup homologies of 20 to 40%. The six species in group II had very low homologies with groups I and II. Negligible homology also resulted when five of the species were tested against the sixth, C. ramosum. The five species having DNA with 41 to 45% GC were C. innocuum, C. sphenoides, C. indolis, C. barkeri and C. orotic um. Little rRNA homology was apparent between C. innocuum and the other high % GC species or with several Bacillus species having similar %GC DNA. Correlations between homology results and phenotypic characteristics are discussed.     

The structure of the yeast ribosomal RNA genes. 4. Complete sequence of the 25 S rRNA gene from Saccharomyces cerevisae.

The complete nucleotide sequence of the 25 S rRNA gene from one rDNA repeating unit of Saccharomyces cerevisiae has been determined. The corresponding 25 S rRNA molecule contains 3392 nucleotides and has an estimated relative molecular mass (Mr, Na-salt) or 1.17 x 10(6). Striking sequence homology is observed with known 5'- and 3'-end terminal segments of L-rRNA from other eukaryotes. Possible models of interaction with 5.8 S rRNA are discussed.     

Outer Membrane Protein Heterogeneity within Pseudomonas fluorescens and P. putida and Use of an OprF Antibody as a Probe for rRNA Homology Group I Pseudomonads

The electrophoretic patterns of outer membrane proteins of strains representing the biovars of Pseudomonas fluorescens and Pseudomonas putida were analyzed by gel electrophoresis. The outer membrane protein profiles were variable, and they were not useful for assigning strains to a specific biovar. However, three or four predominant outer membrane proteins migrating at 42 to 46 kDa, 33 to 38 kDa, and 20 to 22 kDa were conserved among the strains. They could be tentatively identified as OprE (44 kDa), OprF (38 kDa), OprH (21 kDa), and OprL (20.5 kDa), which are known proteins from Pseudomonas aeruginosa. A 37-kDa OprF-like protein was purified from P. fluorescens DF57 and used to raise a polyclonal antibody. In Western blot (immunoblot) analysis, this antibody reacted with OprF proteins from members of Pseudomonas rRNA homology group I but not with proteins from nonpseudomonads. The heterogeneity in M(infr) of OprF was greater among P. fluorescens strains than among P. putida strains. Immunofluorescence microscopy of intact cells demonstrated that the antibody recognized epitopes that were accessible only after unmasking by EDTA treatment. The antibody was used in a colony blotting assay to determine the percentage of rRNA homology group I pseudomonads among bacteria from the rhizosphere of barley. The bacteria were isolated on 10% tryptic soy agar, King's B agar, and the pseudomonad-specific medium Gould S1 agar. The estimate of OprF-containing CFU in rhizosphere soil obtained by colony blotting on 10% tryptic soy agar was about 2 and 14 times higher than the values obtained from King's agar and Gould S1 agar, respectively, indicating that not all fluorescent pseudomonads are scored on more specific media. The colonies reacting with the OprF antibody were verified as being rRNA homology group I pseudomonads by using the API 20NE system.     

Ribosomal cistrons in higher plant cells. II. Sequence homology between the two mature rRNAs of sycamore cells and intracistronic reiteration. A DNA - rRNA hybridization study.

1. Uniformly labelled rRNA of sycamore cells has been annealed with homologous DNA. The fractions of DNA complementary to the 17S, or 26S, or 17S + 26S rRNAs are found to be 0.19%, 0.15% and 0.23%. They are not in the ratio of the molecular weight values (0.8, 1.2 and 2 - 10(6), respectively for the 17S, 26S and 17S + 26S rRNAs). This result is compatible with the large hybridization competition observed between the two rRNAs (53 and 72%) and with the shift-down of saturation curves when DNA is presaturated with unlabelled rRNA before the incubation with the other labelled rRNA. 2. Under the selected experimental procedure, the DNA - rRNA hybrids formed appear to be specific. Since there is an equal number of structural genes for the 17S and 26S rRNAs, these results mean the occurrence of a great sequence homology, strictly restricted to the two rRNAs. Homologous and specific sequences have been estimated to 0.1 and 0.7, or 0.85 and 0.35 million daltons, respectively in the 17S or 26S structural genes. 3. From the calculated lengths of homologous sequences, an intracistronic reiteration of some ribosomal sequences can be deduced. This internal reiteration is directly evidenced by the complex pattern of DNA - rRNA annealing curves. As demonstrated by base-composition analysis, the internal reiteration is heterogeneous and concerns both the homologous and specific sequences. In addition, the DNA saturation values allow the calculation of 4000 copies for the ribosomal cistron in the whole sycamore genome.     

Yeast ribosomal protein L25 binds to an evolutionary conserved site on yeast 26S and E. coli 23S rRNA.

The binding site of the yeast 60S ribosomal subunit protein L25 on 26S rRNA was determined by RNase protection experiments. The fragments protected by L25 originate from a distinct substructure within domain IV of the rRNA, encompassing nucleotides 1465-1632 and 1811-1861. The protected fragments are able to rebind to L25 showing that they constitute the complete protein binding site. This binding site is remarkably conserved in all 23/26/28S rRNAs sequenced to date including Escherichia coli 23S rRNA. In fact heterologous complexes between L25 and E. coli 23S rRNA could be formed and RNase protection studies on these complexes demonstrated that L25 indeed recognizes the conserved structure. Strikingly the L25 binding site on 23S rRNA is virtually identical to the previously identified binding site of E. coli ribosomal protein EL23. Therefore EL23 is likely to be the prokaryotic counterpart of L25 in spite of the limited homology displayed by the amino acid sequences of the two proteins.     

Polyphasic identification of yeasts isolated from bark of cork oak during the manufacturing process of cork stoppers

A two-step protocol was used for the identification of 52 yeasts isolated from bark of cork oak at initial stages of the manufacturing process of cork stoppers. The first step in the identification was the separation of the isolates into groups by their physiological properties and RFLPs of the ITS-5.8S rRNA gene. The second step was the sequencing of the D1/D2 domains of the 26S rRNA gene of selected isolates representing the different groups. The results revealed a predominance of basidiomycetous yeasts (11 species), while only two species represented the ascomycetous yeasts. Among the basidiomycetous yeasts, members representing the species Rhodosporidium kratochvilovae and Rhodotorula nothofagi, that have been previously isolated from plant material, were the most abundant. Yeasts pertaining to the species Debaryomyces hansenii var. fabryii, Rhodotorula mucilaginosa and Trichosporon mucoides were isolated in small numbers.     

Characterization of yeast ribosomal DNA fragments generated by EcoR1 restriction endonuclease

Summary The action of Escherichia coli restriction endonuclease R1 (EcoR1) on DNA isolated from Saccharomyces cerevisiae (strain MAR-33) generates three predominent homogenously sized DNA fragments (species of 1.8, 2.2 and 2.5 kilo nucleotide base pairs (KB). Many DNA species of molecular weight greater than 2 million daltons can be recognized upon incomplete EcoR1 digestion of yeast DNA. Four additional DNA species ranging from 0.3–0.9 KB can be identified as the second major class of EcoR1-yeast DNA products.Hybridization with radioactive ribosomal RNA (rRNA) and competition with nonradioactive rRNA show that of the three predominent EcoR1-yeast DNA species, the 2.5 KB species hybridizes only with the 25S rRNA while the lighter 1.8 KB species hybridizes with the 18S rRNA. The intermediate DNA species of 2.2 KB hybridizes to a small extent with the 25S rRNA and could be a result of the presence of the 2.5 KB DNA species. The mass proportions and hybridization values of these 3 DNA species account for about 60% of the total ribosomal DNA (rDNA).The 5EcoR1-yeast DNA species of less than 0.9 KB (4 major and 1 minor species) hybridize to varying degrees with the 2 rRNA and can be grouped in two classes. In one class there are 3 DNA species that hybridize exclusively with the 18S rRNA. In the second class there are 2 DNA species that besides hybridizing predominently with the 25S rRNA also hybridize with the 18S rRNA. The 7 EcoR1-yeast DNA species (excluding the 2.2 KB DNA species) that hybridize with the two rRNA account for nearly a 5 million dalton DNA segment, which is very close to the anticipated gene size of rRNA precursor molecule. If the 2.2 KB DNA species is a part of the rDNA that is not transcribed or 5 sRNA then the cistron encoding the rRNA in S. cerevisiae has at least 8 EcoR1 recognition sites resulting in 8 DNA fragments upon digestion with the EcoR1. Consideration is given to the relationship of the rRNA species generated by EcoR1 digestion and the chromosomes containing ribosomal cistrons.     

The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum.

The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH. The homology with the 55 rRNA from another archaebacterial species, Halobacterium cutirubrum, is only 60.6% and other 55 rRNAs are even less homologous. Examination of the potential for forming secondary structure is revealing. T. acidophilum does not conform to the usual models employed for either procaryotic or eucaryotic 5S rRNAs. Instead this 5S rRNA has a mixture of the characteristic features of each. On the whole this 5S rRNA does however appear more eucaryotic than eubacterial. These results give further support to the notion that the archaebacteria represent an extremely early divergence among entities with procaryotic organization.     

Variable regions V13 and V3 of Saccharomyces cerevisiae contain structural features essential for normal biogenesis and stability of 5.8S and 25S rRNA.

The homologous ribosomal RNA species of all organisms can be folded into a common "core" secondary structure. In addition, eukaryotic rRNAs contain a large number of segments, located at fixed positions, that are highly variable in size and sequence from one organism to another. We have investigated the role of the two largest of these variable regions in Saccharomyces cerevisiae 25S rRNA, V13, and V3, by mutational analysis in a yeast strain that can be rendered completely dependent on the synthesis of mutant (pre-)rRNA. We found that approximately half of variable region V13 can be deleted without any phenotypic effect. The remaining portion, however, contains multiple structural features whose disturbance causes serious growth defects or lethality. Accumulation of 25S rRNA is strongly reduced by these mutations, at least in part because they inhibit processing of ITS2. Removal of even a relatively small portion of V3 also strongly reduces the cellular growth rate and larger deletions are lethal. Interestingly, some of the deletions in V3 cause accumulation of 27S(A) pre-rRNA and, moreover, appear to interfere with the close coupling between the processing cleavages at sites A3 and B1(S). These results demonstrate that both variable regions play an important role in 60S subunit formation.