The nucleotide sequence of phenylalanine tRNA and 5S RNA from Rhodospirillum rubrum

The complete nucleotide sequence of tRNAPhe and 5S RNA from the photosynthetic bacterium Rhodospirillum rubrum has been elucidated. A combination of in vitro and in vivo labelling techniques was used. The tRNAPhe sequence is 76 nucleotides long, 7 of which are modified. The primary structure is typically prokaryotic and is most similar to the tRNAPhe of Escherichia coli and Anacystis nidulans (14 differences of 76 positions). The 5S ribosomal RNA sequence is 120 nucleotides long and again typical of other prokaryotic 5S RNAs. The invariable GAAC sequence is found starting at position 45. When aligned with other prokaryotic 5S RNA sequences, a surprising amount of nucleotide substitution is noted in the prokaryotic loop region of the R. rubrum 5S RNA. However, nucleotide complementarity is maintained reinforcing the hypothesis that this loop is an important aspect of prokaryotic 5S RNA secondary structure. The 5S and tRNAPhe are the first complete RNA sequences available from the photosynthetic bacteria.     

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.     

Internal transcribed spacer 1 of the yeast precursor ribosomal RNA. Higher order structure and common structural motifs

The higher order structure of the first internal transcribed spacer between the 18S and the 5.8S rRNA sequences in the Saccharomyces cerevisiae precursor ribosomal RNA has been investigated. Sites of potential base pairing in the RNA region have been determined by using a combination of enzymatic and chemical structure sensitive probes. Data generated have been used to evaluate secondary structure models predicted by minimum free energy calculations. Several alternative suboptimal structures were also evaluated. The derived model contains several stable hairpins. Theoretical secondary structural models for the corresponding RNA region from S. carlsbergensis, S. pombe, N. crassa, X. laevis, and mung bean have also been derived from identical calculations and assumptions. Certain structural motifs appear to be conserved despite extensive divergence in the base sequence. The yeast model should be a useful prototype for investigation of structure and function of precursor ribosomal RNA molecules.     

The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.     

Nucleotide sequences of the 5.8S rRNAs of a mollusc and a porifer, and considerations regarding the secondary structure of 5.8S rRNA and its interaction with 28S rRNA

We report the primary structures of the 5.8 S ribosomal RNAs isolated from the sponge Hymeniacidon sanguinea and the snail Arion rufus. We had previously proposed (Ursi et al., Nucl. Acids Res. 10, 3517-3530 (1982)) a secondary structure model on the basis of a comparison of twelve 5.8 S RNA sequences then known, and a matching model for the interaction of 5.8 S RNA with 26 S RNA in yeast. Here we show that the secondary structure model can be extended to the 25 sequences presently available, and that the interaction model can be extended to the binding of 5.8 S RNA to the 5'-terminal domain of 28 S (26 S) RNA in three species.     

Some characteristics of processing sites in ribosomal precursor RNA of yeast.

The DNA sequences of the intergenic region between the 17S and 5.8S rRNA genes of the ribosomal RNA operon in yeast has been determined. In this region the 37S ribosomal precursor RNA is specifically cleaved at a number of sites in the course of the maturation process. The exact position of these processing sites has been established by sequence analysis of the terminal fragments of the respective RNA species. There appears to be no significant complementarity between the sequences surrounding the two termini of the 18S secondary precursor RNA nor between those surrounding the two termini of 17S mature rRNA. This finding implies that the processing of yeast 37S ribosomal precursor RNA is not directed by a double-strand specific ribonuclease previously shown to be involved in the processing of E. coli ribosomal precursor RNA [see Refs 1,2]. The processing sites of yeast ribosomal precursor RNA described in the present paper are all flanked at one side by a very [A+T]-rich sequence. In addition, sequence repeats are found around the processing sites in this precursor RNA. Finally, sequence homologies are present at the 3'-termini [6 nucleotides] and the 5'-termini [13 nucleotides] of a number of mature rRNA products and intermediate ribosomal RNA precursors. These structural features are discussed in terms of possible recognition sites for the processing enzymes.     

Sequences of the 5S rRNAs of the thermo-acidophilic archaebacterium Sulfolobus solfataricus (Caldariella acidophila) and the thermophilic eubacteria Bacillus acidocaldarius and Thermus aquaticus.

We have determined the nucleotide sequences of the 5 S rRNAs of three thermophilic bacteria: the archaebacterium Sulfolobus solfataricus, also named Caldariella acidophila, and the eubacteria Bacillus acidocaldarius and Thermus aquaticus. A 5 S RNA sequence for the latter species had already been published, but it looked suspect on the basis of its alignment with other 5 S RNA sequences and its base-pairing pattern. The corrected sequence aligns much better and fits in the universal five helix secondary structure model, as do the sequences for the two other examined species. The sequence found for Sulfolobus solfataricus is identical to that determined by others for Sulfolobus acidocaldarius. The secondary structure of its 5 S RNA shows a number of exceptional features which distinguish it not only from eubacterial and eukaryotic 5 S RNAs, but also from the limited number of archaebacterial 5 S RNA structures hitherto published. The free energy change of secondary structure formation is large in the three examined 5 S RNAs.     

Classification of methylotrophic bacteria according to 5S ribosomal RNA sequencing

5S ribosomal RNA sequences of 33 strains of methylotrophic bacteria were determined. Tentative phylogenetic tree was constructed using the maximum topological similarity principle. Strains under study can be divided into 7 separate branches consistently with the current classification of methylotrophic bacteria. More extensive tree was also built to show the position of methylotrophic bacteria with respect to non-methylotrophic ones. One can conclude that the in contrast to obligate methane-oxidizing bacteria, facultative methylotrophic bacteria do not comprise phylogenetically separate domain on the tree.     

Structure and evolution of ribonuclease P RNA in Gram-positive bacteria.

The sequences and structures of RNase P RNAs of some Gram-positive bacteria, e.g. Bacillus subtilis, are very different than those of other bacteria. In order to expand our understanding of the structure and evolution of RNase P RNA in Gram-positive bacteria, gene sequences encoding RNase P RNAs from 10 additional species from this evolutionary group have been determined, doubling the number of sequences available for comparative analysis. The enlarged data set allows refinement of the secondary structure model of these unusual RNase P RNAs and the identification of potential tertiary interactions between P10.1 and L12, and between L5.1 and L15.1. The newly-obtained sequences suggest that RNase P RNA underwent an abrupt, dramatic restructuring in the ancestry of the low-G+C Gram-positive bacteria after the divergence of the branches leading to the 'Clostridia and relatives' and the remaining low-G+C Gram-positive species. The unusual structures of the RNase P RNAs of Mycoplasma hyopneumoniae and M.floccularre are apparently derived from RNAs with Bacillus-like structure rather than from intermediate, partially restructured ancestral RNAs. The structure of the RNase P RNA from the photosynthetic Heliobacillus mobilis supports the relationship of this specie with Bacillus and Staphylococcus rather than the 'Clostridia and relatives' as suggested by the sequences of their small-subunit ribosomal RNAs.     

Paired sequence difference in ribosomal RNAs: evolutionary and phylogenetic implications

Ribosomal RNAs have secondary structures that are maintained by internal Watson-Crick pairing. Through analysis of chordate, arthropod, and plant 5S ribosomal RNA sequences, we show that Darwinian selection operates on these nucleotide sequences to maintain functionally important secondary structure. Insect phylogenies based on nucleotide positions involved in pairing and the production of secondary structure are incongruent with those constructed on the basis of positions that are not. Furthermore, phylogeny reconstruction using these nonpairing bases is concordant with other, morphological data.      

Computer-aided prediction of RNA secondary structures.

A brief survey of computer algorithms that have been developed to generate predictions of the secondary structures of RNA molecules is presented. Two particular methods are described in some detail. The first utilizes a thermodynamic energy minimization algorithm that takes into account the likelihood that short-range folding tends to be favored over long-range interactions. The second utilizes an interactive computer graphic modelling algorithm that enables the user to consider thermodynamic criteria as well as structural data obtained by nuclease susceptibility, chemical reactivity and phylogenetic studies. Examples of structures for prokaryotic 16S and 23S ribosomal RNAs, several eukaryotic 5S ribosomal RNAs and rabbit beta-globin messenger RNA are presented as case studies in order to describe the two techniques. Anm argument is made for integrating the two approaches presented in this paper, enabling the user to generate proposed structures using thermodynamic criteria, allowing interactive refinement of these structures through the application of experimentally derived data.     

Ribosomal RNA genes of Saccharomyces cerevisiae. I. Physical map of the repeating unit and location of the regions coding for 5 S, 5.8 S, 18 S, and 25 S ribosomal RNAs.

The organization of the ribosomal DNA repeating unit from Saccharomyces cerevisiae has been analyzed. A cloned ribosomal DNA repeating unit has been mapped with the restriction enzymes Xma 1, Kpn 1, HindIII, Xba 1, Bgl I + II, and EcoRI. The locations of the sequences which code for 5 S, 5.8 S, 18 S, and 25 S ribosomal RNAs have been determined by hybridization of the purified RNA species with restriction endonuclease generated fragments of the repeating unit. The position of the 5.8 S ribosomal DNA sequences within the repeat was also established by sequencing the DNA which codes for 83 nucleotides at the 5' end of 5.8 S ribosomal RNA. The polarity of the 35 S ribosomal RNA precursor has been established by a combination of hybridization analysis and DNA sequence determination and is 5'-18 S, 5.8 S, 25 S-3'.     

Structure of 5S rRNA in actinomycetes and relatives and evolution of eubacteria

Summary The primary structure of 5S ribosomal RNA has been determined in five species belonging to the genusMycobacterium and inMicrococcus luteus. The sequences of 5S RNAs from Actinomycetes and relatives point to the existence in this taxon of a bulge on the helix that joins the termini of the molecule. An attempt was made to reconstruct bacterial evolution from a sequence dissimilarity matrix based on 142 eubacterial 5S RNA sequences and corrected for multiple mutation. The algorithm is based on weighted pairwise clustering, and incorporates a correction for divergent mutation rates, as derived by comparison of sequence dissimilarities with an external reference group of eukaryotic 5S RNAs. The resulting tree is compared with the eubacterial phylogeny built on 16S rRNA catalog comparison. The bacteria for which the 5S RNA sequence is known form a number of clusters also discernible in the 16S rRNA phylogeny. However, the branching pattern leading to these clusters shows some notable discrepancies with the aforementioned phylogeny.     

Secondary structure maps of ribosomal RNA and DNA: I. Processing of Xenopus laevis ribosomal RNA and structure of single-stranded ribosomal DNA

Precursor and mature ribosomal RNA molecules from Xenopus laevis were examined by electron microscopy. A reproducible arrangement of hairpin loops was observed in these molecules. Maps based on this secondary structure were used to determine the arrangement of sequences in precursor RNA molecules and to identify the position of mature rRNAs within the precursors. A processing scheme was derived in which the 40 S rRNA is cleaved to 38 S RNA, which then yields 34 S plus 18 S RNA. The 34 S RNA is processed to 30 S, and finally to 28 S rRNA. The pathway is analogous to that of L-cell rRNA but differs from HeLa rRNA in that no 20 S rRNA intermediate was found. X. laevis 40 S rRNA (M_r = 2.7 × 10⁶) is much smaller than HeLa or L-cell 45 8 rRNA (M_r = 4.7 × 10⁶), but the arrangement of mature rRNA sequences in all precursors is very similar. Experiments with ascites cell 3′-exonuclease show that the 28 S region is located at or close to the 5′-end of the 40 S rRNA.Secondary structure maps were obtained also for single-stranded molecules of ribosomal DNA. The region in the DNA coding for the 40 S rRNA could be identified by its regular structure, which closely resembles that of the RNA. Regions corresponding to the 40 S RNA gene alternate with non-transcribed spacer regions along strands of rDNA. The latter have a large amount of irregular secondary structure and vary in length between different repeating units. A detailed map of the rDNA repeating unit was derived from these experiments.Optical melting studies are presented, showing that rRNAs with a high (G + C) content exhibit significant hypochromicity in the formamide/urea-containing solution that was used for spreading.     

An NMR study of the helix V-loop E region of the 5S RNA from Escherichia coli

Experiments are described that complete the assignment of the imino proton NMR spectrum of the fragment 1 domain from the 5S RNA of Escherichia coli. Most of the new assignments fall in the helix V-loop E portion of the molecule (bases 70-78 and 98-106), the region most sensitive to the binding of ribosomal protein L25. The spectroscopic data are incompatible with the standard, phylogenetically derived model for 5S RNA, which makes all the base pairs possible in loop E with the sequences aligned in parallel (C70-G106, C71-G105, etc.) [see Delihas et al. (1984) Prog. Nucleic Acid Res. Mol. Biol. 31, 161-190]. Furthermore, the alternative loop E model proposed for spinach chloroplast 5S RNA by Romby et al. [(1988) Biochemistry 27, 4721-4730] does not apply to the closely homologous 5S RNA from E. coli. The 5S RNAs from E. coli and spinach chloroplasts do not have the same secondary structures in solution despite their strong sequence homologies, and neither appears to conform to the standard model for 5S RNA in the loop E region.     

Secondary structure model for 23S ribosomal RNA.

A secondary structure model for 23S ribosomal RNA has been constructed on the basis of comparative sequence data, including the complete sequences from E. coli. Bacillus stearothermophilis, human and mouse mitochondria and several partial sequences. The model has been tested extensively with single strand-specific chemical and enzymatic probes. Long range base-paired interactions organize the molecule into six major structural domains containing over 100 individual helices in all. Regions containing the sites of interaction with several ribosomal proteins and 5S RNA have been located. Segments of the 23S RNA structure corresponding to eucaryotic 5.8S and 25 RNA have been identified, and base paired interactions in the model suggest how they are attached to 28S RNA. Functionally important regions, including possible sites of contact with 30S ribosomal subunits, the peptidyl transferase center and locations of intervening sequences in various organisms are discussed. Models for molecular 'switching' of RNA molecules based on coaxial stacking of helices are presented, including a scheme for tRNA-23S RNA interaction.     

Refined secondary structure models for the 16S and 23S ribosomal RNA of Escherichia coli

The complete range of published sequences for ribosomal RNA (or rDNA), totalling well over 50,000 bases, has been used to derive refined models for the secondary structures of both 16S and 23S RNA from E. coli. Particular attention has been paid to resolving the differences between the various published secondary structures for these molecules. The structures are described in terms of 133 helical regions (45 for 16S RNA and 88 for 23S RNA). Of these, approximately 20 are still tentative or unconfirmed. A further 20 represent helical regions which definitely exist, but where the detailed base-pairing is still open to discussion. Over 90 of the helical regions are however now precisely established, at least to within one or two base pairs.     

Nucleotide sequence of a crustacean 18S ribosomal RNA gene and secondary structure of eukaryotic small subunit ribosomal RNAs

The primary structure of the gene for 18 S rRNA of the crustacean Artemia salina was determined. The sequence has been aligned with 13 other small ribosomal subunit RNA sequences of eukaryotic, archaebacterial, eubacterial, chloroplastic and plant mitochondrial origin. Secondary structure models for these RNAs were derived on the basis of previously proposed models and additional comparative evidence found in the alignment. Although there is a general similarity in the secondary structure models for eukaryotes and prokaryotes, the evidence seems to indicate a different topology in a central area of the structures.     

Nucleotide sequence and structure of cytoplasmic 5S RNA and 5.8S RNA of Chlamydomonas reinhardii.

Three small RNAs of the cytoplasmic 8OS ribosomes of the green unicellular alga Chlamydomonas reinhardii have been sequenced. They include two species of ribosomal 5S RNA, a major and a minor one of 122 and 121 nucleotides respectively, which differ from each other by 17 bases, and also the ribosomal 5.8S RNA of 156 nucleotides. Novel structural features can be recognized in the 5S RNAs of C. reinhardii by a comparison with published 5S RNA sequences. In addition the secondary structure of these small RNA molecules has been examined using a newly developed method based on differential nuclease susceptibility.