Conformational features of a natural break in the type IV collagen Gly-X-Y repeat

Fibrillar collagens have an absolute requirement for Gly as every 3rd residue, whereas breaks in the Gly-X-Y repeating pattern are found normally in the triple helix domains of non-fibrillar collagens, such as type IV collagen in basement membranes. In this study, a model 30-mer peptide is designed to include the interruption GPOGAAVMGPOGPO found in the alpha5 chain of type IV collagen. The GAAVM peptide forms a stable triple helix, with Tm= 29 degrees C. When compared with a control peptide with Gly as every 3rd residue, the GAAVM peptide has a marked decrease in the 225 nm maximum of its CD spectrum and a 10 degrees C drop in stability. A 50% decrease in calorimetric enthalpy is observed, which may result from disruption of ordered water structure anchored by regularly placed backbone carbonyls. NMR studies on specific 15N-labeled residues within the GAAVM peptide indicate a normal triple helical structure for Gly-Pro-Hyp residues flanking the break. The sequence within the break is not disordered but shows altered hydrogen exchange rates and an abnormal Val chemical shift. It was previously reported that a peptide designed to model a similar kind of interruption in the peptide (Pro-Hyp-Gly)10, (GPOGPOPOGPO), is unable to form a stable triple helix, and replacement of GAA by GPO or VM by PO within the GAAVM break decreases the stability. Thus, rigid imino acids are unfavorable within a break, despite their favorable stabilization of the triple helix itself. These results suggest some non-random structure typical of this category of breaks in the Gly-X-Y repeat of the triple helix.     

Expression analysis of the novel gene collagen triple helix repeat containing-1 (Cthrc1)

We recently identified collagen triple helix repeat containing-1 (Cthrc1) as a novel gene induced in adventitial fibroblasts after arterial injury. Cthrc1 is a 30 kDa secreted protein that has the ability to inhibit collagen matrix synthesis. Cthrc1 is also glycosylated and retains a signal sequence consistent with the presence of Cthrc1 in the extracellular space. In injured arteries and skin wounds, we have found Cthrc1 expression to be associated with myofibroblasts and sites of collagen matrix deposition. Furthermore, we demonstrated that Cthrc1 inhibits collagen matrix deposition in vitro. Using in situ hybridization and immunohistochemistry, we characterized the expression domains of Cthrc1 during murine embryonic development and in postnatal tissues. In mouse embryos, Cthrc1 was expressed in the visceral endoderm, notochord, neural tube, developing kidney, and heart. Abundant expression of Cthrc1 was observed in the developing skeleton, i.e., in cartilage primordia, in growth plate cartilage with exclusion of the hypertrophic zone, in the bone matrix and periostium. Bones from adults showed expression of Cthrc1 only in the bone matrix and periostium while the articular cartilage lacked expression. Cthrc1 is typically expressed at epithelial-mesenchymal interfaces that include the epidermis and dermis, basal corneal epithelium, airway epithelium, esophagus epithelium, choroid plexus epithelium, and meninges. In the adult kidney, collecting ducts and distal tubuli expressed Cthrc1. Collectively, the sites of Cthrc1 expression overlap considerably with those reported for TGF-beta family members and interstitial collagens. The present study provides useful information towards the understanding of potential Cthrc1 functions.     

A disease-associated glycine substitution in BP180 (type XVII collagen) leads to a local destabilization of the major collagen triple helix.

BP180 is a homotrimeric transmembrane protein with a carboxy-terminal ectodomain that forms an interrupted collagen triple helix. Null type mutations in the BP180 gene produce a recessive subepidermal blistering disease, non-Herlitz junctional epidermolysis bullosa. Like the null mutations, a glycine substitution (G627V) within the longest BP180 collagenous domain (COL15) is also associated with the recessive skin disease; however, unlike the null mutations, this glycine substitution appears to act in a dominant fashion to give rise to a novel form of random pitting dental enamel hypoplasia. The dominant effects of this mutation were thought to be due to alterations in the assembly and/or stability of this BP180 collagenous region. To further investigate this issue, a structural analysis was performed on recombinant forms of the wild type and G627V mutant BP180 ectodomain. Both proteins were found to form collagen-like triple helices with very similar Stokes radii and melting temperatures and exhibited very similar rates of synthesis, secretion and turn-over. Tryptic digestion analysis revealed that the mutant G627V-sec180e contains an additional highly sensitive proteolytic site that maps within the region of the mutation. Thus, the disease-associated G627V mutation in BP180 does not grossly alter protein structure, but causes a local destabilization of the triple-helix that exposes sensitive residues to the in vitro effects of trypsin and possibly affects its structure-function in vivo.     

Proton magnetic resonance of the triple helix of poly(prolylprolylglycyl)n with defined degree of polymerization

Proton magnetic resonance spectra at 220 MHz were obtained for deuterium oxide and aqueous solutions of the polytripeptides (Pro-Pro-Gly)_n, which were synthesized as collagen models by the modified solid phase method. At higher temperatures, the signals of the proline C_a-protons for the peptides with n ≦ 5 and for those with n = 10 and 15 demonstrate the presence of cis and trans isomers with respect to the Gly-Pro or Pro-Pro C-N bonds. Glycine C_a-protons give typical AB type patterns. At lower temperatures, as the peptides with n = 5, 10 and 15 form triple helices, all of the resonance peaks become broad, but the whole form of the spectrum is quite similar to that of poly(l-proline) form II. The glycine C_a-proton resonances become barely detectable and the upfield peak of the two proline C_a-proton resonances fade away. At the same time, a new glycine NH resonance appears at a field slightly higher than that of a random coil. It seems to suggest that the formation of triple helices accompanies the conversion of cis proline peptide bonds into all trans bonds, and that the glycine residue environment completely changes in the helix.     

Specific interactions of divalent metal ions with a DNA duplex containing the d(CA)n/(GT)n tandem repeat

Divalent metal ions are essential for maintaining functional states of the DNA molecule. Their participation in DNA structure is modulated by the base sequence and varies depending on the nature of the ion. The present investigation addresses the interaction of Ca2+ ions with a tandem repeat of two CA dinucleotides, (CA)2/(TG)2. The binding of Ca2+ to the repeat is monitored by nuclear magnetic resonance (NMR) spectroscopy using chemical shift mapping. Parallel experiments monitor binding of Mg2+ ions to the repeat as well as binding of each ion to a DNA duplex in which the (CA)2/(TG)2 repeat is eliminated. The results reveal that the direction and the magnitude of chemical shift changes induced by Ca2+ ions in the NMR spectra of the repeat are different from those induced by Mg2+ ions. The differences between the two cations are significantly diminished by the elimination of the (CA)2/(TG)2 repeat. These findings suggest a specific interaction of Ca2+ ions with the (CA)2/(TG)2 motif. The specificity of the interaction resides in the two A-T base pairs of the repeat, and it involves the major groove of the first A-T base pair and both grooves of the second A-T base pair.     

Hydroxylation-induced stabilization of the collagen triple helix. Acetyl-(glycyl-4(R)-hydroxyprolyl-4(R)-hydroxyprolyl)(10)-NH(2) forms a highly stable triple helix

The collagen triple helix is one of the most abundant protein motifs in animals. The structural motif of collagen is the triple helix formed by the repeated sequence of -Gly-Xaa-Yaa-. Previous reports showed that H-(Pro-4(R)Hyp-Gly)(10)-OH (where '4(R)Hyp' is (2S,4R)-4-hydroxyproline) forms a trimeric structure, whereas H-(4(R)Hyp-Pro-Gly)(10)-OH does not form a triple helix. Compared with H-(Pro-Pro-Gly)(10)-OH, the melting temperature of H-(Pro-4(R)Hyp-Gly)(10)-OH is higher, suggesting that 4(R)Hyp in the Yaa position has a stabilizing effect. The inability of triple helix formation of H-(4(R)Hyp-Pro-Gly)(10)-OH has been explained by a stereoelectronic effect, but the details are unknown. In this study, we synthesized a peptide that contains 4(R)Hyp in both the Xaa and the Yaa positions, that is, Ac-(Gly-4(R)Hyp-4(R)Hyp)(10)-NH(2) and compared it to Ac-(Gly-Pro-4(R)Hyp)(10)-NH(2), and Ac-(Gly-4(R)Hyp-Pro)(10)-NH(2). Ac-(Gly-4(R)Hyp-4(R)Hyp)(10)-NH(2) showed a polyproline II-like circular dichroic spectrum in water. The thermal transition temperatures measured by circular dichroism and differential scanning calorimetry were slightly higher than the values measured for Ac-(Gly-Pro-4(R)Hyp)(10)-NH(2) under the same conditions. For Ac-(Gly-4(R)Hyp-4(R)Hyp)(10)-NH(2), the calorimetric and the van't Hoff transition enthalpy DeltaH were significantly smaller than that of Ac-(Gly-Pro-4(R)Hyp)(10)-NH(2). We postulate that the denatured states of the two peptides are significantly different, with Ac-(Gly-4(R)Hyp-4(R)Hyp)(10)-NH(2) forming a more polyproline II-like structure instead of a random coil. Two-dimensional nuclear Overhauser effect spectroscopy suggests that the triple helical structure of Ac-(Gly-4(R)Hyp-4(R)Hyp)(10)-NH(2) is more flexible than that of Ac-(Gly-Pro-4(R)Hyp)(10)-NH(2). This is confirmed by the kinetics of amide (1)H exchange with solvent deuterium of Ac-(Gly-4(R)Hyp-4(R)Hyp)(10)-NH(2), which is faster than that of Ac-(Gly-Pro-4(R)Hyp)(10)-NH(2). The higher transition temperature of Ac-(Gly-4(R)Hyp-4(R)Hyp)(10)-NH(2), can be explained by the higher trans/cis ratio of the Gly-4(R)Hyp peptide bonds than that of the Gly-Pro bonds, and this ratio compensates for the weaker interchain hydrogen bonds.     

The formation of the triple helix in a mixed solution of (Pro-Pro-Gly)n and (Pro-Pro-Gly)n'. A model of molecular size recognition

A theoretical analysis is given of the triple-helix–random-coil transition in a mixed solution of poly(Pro-Pro-Gly)_n with two different but defined degrees of polymerization n and n′. Because of the highly cooperative nature of this helix–coil transition, each polypeptide chain tends to form a triple helix with other polypeptide chains with the same degree of polymerization (size recognition). Occurrence of triple helices consisting of polypeptide chains with different degrees of polymerization (error in recognition) is studied in detail as a function of the cooperativity, and n and n′. Implication of this analysis for molecular recognition in general is discussed.     

Structure of d(T)n.d(A)n.d(T)n: the DNA triple helix has B-form geometry with C2'-endo sugar pucker.

The polynucleotide helix d(T)n.d(A)n.d(T)n is the only deoxypolynucleotide triple helix for which a structure has been published, and it is generally assumed as the structural basis for studies of DNA triplexes. The helix has been assigned to an A-form conformation with C3'-endo sugar pucker by Arnott and Selsing [1974; cf. Arnott et al. (1976)]. We show here by infrared spectroscopy in D2O solution that the helix is instead B-form and that the sugar pucker is in the C2'-endo region. Distamycin A, which binds only to B-form and not to A-form helices, binds to the triple helix without displacement of the third strand, as demonstrated by CD spectroscopy and gel electrophoresis. Molecular modeling shows that a stereochemically satisfactory structure can be build using C2'-endo sugars and a displacement of the Watson-Crick base-pair center from the helix axis of 2.5 A. Helical constraints of rise per residue (h = 3.26 A) and residues per turn (n = 12) were taken from fiber diffraction experiments of Arnott and Selsing (1974). The conformational torsion angles are in the standard B-form range, and there are no short contacts. In contrast, we were unable to construct a stereochemically allowed model with A-form geometry and C3'-endo sugars. Arnott et al. (1976) observed that their model had short contacts (e.g., 2.3 A between the phosphate-dependent oxygen on the A strand and O2 in the Hoogsteen-paired thymine strand) which are generally known to be outside the allowed range.(ABSTRACT TRUNCATED AT 250 WORDS)     

Internal dynamics in a DNA triple helix probed by (1)H-(15)N-NMR spectroscopy

The amino group of adenine plays a key role in maintaining DNA triple helical structures, being the only functional group in DNA that is involved in both Watson-Crick and Hoogsteen hydrogen bonds. In the present work we have probed the internal dynamics of the adenine amino group in the intramolecular YRY triple helix formed by the 31-mer DNA oligonucleotide d(AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT). The DNA triple helix was specifically labeled with (15)N at the amino group of the adenine in the fifth position. The rotation rate of the labeled amino group was measured as a function of temperature using (1)H-(15)N heteronuclear NMR spectroscopy. The results indicate that, in the DNA triple helix, the rotation of the adenine amino group is greatly slowed relative to that in a DNA double helix. The temperature dependence of the rotation rate suggests a large entropic contribution to this effect, which may originate from different hydration patterns of the adenine amino group in the two structures.     

Substitutions for glycine alpha 1-637 and glycine alpha 2-694 of type I procollagen in lethal osteogenesis imperfecta. The conformational strain on the triple helix introduced by a glycine substitution can be transmitted along the helix

Two substitutions for glycine in the triple-helical domain were found in type I procollagen synthesized by skin fibroblasts from two probands with lethal osteogenesis imperfecta. One was a substitution of valine for glycine alpha 1-637, and the other was a substitution of arginine for glycine alpha 2-694. The effects of the mutations on the zipper-like folding of the collagen triple helix were similar, since there was post-translational overmodification of the collagenase A fragments (amino acids 1-775) but not of more COOH-terminal fragments of the protein. The mutations differed markedly, however, on their effects on thermal unfolding of the triple helix. The collagenase A fragment from the collagen containing the arginine alpha 2-694 substitution was cleaved at about amino acid 700 when incubated with trypsin at 30-35 degrees C. Therefore, there was micro-unfolding of the triple helix at a site close to the glycine substitution. Surprisingly, however, the collagenase A fragment with the valine alpha 1-637 substitution was also cleaved at about amino acid 700 under the same conditions. The results, therefore, demonstrated that although most glycine substitutions delay folding of the triple helix in regions that are NH2-terminal to the site of the substitution, the effects on unfolding can be transmitted to regions that are COOH-terminal to the site of the glycine substitution.     

Role of proline …︁ proline interactions in the packing of collagenlike poly(tripeptide) triple helices

Conformational energy computations were carried out on the packing of two identical collagenlike poly(tripeptide) triple helices in order to determine the energetics of favorable packing arrangements as a function of composition and chain length. The triple helices considered were [CH₃CO-(Gly-Pro-Pro)_nt-NHCH₃]₃ and [CH₃CO-(Gly-Pro-Ala)_nt-NHCH₃]₃, with n_t = 3, 4, and 5. The packing arrangements were characterized in terms of their intermolecular energies and orientation angles Ω₀ of the axes of the two triple helices. For short triple helices (n_t = 3 or 4), many low-energy orientations, with a wide range of values of Ω₀, can occur. When the triple helices are longer (n_t = 5), the only low-energy packing arrangements of two poly(Gly-Pro-Pro) triple helices are those with a nearly parallel orientation of the two helix axes, with Ω₀ ≈ ?10°. This result accounts for the observed parallel (rather than antiparallel) arrangement of collagen molecules in microfibril assembly and stands in contrast to the preferred antiparallel arrangement of a pair of α-helices. Since the preference for a parallel arrangement of these collagenlike triple helices is less pronounced in the case of poly(Gly-Pro-Ala), it appears that this preference is a consequence of the frequent presence of imino acids in position Y of the Gly-X-Y repeating triplet. In poly(Gly-Pro-Ala), most of the low-energy packing arrangements are parallel, but a few arrangements with low energies and high values of |Ω₀| occur. These packing arrangements have a high energy, however, when Pro is substituted for Ala, and thus they are not accessible for collagen with natural amino (imino) acid sequences. The computations reported here account for some of the characteristic features of collagen packing in terms of the local interaction energies of a pair of triple helices.     

Interactions between poly(Gly-Pro-Pro) triple helices: a model for molecular packing in collagen

Potential-energy calculations are reported on the interaction between two collagenlike triple-stranded poly(Gly-L-Pro-L-Pro) helices. Short helices can pack in a variety of orientations, but there is a unique parallel packing arrangement of the two helices for longer polypeptide chains.     

(AT)n is an interspersed repeat in the Xenopus genome.

We have observed (AT)34 and (AT)23 tracts close to the coding sequences of the Xenopus laevis tadpole alpha T1 and adult beta 1 globin genes, respectively. We show that (AT)n sequences are found as interspersed repeats within the Xenopus globin and histone gene loci. Using (AT)n co-polymer in filter hybridisation experiments we estimate that there are 10(4) (AT)n tracts per haploid Xenopus genome. Hybridisation to genomic blots of DNA from yeast, slime mold, trypanosome, fruit fly, salmon, chicken, rat, human, crab and Xenopus species shows that strictly alternating AT of sufficient length to hybridise appears to be most abundant in Xenopus and crab genomes. We show that the specificity of the co-polymer probe for strictly alternating AT is, however, dependent on the length of the probe. Hybridisation experiments using (TG)n copolymer suggest that this highly conserved repeat is found as clustered repeats in the Xenopus genome in contrast to other eukaryotic genomes so far studied.     

Somatic expansion of the (CAG) n repeat in Huntington disease brains

The mutation causing Huntington disease (HD) has been identified as an expansion of a polymorphic (CAG) _n repeat in the 5 part of the huntingtin gene. The specific neuropathology of HD, viz. selective neuronal loss in the caudate nucleus and putamen, cannot be explained by the widespread expression of the gene. Since somatic expansion is observed in affected tissue in myotonic dystrophy, we have studied the length of the (CAG) _n repeat in various regions of the brain. Although we have not found clear differences when comparing severely and mildly affected regions, we have observed a minor increase in repeat length upon comparison of affected brain samples with cerebellum or peripheral blood. Hence, although further somatic amplification seems to occur in affected areas of the brain, the differences between affected and unaffected regions are too small to make this mechanism an obvious candidate for the cause of differential neuronal degeneration in HD.     

The triple helix ⇌ coil conversion of collagen-like polytripeptides in aqueous and nonaqueous solvents. Comparison of the thermodynamic parameters and the binding of water to (L-Pro-L-Pro-Gly)n and (L-Pro-L-Hyp-Gly)n

The collagen-like peptides (L -Pro-L -Pro-Gly)_n and (L -Pro-L -Hyp-Gly)_n with n = 5 and 10, were examined in terms of their triple helix ? coil transitions in aqueous and nonaqueous solvents. The peptides were soluble in 1,2-propanediol containing 3% acetic acid and they were found to form triple-helical structures in this solvent system. The water content of the solvent system and the amount of water bound to the peptides were assayed by equilibrating the solvent with molecular sieves and carrying out Karl Fischer titrations on the solvent phase. After the solvent was dehydrated, much less than one molecule of water per tripeptide unit was bound to the peptides. Since the peptides remained in a triple-helical conformation, the results indicated that water was not an essential component of the triple-helical structure. Comparison of peptides with the same chain length demonstrated that the presence of hydroxyproline increased the thermal stability of the triple helix even under anhydrous conditions. The results, therefore, did not support recent hypotheses that hydroxyproline stabilizes the triple helix of collagen and collagen-like peptides by a specific interaction with water molecules. Analysis of the thermal transition curves in several solvent systems showed that although the peptides containing hydroxyproline had t_m values which were 18.6° to 32.7°C higher, the effect of hydroxyproline on ΔG was only 0.1 to 0.3 kcal per tripeptide unit at 25°C. The results suggested, therefore, that the influence of hydroxyproline on helical stability may be explained by intrinsic effects such as dipole–dipole interactions or by changes in the solvation of the peptides by alcohol, acetic acid, and water. A direct calorimetric measurement of the transition enthalpy for (L -Pro-L -Pro-Gly)_n in 3% or 10% acetic acid gave a value of ?1.84 kcal per tripeptide unit for the coil-to-helix transition. From the value for enthalpy and from data on the effects of different chain lengths on the thermal transition, it was calculated that the apparent free energy for nucleation was +5 kcal/mol at 25°C (apparent nucleation parameter = 2 × 10^?4 M^?2). The value was dependent on solvent and on chemical modification of end groups.     

The effects of different cysteine for glycine substitutions within alpha 2(I) chains. Evidence of distinct structural domains within the type I collagen triple helix

Affected individuals from two apparently distinct, mild osteogenesis imperfecta families were heterozygous for a G to T transition in the COL1A2 gene that resulted in cysteine for glycine substitutions at position 646 in the alpha 2(I) chain of type I collagen. A child with a moderately severe form of osteogenesis imperfecta was heterozygous for a G to T transition that resulted in a substitution of cysteine for glycine at position 259 in the COL1A2 gene. Type I collagen molecules containing an alpha 2(I) chain with cysteine at position 259 denaturated at a lower temperature than molecules containing an alpha 2(I) chain with cysteine at position 646. In contrast to cysteine for glycine substitutions in the alpha 1(I) chain, the severity of the osteogenesis imperfecta phenotype is not directly proportional to the distance of the mutation from the amino-terminal end of the triple helix. These findings could be explained if the type I collagen triple helix contains discontinuous domains that differ in their contributions to maintaining helix stability.     

Low variability of the POLG (CAG)n repeat in north Eurasian populations

We investigated the frequency of different repeat-length alleles of the trinucleotide CAG microsatellite repeat in the coding sequence of the nuclear gene for the catalytic subunit of mitochondrial DNA polymerase gamma (POLG) in 12 ethnic groups from northern Eurasia. The population sample consisted of 1,330 individuals from 3 large geographic areas: Europe, Southwest Asia, and Siberia/East Asia. We found that the 10-repeat allele of the POLG gene is the most frequent in all analyzed populations, with a frequency of 88-96%. The heterozygosity level ranges from 22% in Europe to 13.6% in Southwest Asia with the lowest value of 7.4% in Siberia/East Asia. The present study provides evidence of clinal distribution of POLG gene heterozygosity in North Eurasian populations. In general, we found an extremely low variability of the trinucleotide CAG microsatellite repeat, suggesting that purifying selection acts against deleterious alleles, although low mutability of the repeated region cannot be ruled out.