Interaction of tRNA with Safranal, Crocetin, and Dimethylcrocetin

Saffron is the red dried stigmas of Crocus sativus L. flowers and used both as a spice and as a drug in traditional therapeutic. The biological activity of saffron in modern medicine is in development. Its numerous applications as an anti-oxidant and anti-cancer agent are due to its secondary metabolites and their derivatives (safranal, crocins, crocetin, dimethylcrocetin). The aim of this study was to examine the interaction of transfer RNA with safranal, crocetin, and dimethylcrocetin in aqueous solution at physiological conditions. Constant tRNA concentration (6.25 mM) and various drug/tRNA (phosphate) molar ratios of 1/48 to 1/8 were used. FT-IR and UV-Visible difference spectroscopic methods have been applied to determine the drug binding mode, the binding constants and the effects of drug complexation on the stability and conformation of tRNA duplex. External binding mode was observed for safranal crocetin and dimethylcrocetin, with overall binding constants K(safranal) = 6.8 (+/- 0.34) x 10(3) M(-1), K(CRT) = 1.4 (+/- 0.31) x 10(4) M(-1), and K(DMCRT) = 3.4 (+/- 0.30) x 10(4) M(-1). Transfer RNA remains in the A-family structure, upon safranal, crocetin and dimethylcrocetin complexation.     

Interaction of tRNA with Safranal,Crocetin, and Dimethylcrocetin

Abstract

Saffron is the red dried stigmas of Crocus sativus L. flowers and used both as a spice and as a drug in traditional therapeutic. The biological activity of saffron in modern medicine is in development. Its numerous applications as an anti-oxidant and anti-cancer agent are due to its secondary metabolites and their derivatives (safranal, crocins, crocetin, dimethylcrocetin). The aim of this study was to examine the interaction of transfer RNA with safranal, crocetin, and dimethylcrocetin in aqueous solution at physiological conditions. Constant tRNA concentration (6.25 mM) and various drug/tRNA (phosphate) molar ratios of 1/48 to 1/8 were used. FT-IR and UV-Visible difference spectroscopic methods have been applied to determine the drug binding mode, the binding constants and the effects of drug complexation on the stability and conformation of tRNA duplex. External binding mode was observed for safranal crocetin and dimethylcrocetin, with overall binding constants K_safranal = 6.8 (± 0.34) × 10³ M^?1, K_CRT = 1.4 (± 0.31) × 10⁴ M^?1, and K_DMCRT = 3.4 (± 0.30) × 10⁴ M^?1. Transfer RNA remains in the A-family structure, upon safranal, crocetin and dimethylcrocetin complexation.     

DNA interaction with naturally occurring antioxidant flavonoids quercetin, kaempferol, and delphinidin

Flavonoids are strong antioxidants that prevent DNA damage. The anticancer and antiviral activities of these natural products are implicated in their mechanism of actions. However, there has been no information on the interactions of these antioxidants with individual DNA at molecular level. This study was designed to examine the interaction of quercetin (que), kaempferol (kae), and delphinidin (del) with calf-thymus DNA in aqueous solution at physiological conditions, using constant DNA concentration (6.5 mmol) and various drug/DNA(phosphate) ratios of 1/65 to 1. FTIR and UV-Visible difference spectroscopic methods are used to determine the drug binding sites, the binding constants and the effects of drug complexation on the stability and conformation of DNA duplex. Structural analysis showed quercetin, kaempferol, and delphinidin bind weakly to adenine, guanine (major groove), and thymine (minor groove) bases, as well as to the backbone phosphate group with overall binding constants K(que) = 7.25 x 10(4)M(-1), K(kae) = 3.60 x 10(4)M(-1), and K(del) = 1.66 x 10(4)M(-1). The stability of adduct formation is in the order of que>kae>del. Delphinidin with a positive charge induces more stabilizing effect on DNA duplex than quercetin and kaempferol. A partial B to A-DNA transition occurs at high drug concentrations.     

DNA adducts with antioxidant flavonoids: morin, apigenin, and naringin

Flavonoids have recently attracted a great interest as potential therapeutic drugs against a wide range of free-radical-mediated diseases. The anticancer and antiviral activities of these natural products are implicated in their mechanism of actions. While the antioxidant activity of these natural polyphenolic compounds is well known, their bindings to DNA are not fully investigated. This study was designed to examine the interactions of morin (Mor), naringin (Nar), and apigenin (Api) with calf thymus DNA in aqueous solution at physiological conditions, using constant DNA concentration (6.25 mM) and various drug/DNA(phosphate) ratios of 1/40 to 1. FTIR and UV-Vis spectroscopic methods were used to determine the ligand binding modes, the binding constant, and the stability of DNA in flavonoid-DNA complexes in aqueous solution. Spectroscopic evidence shows both intercalation and external binding of flavonoids to DNA duplex with overall binding constants of K(morin) = 5.99 x 10(3) M(-1), K(apigenin) = 7.10 x 10(4) M(-1), and K(naringin) = 3.10 x 10(3) M(-1). The affinity of ligand-DNA binding is in the order of apigenin > morin > naringin. DNA aggregation and a partial B- to A-DNA transition occurs upon morin, apigenin, and naringin complexation.     

Interaction of antioxidant flavonoids with tRNA: intercalation or external binding and comparison with flavonoid-DNA adducts

Antioxidants are essential to good health. Flavonoids are powerful antioxidants, and prevent DNA damage. The antioxidative protections are related to their binding modes to a DNA duplex and complexation with free radicals in vivo. Recently we reported the interaction of flavonoids with DNA in vitro (Kanakis et al., J. Biomol. Struct. Dyn. 22, 719-724, 2005), where polyphenol different binding modes were discussed. The aim of this study was to examine the interaction of transfer RNA with quercetin (que), kaempferol (kae), and delphinidin (del) in aqueous solution at physiological conditions and to make a comparison with the corresponding pigment-DNA adducts. Constant tRNA concentration (6.25 mM) and various drug/RNA(phosphate) molar ratios of 1/48 to 1/8 were used. FTIR and UV-visible difference spectroscopic methods have been applied to determine the drug binding mode, the binding constants, and the effects of drug complexation on the stability and conformation of tRNA duplex. Both intercalative and external binding modes were observed. Structural analysis showed que, kae, and a del intercalate tRNA duplex with minor external binding to the major or minor groove and the backbone phosphate group with overall binding constants K (que) = 4.80 x 10(4) M(1), K (kae) = 4.65 x 10(4) M(1), and K (del) = 9.47 x 10(4) M(1). The stability of adduct formation is in the order of del > que > kae. A comparison with flavonoids-DNA adducts showed both intercalation and external bindings with the stability order K (que) = 7.25 x 10(4) M(1), K (kae) = 3.60 x 10(4) M(1), and K (del) = 1.66 x 10(4) M(1). Low flavonoid concentration induces helical stabilization, whereas high pigment content causes helix opening. A partial Bto A-DNA transition occurs at high drug concentration, while tRNA remains in the A-family structure.     

Binding of netropsin and 4,6-diamidino-2-phenylindole to an A2T2 DNA hairpin: a comparison of biophysical techniques

Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies.     

Study of DNA interactions with steroidal and nonsteroidal estrogen-platinum (II)-based anticancer drugs

The interactions of the steroidal and nonsteroidal estrogen-platinum (Pt) (II)-based anticancer drugs 16beta-hydroxymethyl-16alpha-[8-(2-pyridin-2-yl-ethylamino)-3,6-dioxaoctyl]-1,3,5(10)-estratrien-3,17betadiol dichloroplatinum (II) (JPM-39), 4-[6-(2'-pyridylethylamino)-butyloxy)-phenyl]-7-methoxy-2,2-dimethyl-3-phenyl-chroman dichloroplatinum (II) (ATG-99), and 1-[(2-aminoethyl)amino]-9,10,10-tris(4-hydroxyphenyl)-9-decene dichloroplatinum (II) (GEB-28) with calf-thymus DNA in vitro using constant DNA concentration and various drug levels were studied. Fourier transform infrared (FTIR) and circular dichroism (CD) were studied with calf-thymus DNA in vitro using constant DNA concentration and various drug levels. FTIR, UV-visible, and CD spectroscopic methods were used to characterize the drug binding mode, the binding constant, and structural variations of DNA in aqueous solution. Spectroscopic evidence showed that the various Pt-based drugs bind indirectly to the major and minor grooves of DNA duplex with some degree of drug-phosphate interaction. The overall binding constants for JPM-39, GEB-28, and ATG-99 are K(JPM-39) = 4.2 (+/-0.75) x 10(3) M(-1), K(GEB-28) = 3.4 (+/-0.65) x 10(3) M(-1), and K(ATG-99) = 2.1 (+/-0.45) x 10(3) M(-1). DNA aggregation occurs at high drug concentration, while DNA remains in the B-family structure.     

DNA binding properties of the marine sponge pigment fascaplysin

Association of fascaplysin with double-stranded calf thymus DNA was investigated by means of isothermal titration calorimetry, absorption spectroscopy, and circular dichroism. The UV spectroscopic data could be well interpreted in terms of a two-site model for the binding of fascaplysin to DNA revealing affinity constants of K1 = 2.5 x 10(6) M(-1) and K2 = 7.5 x 10(4) M(-1) (base pairs of DNA). Based on the typical change observed in the absorption and circular dichroism spectra, intercalation of fascaplysin is regarded as the major binding mode. The calorimetric titration curves showed an exothermic reaction which was exhausted at a 2:1 base pair/drug; ratio. This finding is in agreement with an intercalation model comprising nearest neighbor exclusion. In addition, significantly weaker non-intercalative DNA interactions can be observed at high drug concentration. By comparison of all these data with the binding behavior of known intercalating agents, it is concluded that fascaplysin intercalates into DNA.     

A Comparative study of Fe(II) and Fe(III) interactions with DNA duplex: major and minor grooves bindings

The involvement of the Fe cations in autoxidation in cells and tissues is well documented. DNA is a major target in such reaction, and can chelate Fe cation in many ways. The present study was designed to examine the interaction of calf-thymus DNA with Fe(II) and Fe(III), in aqueous solution at pH 6.5 with cation/DNA (P) (P = phosphate) molar ratios (r) of 1:160 to 1:2. Capillary electrophoresis and Fourier transform infrared (FTIR) difference spectroscopic methods were used to determine the cation binding site, the binding constant, helix stability and DNA conformation in Fe-DNA complexes. Structural analysis showed that at low cation concentration (r = 1/80 and 1/40), Fe(II) binds DNA through guanine N-7 and the backbone PO(2) group with specific binding constants of K(G) = 5.40 x 10(4) M(1) and K(P) = 2.40 x 10(4) M(1). At higher cation content, Fe(II) bindings to adenine N-7 and thymine O-2 are included. The Fe(III) cation shows stronger interaction with DNA bases and the backbone phosphate group. At low cation concentration (r = 1:80), Fe(III) binds mainly to the backbone phosphate group, while at higher metal ion content, cation binding to both guanine N-7 atom and the backbone phosphate group is prevailing with specific binding constants of K(G) = 1.36 x 10(5) M(-1) and K(P) = 5.50 x 10(4) M(-1). At r = 1:10, Fe(II) binding causes a minor helix destabilization, whereas Fe(III) induces DNA condensation. No major DNA conformational changes occurred upon iron complexation and DNA remains in the B-family structure.     

A supramolecular enzyme model catalyzing the central cleavage of carotenoids

Several bis-beta-cyclodextrin porphyrins have been prepared as supramolecular receptors of carotenoids. The binding constants of carotenoids to receptors were determined by quenching the fluorescence of the porphyrins on hydrophobic binding of carotenoids within the cavities of cyclodextrins. K(a)=8.3 x 10(6) M(-1) was calculated for binding of beta,beta-carotene to bis-beta-cyclodextrin Zn porphyrin. The corresponding Ru complex catalyzes the central cleavage of carotenoids in the presence of tert-butyl hydroperoxide in a biphasic system.     

Structural analysis of DNA interactions with biogenic polyamines and cobalt(III)hexamine studied by Fourier transform infrared and capillary electrophoresis

Biogenic polyamines, such as putrescine, spermidine, and spermine are small organic polycations involved in numerous diverse biological processes. These compounds play an important role in nucleic acid function due to their binding to DNA and RNA. It has been shown that biogenic polyamines cause DNA condensation and aggregation similar to that of inorganic cobalt(III)hexamine cation, which has the ability to induce DNA conformational changes. However, the nature of the polyamine.DNA binding at the molecular level is not clearly established and is the subject of much controversy. In the present study the effects of spermine, spermidine, putrescine, and cobalt(III)hexamine on the solution structure of calf-thymus DNA were investigated using affinity capillary electrophoresis, Fourier transform infrared, and circular dichroism spectroscopic methods. At low polycation concentrations, putrescine binds preferentially through the minor and major grooves of double strand DNA, whereas spermine, spermidine, and cobalt(III)hexamine bind to the major groove. At high polycation concentrations, putrescine interaction with the bases is weak, whereas strong base binding occurred for spermidine in the major and minor grooves of DNA duplex. However, major groove binding is preferred by spermine and cobalt(III)hexamine cations. Electrostatic attractions between polycation and the backbone phosphate group were also observed. No major alterations of B-DNA were observed for biogenic polyamines, whereas cobalt(III)hexamine induced a partial B --> A transition. DNA condensation was also observed for cobalt(III)hexamine cation, whereas organic polyamines induced duplex stabilization. The binding constants calculated for biogenic polyamines are K(Spm) = 2.3 x 10(5) M(-1), K(Spd) = 1.4 x 10(5) M(-1), and K(Put) = 1.02 x 10(5) M(-1). Two binding constants have been found for cobalt(III)hexamine with K(1) = 1.8 x 10(5) M(-1) and K(2) = 9.2 x 10(4) M(-1). The Hill coefficients indicate a positive cooperativity binding for biogenic polyamines and a negative cooperativity for cobalt(III)hexamine.     

Berberine and amitozine binding with calf thymus DNA

Binding of amitozine and berberine to DNA has been investigated by VIS- and UV-spectroscopy. It has been found that amitozine forms one type of complex and berberine forms two types of complexes with DNA. Observed concentration dependences of absorption spectra were analyzed using the DALSMOD optimization program and association constants were calculated (K(BCl)= 3 x 10(3) M(-1), K(Am) = 1.6 x 10(3)-10(4) M(-1)). Competitive binding of berberine to DNA in presence of ethidium bromide has been investigated as well. It has been shown that it competes with berberine for DNA binding sites.     

Thymol and carvacrol binding to DNA: model for drug-DNA interaction

Thymol and carvacrol can bind to major and minor grooves of B-DNA. The aim of this study was to examine the interaction of calf thymus DNA with thymol and carvacrol in aqueous solution and physiological pH with thymol/DNA and carvacrol/DNA (phosphate) molar ratios of 1/20, 1/10, 1/5, and 1/1. Fourier transform infrared and UV-visible difference spectroscopy were used to determine the thymol and carvacrol binding mode, binding constant, sequence selectivity, DNA secondary structure, and structural variations of thymol/DNA and carvacrol/DNA complexes in aqueous solution. Spectroscopic evidence showed that the thymol and carvacrol interaction occurred mainly through H-bonding of the thymol and carvacrol OH group to the guanine N7, cytosine N3, and backbone phosphate group with overall binding constant of K(thymol-DNA) = 2.43 x 10(3) M(-1), K(carvacrol-DNA) = 1.55 x 10(3) M(-1). In thymol and carvacrol-DNA complexes, DNA remains in the B-family structure.     

High affinity binding of paclitaxel to human serum albumin.

Paclitaxel, a very potent antitumor agent is a hydrophobic molecule with low aqueous solubility. Its currently used formula (Taxol) contains the drug in a 1 : 1 (v/v) mixture of ethanol and Cremophor EL. To minimize vehicle-related toxicity, we developed a novel, water-soluble formulation in which paclitaxel is bound noncovalently to human serum albumin. For this purpose, studies of the paclitaxel-albumin binding equilibrium were performed. Paclitaxel dissolved in ethanol was added to the aqueous solution of human serum albumin. Precipitated paclitaxel was removed and unbound drug was separated by ultrafiltration. Paclitaxel concentration was measured by RP-HPLC. Binding data were evaluated based both on the Scatchard plot and the general binding equation describing binding equilibria with the stepwise stoichiometric binding constants. The Scatchard plot was found to be curvilinear with a slight positive slope of the final part. Parameters of high affinity specific binding were determined from the initial part of the curve (nsp = 1.3 and Ksp = 1.7 x 10(6) M(-1)). Stoichiometric binding constants were estimated by fitting the general binding equation to the experimental data (K1 = 2.4 x 10(6) M(-1) and K2 = 1.0 x 10(5) M(-1)). Saturation of the protein with paclitaxel, similarly to other ligands of albumin, could not be reached. The greatest observed value of r (number of paclitaxel molecules bound to one albumin molecule) was 6.6.     

Thermodynamic comparison of PNA/DNA and DNA/DNA hybridization reactions at ambient temperature

The thermodynamics of 13 hybridization reactions between 10 base DNA sequences of design 5'-ATGCXYATGC-3' with X, Y = A, C, G, T and their complementary PNA and DNA sequences were determined from isothermal titration calorimetry (ITC) measurements at ambient temperature. For the PNA/DNA hybridization reactions, the binding constants range from 1.8 x 10(6)M(-1)for PNA(TT)/DNA to 4.15 x 10(7)M(-1)for PNA(GA)/DNA and the binding enthalpies range from -194 kJ mol(-1)for PNA(CG)/DNA to -77 kJ mol(-1)for PNA(GT)/DNA. For the corresponding DNA/DNA binding reactions, the binding constants range from 2.9 x 10(5)M(-1)for DNA(GT)/DNA to 1.9 x 10(7)M(-1)for DNA(CC)/DNA and the binding enthalpies range from -223 kJ mol(-1)for DNA(CG)/DNA to -124 kJ mol(-1)for DNA(TT)/DNA. Most of the PNA sequences exhibited tighter binding affinities than their corresponding DNA sequences resulting from smaller entropy changes in the PNA/DNA hybridization reactions. van't Hoff enthalpies and extrapolated Delta G values determined from UV melting studies on the duplexes exhibited closer agreement with the ITC binding enthalpies and Delta G values for the DNA/DNA duplexes than for the PNA/DNA duplexes.     

Mixed-ligand copper(II)-phenanthroline-dipeptide complexes: synthesis, characterization, and DNA-cleavage properties

The mixed-ligand complexes [Cu(II)(HisLeu)(phen)](+) (1) and [Cu(II)(HisSer)(phen)](+) (2; phen=1,10-phenanthroline) were synthesized and characterized. The intercalative interaction of the Cu(II) complexes with calf-thymus DNA (CT-DNA) was probed by UV/VIS and fluorescence titration, as well as by thermal-denaturation experiments, and the intrinsic binding constants (K(b)) for the complexes with 1 and 2 were 4.2x10(3) and 4.9x10(3) M(-1), resp. Both complexes were found to be efficient catalysts for the hydrolytic cleavage of plasmid pUC19 DNA, as tested by gel electrophoresis, converting the DNA from the supercoiled to the nicked-circular form at rate constants of 1.32 and 1.40 h(-1) for 1 and 2, resp.     

A comparative study of DNA complexation with Mg(II) and Ca(II) in aqueous solution: major and minor grooves bindings

Although structural differences for the Mg-DNA and Ca-DNA complexes are provided in the solid state, such comparative study in aqueous solution has been less investigated. The aim of this study was to examine the bindings of Mg and Ca cations with calf thymus DNA in aqueous solution at physiological pH, using constant concentration of DNA (1.25 or 12.5 mM) and various concentrations of metal ions (2 microM-650 microM). Capillary electrophoresis, UV-visible, and Fourier transform infrared spectroscopic methods were used to determine the cation-binding modes, the binding constants, and DNA structural variations in aqueous solution. Direct Ca-PO(2) binding was evident by major spectral changes (shifting and splitting) of the backbone PO(2) asymmetric stretching at 1222 cm(-1) with K = 4.80 x 10(5) M(-1), whereas an indirect Mg-phosphate interaction occurred (due to the lack of shifting and splitting of the phosphate band at 1222 cm(-1)) with K = 5.6 x 10(4) M(-1). The metal-base bindings were directly for the Mg with K = 3.20 x 10(5) M(-1) and indirectly for the Ca cation with K = 3.0 x 10(4) M(-1). Both major and minor groove bindings were observed with no alteration of the B-DNA conformation.