Real‐time measurements of human chondrocyte heat production during in vitro proliferation

Isothermal microcalorimeters (IMC) are highly sensitive instruments that allow the measurement of heat flow in the microwatt range. Due to their detection of minute thermal heat, IMC techniques have been used in numerous biological applications, including the study of fermentation processes, pharmaceutical development, and cell metabolism. In this work, with the ultimate goal of establishing a rapid and real‐time method to predict the proliferative capacity of human articular chondrocytes (HAC), we explored to use of IMC to characterize one of the crucial steps within the process of cartilage tissue engineering, namely the in vitro expansion of HAC. We first established an IMC‐based model for the real‐time monitoring of heat flow generated by HAC during proliferation. Profiles of the heat and heat flow curves obtained were consistent with those previously shown for other cell types. The average heat flow per HAC was determined to be 22.0 ± 5.3 pW. We next demonstrated that HAC proliferation within the IMC‐based model was similar to proliferation under standard culture conditions, verifying its relevance for simulating the typical cell culture application. HAC growth and HAC heat over time appeared correlated for cells derived from particular donors. However, based on the results from 12 independent donors, no predictive correlation could be established between the growth rate and the heat increase rate of HAC. This was likely due to variability in the biological function of HAC derived from different donors, combined with the complexity of tightly couple metabolic processes beyond proliferation. In conclusion, IMC appears to be a promising technique to characterize cell proliferation. However, studies with more reproducible cell sources (e.g., cell lines) could be used before adding the complexity associated with primary human cells. Biotechnol. Bioeng. 2011;108: 3019–3024. © 2011 Wiley Periodicals, Inc.     

Influence of a combination of two potential probiotic strains, Lactobacillus rhamnosus IMC 501® and Lactobacillus paracasei IMC 502® on bowel habits of healthy adults

Aims: This study aims to investigate the effect of different kinds of food products enriched with a combination of two potential probiotic strains, Lactobacillus rhamnosus IMC 501^® and Lactobacillus paracasei IMC 502^®, on bowel habits of healthy adults. Methods and Results: Fifty healthy volunteers took part in a double‐blind placebo probiotic feeding study (25 fed probiotics, 25 fed placebo) for 12 weeks. Each volunteer ingested daily one or more food products enriched with a combination of the two potential probiotic strains (probiotic group) or the same food products without the probiotics (control group). Faecal samples were collected before, at the end and 2 weeks later the intervention period, and some of the main groups of faecal bacteria were enumerated by plate count and real‐time PCR. Questionnaires on bowel habits were submitted to volunteers. After the intervention, a significant increase in faecal lactobacilli and bifidobacteria were observed in the probiotic group, and stool frequency and stool volume were higher in the probiotic group than in the placebo group. Conclusions: Daily consumption of food products enriched with the two potential probiotic strains, Lact. rhamnosus IMC 501^® and Lact. paracasei IMC 502^®, contributes to improve intestinal microbiota with beneficial properties and enhances bowel habits of healthy adults. Significance and Impact of the Study: The study revealed that Lact. rhamnosus IMC 501^® and Lact. paracasei IMC 502^® exert a positive effect, in terms of improved bowel habits, on healthy adults.     

Specific detection and quantification of culturable and non-culturable mycobacteria in metalworking fluids by fluorescence-based methods

Aims: To optimize and evaluate fluorescence microscopy assays for specific assessment of mycobacteria and co‐contaminants, including culturable and non‐culturable sub‐populations, in metalworking fluids (MWF). Methods and Results: Auramine‐O‐rhodamine (AR) staining and LIVE/DEAD BacLight? Bacterial Viability staining (L/D staining) were adapted and evaluated for detection/quantification and differentiation (viable vs non‐viable) of the MWF‐associated mycobacteria and the background bacterial flora, respectively. The AR staining method was found to be specific to MWF mycobacteria with a minimum detection limit of 10 cells ml^?1 and was comparable to the QPCR in quantification efficiency in MWF matrix. The L/D staining‐based microscopy allowed differential quantification of viable vs non‐viable cells. In general, a 3‐log difference was observed between the L/D microscopy count and culture count accounting for the presence of non‐culturable fraction in the bacterial population in in‐use MWF. Conclusions: The optimized AR staining‐ and the L/D staining‐based microscopy methods have the potential for rapid, specific and differential assessment (viable vs non‐viable) of MWF‐associated mycobacteria and co‐contaminants in field MWF. Significance and Impact of the study: Early detection of MWF mycobacteria by rapid, low‐cost, less‐skill intensive and culture‐independent fluorescence‐based microscopy methods will facilitate timely intervention to protect the machine workers from occupational hazards.     

Effect of a Probiotic Intake on Oxidant and Antioxidant Parameters in Plasma of Athletes During Intense Exercise Training

The aim of this study was to evaluate the effect of Lactobacillus rhamnosus IMC 501^® and Lactobacillus paracasei IMC 502^® on oxidative stress in athletes during a four-week period of intense physical activity. Two groups of twelve subjects each were selected for this analysis. The first group consumed a daily dose of a mixture of the two probiotic strains (1:1 L. rhamnosus IMC 501^® and L. paracasei IMC 502^®; ~10⁹ cells/day) for 4 weeks. The second group (control) did not consume any supplements during the 4 weeks. Blood samples collected immediately before and after the supplementation were analyzed, and plasma levels of reactive oxygen metabolites and biological antioxidant potential were determined. Faeces were also collected and analyzed before and at the end of the probiotic supplementation. Antioxidative activity and oxidative stress resistance of the two strains were determined in vitro. Results demonstrated that intense physical activity induced oxidative stress and that probiotic supplementation increased plasma antioxidant levels, thus neutralizing reactive oxygen species. The two strains, L. rhamnosus IMC 501^® and L. paracasei IMC 502^®, exert strong antioxidant activity. Athletes and all those exposed to oxidative stress may benefit from the ability of these probiotics to increase antioxidant levels and neutralize the effects of reactive oxygen species.     

Rapid detection of “Candidatus Phytoplasma mali” by recombinase polymerase amplification assays

Isothermal recombinase polymerase amplification (RPA) assays for the specific detection of “Candidatus Phytoplasma mali (Ca. P. mali),” the causal agent of apple proliferation, were developed. The assays amplify a fragment of the imp gene and amplimers were detected either by fluorescence in real‐time mode (TwistAmp^®exo assay) using a fluorophore‐labelled probe or by direct visualization employing a lateral flow device (TwistAmp^®nfo assay/Milenia^®HybriDetect). The RPA assays specifically amplified DNA from “Ca. P. mali” strains, and cross‐reactivity with other phytoplasmas or plant DNA was not observed. The limit of detection was determined with a cloned imp standard, and positive results were obtained down to 10 copies with both RPA assay formats. In comparison with a TaqMan real‐time PCR assay based on the same target gene, the RPA assays were equally sensitive, but results were obtained faster. Simplified nucleic acid extraction procedures from plant tissue with Tris‐ and CTAB‐based buffers revealed that crude Tris–DNA extracts were a suitable source for RPA tests while larger concentrations of CTAB were inhibitory. This is the first report of RPA‐based assays for the detection of “Ca. P. mali”. The assays are suitable for high‐throughput screening of plant material and point‐of‐care diagnostic and can be potentially combined with a simplified DNA extraction procedure.     

Evaluation of the hyplex<Superscript>®</Superscript> TBC PCR test for detection of <Emphasis Type="Italic">Mycobacterium tuberculosis</Emphasis> complex in clinical samples

Background

Tuberculosis (TB) is one of the major public health concerns worldwide. The detection of the pathogen Mycobacterium tuberculosis complex (MTBC) as early as possible has a great impact on the effective control of the spread of the disease. In our study, we evaluated the hyplex^® TBC PCR test (BAG Health Care GmbH), a novel assay using a nucleic acid amplification technique (NAAT) with reverse hybridisation and ELISA read out for the rapid detection of M. tuberculosis directly in clinical samples.

Results

A total of 581 respiratory and non-respiratory specimens from our pneumological hospital and the National TB Institute of Uzbekistan were used for the evaluation of the PCR assay. Of these, 292 were classified as TB samples and 289 as non-TB samples based on the results of the TB cultures as reference method. The PCR results were initially used to optimise the cut-off value of the hyplex^® TBC test system by means of a ROC analysis. The overall sensitivity of the assay was determined to be 83.1%. In smear-positive TB samples, the sensitivity of the hyplex^® TBC PCR test was estimated to 93.4% versus 45.1% in smear-negative samples. The specificity of the test was 99.25%. Of the two specimens (0.75%) with false-positive PCR results, one yielded a culture positive for non-tuberculous mycobacteria. Based on the assumption of a prevalence of 8% TB positives among the samples in our diagnostic TB laboratory, the positive and negative predictive values were estimated to 90.4% and 98.5%, respectively.

Conclusions

The hyplex^® TBC PCR test is an accurate NAAT assay for a rapid and reliable detection of M. tuberculosis in various respiratory and non-respiratory specimens. Compared to many other conventional NAAT assays, the hyplex^® TBC PCR test is in a low price segment which makes it an attractive option for developing and emerging countries with high TB burdens.

     

Multiplex PCR assay for simultaneous detection and differentiation of Mycobacterium tuberculosis, Mycobacterium avium complexes and other Mycobacterial species directly from clinical specimens

Aims: Polymerase chain reaction (PCR) is the most rapid and sensitive method for diagnosing mycobacterial infections and identifying the aetiological Mycobacterial species in order to administer the appropriate therapy and for better patient management. Methods and Results: Two hundred and thirty‐five samples from 145 clinically suspected cases of tuberculosis were processed for the detection of Mycobacterial infections by ZN (Ziehl Neelsen) smear examination, L‐J & BACTEC^TM MGIT‐960 culture and multiplex PCR tests. The multiplex PCR comprised of genus‐specific primers targeting hsp65 gene, Mycobacterium tuberculosis complex‐specific primer targeting cfp10 (Rv3875, esxB) region and Mycobacterium avium complex‐specific primer pairs targeting 16S–23S Internal Transcribed Spacer sequences. The multiplex PCR developed had an analytical sensitivity of 10 fg (3–4 cells) of mycobacterial DNA. The multiplex PCR test showed the highest (77·24%) detection rate, while ZN smear examination had the lowest (20%) detection rate, which was bettered by L‐J culture (34·4%) and BACTEC^TM MGIT‐960 culture (50·34%) methods. The mean isolation time for M. tuberculosis was 19·03 days in L‐J culture and 8·7 days in BACTEC^TM MGIT‐960 culture. Using the multiplex PCR, we could establish M. tuberculosis + M. avium co‐infection in 1·3% HIV‐negative and 2·9% HIV‐positive patients. The multiplex PCR was also highly useful in diagnosing mycobacteraemia in 38·09% HIV‐positive and 15·38% HIV‐negative cases. Conclusions: The developed in‐house multiplex PCR could identify and differentiate the M. tuberculosis and M. avium complexes from other Mycobacterial species directly from clinical specimens. Significance and Impact of the Study: The triplex PCR developed by us could be used to detect and differentiate M. tuberculosis, M. avium and other mycobacteria in a single reaction tube.     

The development and use of Actiphage® to detect viable mycobacteria from bovine tuberculosis and Johne’s disease-infected animals

Here, we describe the development of a method that exploits bacteriophage D29 as a lysis agent for efficient DNA extraction from low numbers of mycobacterial cells. This method (Actiphage^®) used in combination with PCR achieved rapid and sensitive (LOD ≤ 10 cell ml⁻¹) detection and identification of viable, pathogenic mycobacteria in blood samples within 6 h. We demonstrate that mycobacteriophage D29 can be used to detect a range of mycobacteria from clinical blood samples including both Mycobacterium tuberculosis complex and Mycobacterium avium subsp. paratuberculosis without the need for culture and confirms our earlier observations that a low-level bacteraemia is associated with these infections in cattle. In a study of M. bovis-infected cattle (n = 41), the sensitivity of the Actiphage^® method was 95 % (95 % CI; 0.84–0.99) and specificity was 100 % (95% CI; 0.92–1). We further used Actiphage^® to demonstrate viable Mycobacterium avium subsp. paratuberculosis is present in the blood of Johne’s infected cattle. This method provides a revolutionary new tool for the study of infections caused by these difficult to grow pathogens.     

A rapid and simple chemiluminescence method for screening levels of inosine and hypoxanthine in non‐traumatic chest pain patients

A rapid and simple chemiluminescence method was developed for detection of inosine and hypoxanthine in human plasma. The method utilized a microplate luminometer with direct injectors to automatically dispense reagents during sample analysis. Enzymatic conversions of inosine to hypoxanthine, followed by hypoxanthine to xanthine to uric acid, generated superoxide anion radicals as a useful metabolic by‐product. The free radicals react with Pholasin^®, a sensitive photoprotein used for chemiluminescence detection, to produce measurable blue‐green light. The use of Pholasin^® and a chemiluminescence signal enhancer, Adjuvant‐K?, eliminated the need for plasma clean‐up steps prior to analysis. The method used 20 μL of heparinized plasma, with complete analysis of total hypoxanthine levels (inosine is metabolized to hypoxanthine using purine nucleoside phosphorylase) in approximately 3.7 min. The rapid chemiluminescence method demonstrated the capability of differentiating total hypoxanthine levels between healthy individuals, and patients presenting with non‐traumatic chest pain and potential acute cardiac ischemia. The results support the potential use of chemiluminescence methodology as a diagnostic tool to rapidly screen for elevated levels of inosine and hypoxanthine in human plasma, potential biomarkers of acute cardiac ischemia.Copyright ©2009 John Wiley & Sons, Ltd.     

Restriction fragment length polymorphisms of 16S rRNA genes in the differentiation of fast-growing mycobacterial species

Abstract DNA from several species of fast growing mycobacteria displayed a characteristic restriction fragment length polymorphism (RFLP) pattern when hybridizated to a Mycobacterium fortuitum 16S rRNA gene fragment. The resulting patterns were identical when comparing different strains belonging to the same species. The RFLP results were consistent with those obtained by DNA-DNA hybridization studies. Using this approach, we have been able to identify the number of copies for 16S rRNA genes in several fast-growing mycobacteria.     

Biodegradation of epoxyconazole and piraclostrobin fungicides by Klebsiella sp. from soil

Three bacterial strains have been isolated from soil in which soybean had been continuously cropped and treated with Opera^®, a fungicide containing epoxyconazole and pyraclostrobin. The three strains (1,805, 2,801 and 3,803), obtained from soil at 80–100 cm depth, were selected on medium containing 0.03% Opera^®. Morphological examination revealed that the strains were Gram-negative, and two of them (1,805 and 2,801) exhibited polymorphism. The growth profiles demonstrated that 1,805 and 3,803 were more efficient growing in the presence of Opera^® than 2,801. Maximum growth was reached between 24 and 48 h, however, 2,801 was not able to survive after this period. The total protein content produced by 1,805, 2,801 and 3,803 in liquid selective medium containing Opera^® were 111.0 ± 0.02, 80.0 ± 0.05 and 130.5 ± 0.07 μg/ml, respectively. According to its biochemical and molecular features, strain 1,805 was identified as Klebsiella sp. On the basis of the characteristics presented (facultative anaerobic nature, polymorphic character and capacity of growing in the presence of Opera^®) strain 1,805 seems to be able to degrade the epoxyconazole and pyraclostrobin.     

Effect of recombinant Rv1009 protein on promoting the growth of Mycobacterium tuberculosis

Aims: To determine whether resuscitation-promoting factor (RPF) from Mycobacterium tuberculosis can promote mycobacterial growth and shorten culture time. Method and Results: We cloned, expressed and purified an RPF from M. tuberculosis, Rv1009 protein and subsequently studied the biological activity of the recombinant Rv1009 (rRv1009) in liquid and on solid media. Our results indicate that the molecular weight of rRv1009 protein expressed in Escherichia coli BL21 was approximately 39 kDa. At picomolar and micromolar concentrations, rRv1009 protein could increase the optical density of freeze-dried Mycobacterium bovis BCG three to fivefold in Middlebrook 7H9 medium, stimulate the growth of viable mycobacteria on solid medium, and shorten positive growth detection time of a small number of M. tuberculosis in BACTEC 960 medium. Conclusions: The rRv1009 could promote proliferation of mycobacteria. It may be useful for culture of mycobacteria presented in clinical samples. Significance and Impact of the Study: rRv1009 protein can be used as a growth-promoting reagent of mycobacteria in the medium to shorten the time of culture.     

Rapid determination of benzo[a]pyrene by membrane enrichment coupled with solid‐phase constant‐wavelength synchronous fluorescence spectrometry

Normal methods for benzo[a]pyrene (BaP) determination, including gas chromatography–mass spectrometry and liquid chromatography with fluorescence detection, involve expensive instruments and complex separation and purification processes. Based on membrane enrichment, coupled with solid‐phase constant‐wavelength synchronous fluorescence spectrometry, a simple, fast, sensitive method was proposed for the determination of BaP in water samples. A Nylon membrane was used as the solid‐phase extraction material for enrichment. After enrichment, a constant‐wavelength synchronous fluorescence spectrum was scanned directly on the membrane‐concentrated BaP without elution. Spectral measurement and enrichment conditions were optimized. Under optimum conditions, when using 150 mL sample solutions, the relationship between fluorescence intensity and BaP concentrations in the 0.05–10.00 μg L^–1 range could be fitted by binomial function with an R² value of 0.9973. Limit of detection (LOD) was calculated to be 0.0137 μg L^–1. The volume of the sample solution was increased to 1000 mL to test if the method could be applied to determine lower BaP concentrations. A linear relationship still existed in the range 2.0–20.0 ng L^–1 BaP with an R² value of 0.9895, and a LOD of 2.4 ng L^–1. The method was also used to measure the BaP concentration in several natural water samples, and recoveries were in the 90–110% range with relative standard deviations (RSDs) in the 0.58–7.93% range. Copyright © 2016 John Wiley & Sons, Ltd.     

Binding of Leishmania spp with gold nanoparticles supported polyethylene glycol and its application for the sensitive detection of infectious photogenes in human plasma samples: A novel biosensor

The management of pathogen detection using a rapid and cost‐effective method presents a major challenge to the biological safety of the world. The field of pathogen detection is nascent and therefore, faces a dynamic set of challenges as the field evolves. Visceral leishmaniasis (VL), or kala‐azar is the most severe form of leishmaniasis. Delay to the accurate diagnosis and treatment is likely to lead to fatality. The reliable, fast and sensitive detection is closely linked to safe and effective treatment of Leishmania spp. Despite several routine and old method for sensitive and specificity detection of Leishmania spp, there is highly demand for developing modern and powerfully system. In this study a novel ultra‐sensitive DNA‐based biosensor was prepared for detection of Leishmania spp. For the first time, the specific and thiolated sequences of the Leishmania spp genome (5′‐SH‐[CH₂]₆ ATCTCGTAAGCAGATCGCTGTGTCAC‐3′) were recognized by electrochemical methods. Also, selectivity of the proposed bioassay was examined by three sequences that were mismatched in 1, 2, and 3 nucleotides. The linear range (10^?6 to 10^?21 M) and limit of detection (LLOQ = 1 ZM) obtained are remarkable in this study. Also, simple and cost‐effective construction of genosensors was another advantage of the proposal DNA‐based assay. The experimental results promise a fast and simple method in detection of kala‐azar patients with huge potential of the nanocomposite‐based probe for development of ideal biosensors.     

Differences in the Rapid Knockdown and Lethal Effects of Aerosol Formulations against German Cockroach (Blattaria, Blattellidae) Strains

ABSTRACT The knockdown and lethal efficacies of five aerosol formulations including Combat Speed^® (AIs: 0.1 % imiprothrin and 0.3% cyphenothrin), Raid Power^® (AIs: 1.0% pyrethrin and 0.2% permethrin), Home Keeper^®, (AIs: 0.2% tetramethrin and 0.3% permethrin), Super Killer^® (AIs: 0.32% tetramethrin and 0.08% bioresmethrin), and Perma Kill‐K^® (AIs: 0.3% dichlorvos and 0.1% tetramethrin) against five strains of the German cockroach, Blattella germanica (L.) were assessed. The results show that the mean value of KT₅₀ (5.4 sec.) of Combat Speed^® was 4.5 and 3.1‐folds lower than those of Perma Kill‐K^® and Home Keeper^®, respectively. The mean value of KT₉₀ (9.0 sec; slope = 10.02) of Combat Speed^® was 3.8 to 5.8‐folds lower than Perma Kill‐K^®, Supper Killer^® and Home Keeper^®. As lethal effects, the mean value of LT₅₀ (17.3 sec.) of Combat Speed^® was over 26 folds lower than Supper Killer^® and Perma Kill‐K^®. The mean value of LT₉₀ (32.9 sec.) of Combat Speed^® was 37.4 and 15.1‐folds lower than those of Supper Killer^® and Perma Kill‐K^®, respectively. In general, Combat Speed^® and Raid Power^® were considered the insecticide aerosols with faster knockdown and higher lethal effects than Supper Killer^®, Perma Kill‐K^®, and Home Keeper^® against five strains of German cockroaches in Korea. Also, the knockdown and lethal effects of Supper Killer^®, Perma Kill‐K^®, and Home Keeper^® were highly variable depends on the strains.     

Development of a loop-mediated isothermal amplification (LAMP) method for specific detection of Mycobacterium bovis

Bovine tuberculosis (TB) caused by Mycobacterium bovis is a significant health threat to cattle and a zoonotic threat for humans in many developing countries. Rapid and accurate detection of M. bovis is fundamental for controlling the disease in animals and humans, and for the proper treatment of patients as one of the first-line anti-TB drug, pyrazinamide, is ineffective against M. bovis. Currently, there are no rapid, simplified and low-cost diagnostic methods that can be easily integrated for use in many developing countries. Here, we report the development of a loop-mediated isothermal amplification (LAMP) assay for specific identification of M. bovis by targeting the region of difference 4 (RD4), a 12.7 kb genomic region that is deleted solely in M. bovis. The assay''s specificity was evaluated using 139 isolates comprising 65 M. bovis isolates, 40 M. tuberculosis isolates, seven M. tuberculosis complex reference strains, 22 non-tuberculous mycobacteria and five other bacteria. The established LAMP detected only M. bovis isolates as positive and no false positives were observed using the other mycobacteria and non-mycobacteria tested. Our LAMP assay detected as low as 10 copies of M. bovis genomic DNA within 40 minutes. The procedure of LAMP is simple with an incubation at a constant temperature. Results are observed with the naked eye by a color change, and there is no need for expensive equipment. The established LAMP can be used for the detection of M. bovis infections in cattle and humans in resource-limited areas.     

Evaluation of lures and traps for male and female monitoring of Mediterranean fruit fly in pome and stone fruit

Commercial traps and lures have recently become available for monitoring male and female Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) in Australia, with possible applications in monitoring and mass trapping. This study investigated the attractiveness of commercially available male [Capilure^® (CPL), Trimedlure (TML) cone, plugs, and wafers] and female‐targeted synthetic lures (three‐component BioLure^®, BioLure^® Unipak, Ceratitis^® Unipak, TMA Plus^® Unipak and Biotrap^® gel), and five female‐targeted traps [Maxi^® trap, Sorygar Tephri‐trap, Probodelt^® cone trap, and BioTrap Globe^® traps (two versions)]. Results showed that TML and CPL lures were equivalent up to 8 weeks, but TML‐baited traps captured 1.2–4.6 times more male medflies than CPL‐baited traps with lures aged 9–16 weeks. For female‐targeted trapping, all tested lures were female selective. Ceratitis^® Unipak was equivalent to three‐component (3‐C) BioLure^®, whilst BioLure^® Unipak captured 1.1–1.5 times more medflies than 3‐C BioLure^®. The least efficient lures were TMA Plus^® Unipak and Biotrap Fruit Fly Attractant Gel. Tephri‐traps were the least efficient trap, with Maxi traps catching 1.9–6.7 times more medflies than the Tephri‐trap. The appropriate selection of lures and traps for applications in monitoring and mass trapping are discussed.     

Sensitive and selective detection of mycoplasma in cell culture samples using cantilever sensors

In this article we report a new biosensor‐based method that is more sensitive and rapid than the current approach for detecting mycoplasma in cell culture samples. Piezoelectric‐excited millimeter‐sized cantilever (PEMC) sensors respond to mass change via resonant frequency change. They are sensitive at femtogram level and can be used directly in liquid for label‐free detection. Common cell culture contaminant, Acholeplasma laidlawii was detected in both buffer and cell culture medium. Two different sources (positive control from a commercial kit and ATCC 23206) were analyzed using antibody‐immobilized PEMC sensor. Resonant frequency decrease caused by binding of A. laidlawii was monitored in real‐time using an impedance analyzer. Positive detection was confirmed by a second antibody binding. The limit of detection (LOD) was lower than 10³ CFU/mL in cell culture medium using PEMC sensor while parallel ELISA assays showed LOD as 10⁷ CFU/mL. This study shows that PEMC sensor can be used for sensitive and rapid mycoplasma detection in cell culture samples. Biotechnol. Bioeng. 2010;105: 1069–1077. © 2009 Wiley Periodicals, Inc.     

A comparison of barley isolated microspore and anther culture and the influence of cell culture density

Comparisons were made between the efficiency of barley plant regeneration from anther culture (AC) and isolated microspore culture (IMC) for the European winter cultivar `Igri' and the spring F<sub>1</sub> Australian breeder's hybrid Amagi Nijo×WI2585. In both cases, IMC produced a higher number of green regenerant plantlets per anther than AC. For `Igri' there was a 100- to 200-fold improvement and for Amagi Nijo×WI2585 there was a five- to ninefold improvement of IMC over AC. To improve the consistency and reliability of the IMC method, we investigated several parameters, including maltose concentration, subculture protocol, microspore plating density and colony plating density. Subculturing during the liquid culture phase produced no significant improvement in the number of microspores developing into colonies. The optimal concentration of maltose in the liquid induction medium was found to be 90 g l^–1. Both microspore plating density and colony plating density were found to influence plant regeneration. Microspores produced the highest numbers of colonies when plated at densities greater than 5×10⁴ ml^–1, and colonies produced optimal numbers of green plantlets when plated at 12.5–25 colonies/cm². Received: 23 March 1997 / Revision received: 29 May 1997 / Accepted: 25 June 1997