首页 | 本学科首页   官方微博 | 高级检索  
相似文献
 共查询到20条相似文献,搜索用时 381 毫秒
1.
Prions are responsible for a heterogeneous group of fatal neurodegenerative diseases. They can be sporadic, genetic, or infectious disorders involving post-translational modifications of the cellular prion protein (PrPC). Prions (PrPSc) are characterized by their infectious property and intrinsic ability to convert the physiological PrPC into the pathological form, acting as a template. The “protein-only” hypothesis, postulated by Stanley B. Prusiner, implies the possibility to generate de novo prions in vivo and in vitro. Here we describe major milestones towards proving this hypothesis, taking into account physiological environment/s, biochemical properties and interactors of the PrPC.Key words: prion protein (PrP), prions, amyloid, recombinant prion protein, transgenic mouse, protein misfolding cyclic amplification (PMCA), synthethic prionPrions are responsible for a heterogeneous group of fatal neurodegenerative diseases (1 They can be sporadic, genetic or infectious disorders involving post-translational modifications of the cellular prion protein (PrPC).2 Prions are characterized by their infectious properties and by their intrinsic ability to encipher distinct biochemical properties through their secondary, tertiary and quaternary protein structures. In particular, the transmission of the disease is due to the ability of a prion to convert the physiological PrPC into the pathological form (PrPSc), acting as a template.3 The two isoforms of PrP appear to be different in terms of protein structures, as revealed by optical spectroscopy experiments such as Fourier-transform infrared and circular dichroism.4 PrPC contains 40% α-helix and 3% β-sheet, while the pathological isoform, PrPSc, presents approximately 30% α-helix and 45% β-sheet.4,5 PrPSc differs from PrPC because of its altered physical-chemical properties such as insolubility in non-denaturing detergents and proteinases resistance.2,6,7

Table 1

The prion diseases
Prion diseaseHostMechanism
iCJDhumansinfection
vCJDhumansinfection
fCJDhumansgenetic: octarepeat insertion, D178N-129V, V180I, T183A, T188K, T188R-129V, E196K, E200K, V203I, R208H, V210I, E211Q, M232R
sCJDhumans?
GSShumansgenetic: octarepeat insertion, P102L-129M, P105-129M, A117V-129V, G131V-129M, Y145*-129M, H197R-129V, F198S-129V, D202N-129V, Q212P, Q217R-129M, M232T
FFIhumansgenetic: D178-129M
Kurufore peopleinfection
sFIhumans?
Scrapiesheepinfection
BSEcattleinfection
TMEminkinfection
CWDmule deer, elkcontaminated soils?
FSEcatsinfection
Exotic ungulate encephalopathygreater kudu, nyala, oryxinfection
Open in a separate windowi, infective form; v, variant; f, familial; s, sporadic; CJD, Creutzfeldt-Jakob disease; GSS, Gerstmann-Straüssler-Sheinker disease; FFI, fatal familial insomnia; sFI, sporadic fatal insomnia; BSE, bovine spongiform encephalopathy; TME, transmissible mink encephalopathy; CWD, chronic wasting disease; FSE, feline spongiform encephalopathy.73,78The prion conversion occurring in prion diseases seems to involve only conformational changes instead of covalent modifications. However, Mehlhorn et al. demonstrated the importance of a disulfide bond between the two cysteine residues at position 179 and 214 (human (Hu) PrP numbering) to preserve PrP into its physiological form. In the presence of reducing conditions and pH higher than 7, recombinant (rec) PrP tends to assume high β-sheet content and relatively low solubility like PrPSc.8  相似文献   

2.
3.
4.
Escherichia coli isolates (72 commensal and 10 O157:H7 isolates) were compared with regard to physiological and growth parameters related to their ability to survive and persist in the gastrointestinal tract and found to be similar. We propose that nonhuman hosts in E. coli O157:H7 strains function similarly to other E. coli strains in regard to attributes relevant to gastrointestinal colonization.Escherichia coli is well known for its ecological versatility (15). A life cycle which includes both gastrointestinal and environmental stages has been stressed by both Savageau (15) and Adamowicz et al. (1). The gastrointestinal stage would be subjected to acid and detergent stress. The environmental stage is implicit in E. coli having transport systems for fungal siderophores (4) as well as pyrroloquinoline quinone-dependent periplasmic glucose utilization (1) because their presence indicates evolution in a location containing fungal siderophores and pyrroloquinoline quinone (1).Since its recognition as a food-borne pathogen, there have been numerous outbreaks of food-borne infection due to E. coli O157:H7, in both ground beef and vegetable crops (6, 13). Cattle are widely considered to be the primary reservoir of E. coli O157:H7 (14), but E. coli O157:H7 does not appear to cause disease in cattle. To what extent is E. coli O157:H7 physiologically unique compared to the other naturally occurring E. coli strains? We feel that the uniqueness of E. coli O157:H7 should be evaluated against a backdrop of other wild-type E. coli strains, and in this regard, we chose the 72-strain ECOR reference collection originally described by Ochman and Selander (10). These strains were chosen from a collection of 2,600 E. coli isolates to provide diversity with regard to host species, geographical distribution, and electromorph profiles at 11 enzyme loci (10).In our study we compared the 72 strains of the ECOR collection against 10 strains of E. coli O157:H7 and six strains of E. coli which had been in laboratory use for many years (Table (Table1).1). The in vitro comparisons were made with regard to factors potentially relevant to the bacteria''s ability to colonize animal guts, i.e., acid tolerance, detergent tolerance, and the presence of the Entner-Doudoroff (ED) pathway (Table (Table2).2). Our longstanding interest in the ED pathway (11) derives in part from work by Paul Cohen''s group (16, 17) showing that the ED pathway is important for E. coli colonization of the mouse large intestine. Growth was assessed by replica plating 88 strains of E. coli under 40 conditions (Table (Table2).2). These included two LB controls (aerobic and anaerobic), 14 for detergent stress (sodium dodecyl sulfate [SDS], hexadecyltrimethylammonium bromide [CTAB], and benzalkonium chloride, both aerobic and anaerobic), 16 for acid stress (pH 6.5, 6.0, 5.0, 4.6, 4.3, 4.2, 4.1, and 4.0), four for the ability to grow in a defined minimal medium (M63 glucose salts with and without thiamine), and four for the presence or absence of a functional ED pathway (M63 with gluconate or glucuronate). All tests were done with duplicate plates in two or three separate trials. The data are available in Tables S1 to S14 in the supplemental material, and they are summarized in Table Table22.

TABLE 1.

E. coli strains used in this study
E. coli strain (n)Source
ECOR strains (72)Thomas Whittman
Laboratory adapted (6)
    K-12 DavisPaul Blum
    CG5C 4401Paul Blum
    K-12 StanfordPaul Blum
    W3110Paul Blum
    BTyler Kokjohn
    AB 1157Tyler Kokjohn
O157:H7 (10)
    FRIK 528Andrew Benson
    ATCC 43895Andrew Benson
    MC 1061Andrew Benson
    C536Tim Cebula
    C503Tim Cebula
    C535Tim Cebula
    ATCC 43889William Cray, Jr.
    ATCC 43890William Cray, Jr.
    ATCC 43888Willaim Cray, Jr.
    ATCC 43894William Cray, Jr.
Open in a separate window

TABLE 2.

Physiological comparison of 88 strains of Escherichia coli
Growth medium or conditionOxygencNo. of strains with type of growthb
ECOR strains (n = 72)
Laboratory strains (n = 6)
O157:H7 strains (n = 10)
GoodPoorNoneVariableGoodPoorNoneVariableGoodPoorNoneVariable
LB controlaBoth72000600010000
1% SDSAerobic6930060008002
5% SDSAerobic6840060008200
1% SDSAnaerobic53154023101702
5% SDSAnaerobic0684004200704
CTABd (all)Both00720006000100
0.05% BACAerobic31158202220091
0.2% BACAerobic01710105000100
0.05% BACAnaerobic2367001500091
0.2% BACAnaerobic00720006000100
pH 6.5Both72000600010000
pH 6Both72000600010000
pH 5Both7020060009001
pH 4.6Both70200600010000
pH 4.3Aerobic14015731203205
pH 4.3Anaerobic6930031201100
pH 4.1 or 4.2Aerobic00720NDgND
pH 4.0Both0072000600091
M63 with supplemente
    GlucoseAerobicf6912050109010
    GlucoseAnaerobicf7002050109010
    GluconateBoth6912050109010
    GlucuronateAerobic6822050109010
    GlucuronateAnaerobic6912050109010
Open in a separate windowaEight LB controls were run, two for each set of LB experiments: SDS, CTAB, benzalkonium chloride (BAC), and pH stress.bGrowth was measured as either +++, +, or 0 (good, poor, and none, respectively), with +++ being the growth achieved on the LB control plates. “Variable” means that two or three replicates did not agree. All experiments were done at 37°C.c“Anaerobic” refers to use of an Oxoid anaerobic chamber. Aerobic and anaerobic growth data are presented together when the results were identical and separately when the results were not the same or the anaerobic set had not been done. LB plates were measured after 1 (aerobic) or 2 (anaerobic) days, and the M63 plates were measured after 2 or 3 days.dCTAB used at 0.05, 0.2%, and 0.4%.eM63 defined medium (3) was supplemented with glucose, gluconate, or glucuronate, all at 0.2%.fIdentical results were obtained with and without 0.0001% thiamine.gND, not determined.  相似文献   

5.
6.
The effects of the challenge dose and major histocompatibility complex (MHC) class IB alleles were analyzed in 112 Mauritian cynomolgus monkeys vaccinated (n = 67) or not vaccinated (n = 45) with Tat and challenged with simian/human immunodeficiency virus (SHIV) 89.6Pcy243. In the controls, the challenge dose (10 to 20 50% monkey infectious doses [MID50]) or MHC did not affect susceptibility to infection, peak viral load, or acute CD4 T-cell loss, whereas in the chronic phase of infection, the H1 haplotype correlated with a high viral load (P = 0.0280) and CD4 loss (P = 0.0343). Vaccination reduced the rate of infection acquisition at 10 MID50 (P < 0.0001), and contained acute CD4 loss at 15 MID50 (P = 0.0099). Haplotypes H2 and H6 were correlated with increased susceptibility (P = 0.0199) and resistance (P = 0.0087) to infection, respectively. Vaccination also contained CD4 depletion (P = 0.0391) during chronic infection, independently of the challenge dose or haplotype.Advances in typing of the major histocompatibility complex (MHC) of Mauritian cynomolgus macaques (14, 20, 26) have provided the opportunity to address the influence of host factors on vaccine studies (13). Retrospective analysis of 22 macaques vaccinated with Tat or a Tat-expressing adenoviral vector revealed that monkeys with the H6 or H3 MHC class IB haplotype were overrepresented among aviremic or controller animals, whereas macaques with the H2 or H5 haplotype clustered in the noncontrollers (12). More recently, the H6 haplotype was reported to correlate with control of chronic infection with simian immunodeficiency virus (SIV) mac251, regardless of vaccination (18).Here, we performed a retrospective analysis of 112 Mauritian cynomolgus macaques, which included the 22 animals studied previously (12), to evaluate the impact of the challenge dose and class IB haplotype on the acquisition and severity of simian/human immunodeficiency virus (SHIV) 89.6Pcy243 infection in 45 control monkeys and 67 monkeys vaccinated with Tat from different protocols (Table (Table11).

TABLE 1.

Summary of treatment, challenge dose, and outcome of infection in cynomolgus monkeys
Protocol codeNo. of monkeysImmunogen (dose)aAdjuvantbSchedule of immunization (wk)RoutecChallenged (MID50)Virological outcomee
Reference(s) or source
ACV
ISS-ST6Tat (10)Alum or RIBI0, 2, 6, 12, 15, 21, 28, 32, 36s.c., i.m.104114, 17
ISS-ST1Tat (6)None0, 5, 12, 17, 22, 27, 32, 38, 42, 48i.d.101004, 17
ISS-PCV3pCV-tat (1 mg)Bupivacaine + methylparaben0, 2, 6, 11, 15, 21, 28, 32, 36i.m.103006
ISS-ID3Tat (6)none0, 4, 8, 12, 16, 20, 24, 28, 39, 43, 60i.d.10111B. Ensoli, unpublished data
ISS-TR6Tat (10)Alum-Iscom0, 2, 6, 11, 16, 21, 28, 32, 36s.c., i.d., i.m.10420Ensoli, unpublished
ISS-TGf3Tat (10)Alum0, 4, 12, 22s.c.1503Ensoli, unpublished
ISS-TG3Tatcys22 (10)Alum1503Ensoli, unpublished
ISS-TG4Tatcys22 (10) + Gag (60)Alum1504Ensoli, unpublished
ISS-TG4Tat (10) + Gag (60)Alum1504Ensoli, unpublished
ISS-MP3Tat (10)H1D-Alum0, 4, 12, 18, 21, 38s.c., i.m.15021Ensoli, unpublished
ISS-MP3Tat (10)Alums.c.15003Ensoli, unpublished
ISS-GS6Tat (10)H1D-Alum0, 4, 12, 18, 21, 36s.c., i.m.15132Ensoli, unpublished
NCI-Ad-tat/Tat7Ad-tat (5 × 108 PFU), Tat (10)Alum0, 12, 24, 36i.n., i.t., s.c.15232Ensoli, unpublished
NCI-Tat9Tat (6 and 10)Alum/Iscom0, 2, 6, 11, 15, 21, 28, 32, 36s.c., i.d., i.m.1524312
ISS-NPT3pCV-tat (1 mg)Bupivacaine + methylparaben-Iscom0, 2, 8, 13, 17, 22, 28, 46, 71i.m.20003Ensoli, unpublished
ISS-NPT3pCV-tatcys22 (1 mg)Bupivacaine + methylparaben-Iscom0, 2, 8, 13, 17, 22, 28, 46, 71i.m.20111
    Total vaccinated67191731
        Naive11NoneNoneNAgNA10 or 15137
        Control34None, Ad, or pCV-0Alum, RIBI, H1D, Iscom or bupivacaine + methylparaben-Iscoms.c., i.d., i.n., i.t., i.m.10, 15, or 2051316
    Total controls4561623
    Total112253354
Open in a separate windowaAll animals were inoculated with the indicated dose of Tat plasmid DNA (pCV-tat [8], adenovirus-tat [Ad-tat] [27]) or protein, Gag protein, or empty vectors (pCV-0, adenovirus [Ad]) by the indicated route. Doses are in micrograms unless indicated otherwise.bAlum, aluminum phosphate (4); RIBI oil-in-water emulsions containing squalene, bacterial monophosphoryl lipid A, and refined mycobacterial products (4); Iscom, immune-stimulating complex (4); H1D are biocompatible anionic polymeric microparticles used for vaccine delivery (10, 12, 25a).cs.c., subcutaneous; i.m., intramuscular; i.d., intradermal; i.n., intranasal; i.t., intratracheal.dAll animals were inoculated intravenously with the indicated dose of the same SHIV89.6.Pcy243 stock.eAccording to the virological outcome upon challenge, monkeys were grouped as aviremic (A), controllers (C), or viremic (V).fBecause of the short follow-up, controller status could not be determined and all infected monkeys of the ISS-TG protocol were therefore considered viremic.gNA, not applicable.  相似文献   

7.
Hepatitis C virus (HCV)-specific CD8+ T cells in persistent HCV infection are low in frequency and paradoxically show a phenotype associated with controlled infections, expressing the memory marker CD127. We addressed to what extent this phenotype is dependent on the presence of cognate antigen. We analyzed virus-specific responses in acute and chronic HCV infections and sequenced autologous virus. We show that CD127 expression is associated with decreased antigenic stimulation after either viral clearance or viral variation. Our data indicate that most CD8 T-cell responses in chronic HCV infection do not target the circulating virus and that the appearance of HCV-specific CD127+ T cells is driven by viral variation.Hepatitis C virus (HCV) persists in the majority of acutely infected individuals, potentially leading to chronic hepatitis, liver cirrhosis, and hepatocellular carcinoma. The cellular immune response has been shown to play a significant role in viral control and protection from liver disease. Phenotypic and functional studies of virus-specific T cells have attempted to define the determinants of a successful versus an unsuccessful T-cell response in viral infections (10). So far these studies have failed to identify consistent distinguishing features between a T-cell response that results in self-limiting versus chronic HCV infection; similarly, the impact of viral persistence on HCV-specific memory T-cell formation is poorly understood.Interleukin-7 (IL-7) receptor alpha chain (CD127) is a key molecule associated with the maintenance of memory T-cell populations. Expression of CD127 on CD8 T cells is typically only observed when the respective antigen is controlled and in the presence of significant CD4+ T-cell help (9). Accordingly, cells specific for persistent viruses (e.g., HIV, cytomegalovirus [CMV], and Epstein-Barr virus [EBV]) have been shown to express low levels of CD127 (6, 12, 14) and to be dependent on antigen restimulation for their maintenance. In contrast, T cells specific for acute resolving virus infections, such as influenza virus, respiratory syncytial virus (RSV), hepatitis B virus (HBV), and vaccinia virus typically acquire expression of CD127 rapidly with the control of viremia (5, 12, 14). Results for HCV have been inconclusive. The expected increase in CD127 levels in acute resolving but not acute persisting infection has been found, while a substantial proportion of cells with high CD127 expression have been observed in long-established chronic infection (2). We tried to reconcile these observations by studying both subjects with acute and chronic HCV infection and identified the presence of antigen as the determinant of CD127 expression.Using HLA-peptide multimers we analyzed CD8+ HCV-specific T-cell responses and CD127 expression levels in acute and chronic HCV infection. We assessed a cohort of 18 chronically infected subjects as well as 9 individuals with previously resolved infection. In addition, we longitudinally studied 9 acutely infected subjects (5 individuals who resolved infection spontaneously and 4 individuals who remain chronically infected) (Tables (Tables11 and and2).2). Informed consent in writing was obtained from each patient, and the study protocol conformed to the ethical guidelines of the 1975 Declaration of Helsinki, as reflected in a priori approval from the local institutional review boards. HLA-multimeric complexes were obtained commercially from Proimmune (Oxford, United Kingdom) and Beckman Coulter (CA). The staining and analysis procedure was as described previously (10). Peripheral blood mononuclear cells (PBMCs) were stained with the following antibodies: CD3 from Caltag; CD8, CD27, CCR7, CD127, and CD38 from BD Pharmingen; and PD-1 (kindly provided by Gordon Freeman). Primer sets were designed for different genotypes based on alignments of all available sequences from the public HCV database (http://hcvpub.ibcp.fr). Sequence analysis was performed as previously described (8).

TABLE 1.

Patient information and autologous sequence analysis for patients with chronic and resolved HCV infection
CodeGenotypeStatusEpitope(s) targetedSequencea
02-031bChronicA1 NS3 1436-1444P: ATDALMTGY
A: no sequence
00-261bChronicA1 NS3 1436-1444P: ATDALMTGY
A: no sequence
99-242aChronicA2 NS3 1073-1083P: CINGVCWTV
No recognitionA: S-S--L---
A2 NS3 1406-1415P: KLVALGINAV
No recognitionA: A-RGM-L---
A2 NS5B 2594-2602P: ALYDVVTKL
A: no sequence
1111aChronicA2 NS3 1073-1083P: CINGVCWTV
A: ---------
A2 NS5 2594-2602P: ALYDVVTKL
A: ---------
00X3aChronicA2 NS5 2594-2602P: ALYDVVTKL
No recognitionA: -----IQ--
O3Qb1aChronicA1 NS3 1436-1444P: ATDALMTGY
DiminishedA: --------F
03Sb1aChronicA1 NS3 1436-1444P: ATDALMTGY
DiminishedA: --------F
02A1aChronicA1 NS3 1436-1444P: ATDALMTGY
A: no sequence
01N1aChronicA1 NS3 1436-1444P: ATDALMTGY
DiminishedA: --------F
03H1aChronicA2 NS3 1073-1083P: CINGVCWTV
Full recognitionA: ----A----
01-391aChronicA1 NS3 1436-1444P: ATDALMTGY
DiminishedA: --------F
03-45b1aChronicA1 NS3 1436-1444P: ATDALMTGY
DiminishedA: --------F
06P3aChronicA1 NS3 1436-1444P: ATDALMTGY
DiminishedA: --------F
GS127-11aChronicA2 NS3 1073-1083P: CINGVCWTV
A: ---------
GS127-61aChronicA2 NS3 1073-1083P: CINGVCWTV
A: ---------
GS127-81bChronicA2 NS3 1073-1083P: CINGVCWTV
A: ---------
GS127-161aChronicA2 NS3 1073-1083P: CINGVCWTV
A: ---------
GS127-201aChronicA2 NS3 1073-1083P: CINGVCWTV
A: ---------
04D4ResolvedA2 NS5 1987-1996P: VLSDFKTWKL
01-49b1ResolvedA2 NS5 1987-1996P: VLSDFKTWKL
A2 NS3 1406-1415P: KLVALGINAV
01-311ResolvedA1 NS3 1436-1444P: ATDALMTGY
B57 NS5 2629-2637P: KSKKTPMGF
04N1ResolvedA1 NS3 1436-1444P: ATDALMTGY
01E4ResolvedA2 NS5 1987-1996P: VLSDFKTWKL
98A1ResolvedA2 NS3 1073-1083P: CINGVCWTV
00-10c1ResolvedA24 NS4 1745-1754P: VIAPAVQTNW
O2Z1ResolvedA1 NS3 1436-1444P: ATDALMTGY
99-211ResolvedB7 CORE 41-49P: GPRLGVRAT
OOR1ResolvedB35 NS3 1359-1367P: HPNIEEVAL
Open in a separate windowaP, prototype; A, autologous. Identical residues are shown by dashes.bHIV coinfection.cHBV coinfection.

TABLE 2.

Patient information and autologous sequence analysis for patients with acute HCV infection
CodeGenotypeOutcomeEpitope targeted and time analyzedSequencea
5541aPersistingA2 NS3 1073-1083P: CINGVCWTV
wk 8A: ---------
wk 30A: ---------
03-321aPersistingB35 NS3 1359-1367P: HPNIEEVAL
wk 8A: ---------
No recognition (wk 36)A: S--------
04-111a (1st)Persisting (1st) Resolving (2nd)A2 NS5 2594-2602P: ALYDVVTKL
1b (2nd)A: no sequence
00231bPersistingA1 NS3 1436-1444P: ATDALMTGY
Diminished (wk 7)A: --------F
Diminished (wk 38)A: --------F
A2 NS3 1073-1083P: CINGVCWTV
wk 7A: ---------
wk 38A: ---------
A2 NS3 1406-1415P: KLVALGINAV
Full recognition (wk 7)A: --S-------
Full recognition (wk 38)A: --S-------
3201ResolvingA2 NS3 1273-1282P: GIDPNIRTGV
5991ResolvingA2 NS3 1073-1083P: CINGVCWTV
11441ResolvingA2 NS3 1073-1083P: CINGVCWTV
B35 NS3 1359-1367P: HPNIEEVAL
06L3aResolvingB7 CORE 41-49P: GPRLGVRAT
05Y1ResolvingA2 NS3 1073-1083P: CINGVCWTV
Open in a separate windowaP, prototype; A, autologous. Identical residues are shown by dashes.In established persistent infection, CD8+ T-cell responses against HCV are infrequently detected in blood using major histocompatibility complex (MHC) class I tetramers and are only observed in a small fraction of those sampled (10). We were able to examine the expression of CD127 on antigen-specific T cells in such a group of 18 individuals. We observed mostly high levels of CD127 expression (median, 66%) on these populations (Fig. (Fig.1a),1a), although expression was higher on HCV-specific T-cell populations from individuals with resolved infection (median, 97%; P = 0.0003) (Fig. 1a and c). Importantly, chronically infected individuals displayed CD127 expression levels over a much broader range than resolved individuals (9.5% to 100% versus 92 to 100%) (Fig. (Fig.1a1a).Open in a separate windowFIG. 1.Chronically infected individuals express a range of CD127 levels on HCV-specific T cells. (a) CD127 expression levels on HCV-specific T-cell populations in individuals with established chronic or resolved infection. While individuals with resolved infection (11 tetramer stains in 9 subjects) uniformly express high levels of CD127, chronically infected individuals (21 tetramer stains in 18 subjects) express a wide range of CD127 expression levels. (b) CD127 expression levels are seen to be highly dependent on sequence match with the autologous virus, based on analysis of 9 responses with diminished recognition of the autologous virus and 8 responses with intact epitopes. (c) CD127 expression levels on HCV-specific T-cell B7 CORE 41-49-specific T cells from individual 01-49 with resolved HCV infection (left-hand panel). Lower CD127 expression levels are observed on an EBV-specific T-cell population from the same individual (right-hand panel). APC-A, allophycocyanin-conjugated antibody. (d) Low CD127 levels are observed on A2 NS3 1073-1083 HCV-specific T cells from individual 111 with chronic HCV infection in whom sequencing revealed an intact autologous sequence.Given the relationship between CD127 expression and antigenic stimulation as well as the potential of HCV to escape the CD8 T-cell response through viral mutation, we sequenced the autologous circulating virus in subjects with chronic infection (Table (Table1).1). A perfect match between the optimal epitope sequence and the autologous virus was found for only 8 responses. These were the only T-cell populations with lower levels of CD127 expression (Fig. (Fig.1a,1a, b, and d). In contrast, HCV T-cell responses with CD127 expression levels comparable to those observed in resolved infection (>85%) were typically mismatched with the viral sequence, with some variants compatible with viral escape and others suggesting infection with a non-genotype 1 strain (10) (Fig. (Fig.1).1). Enzyme-linked immunospot (ELISPOT) assays using T-cell lines confirmed the complete abrogation of T-cell recognition and thus antigenic stimulation in cases of cross-genotype mismatch (10). Responses targeting the epitope A1-143D expressed somewhat lower levels of CD127 (between 70% and 85%). Viral escape (Y to F at position 9) in this epitope has been shown to be associated with significantly diminished but not fully abolished recognition (11a), and was found in all chronically infected subjects whose T cells targeted this epitope. Thus, expression of CD127 in the presence of viremia is closely associated with the capacity of the T cell to recognize the circulating virus.That a decrease in antigenic stimulation is indeed associated with the emergence of CD127-expressing CD8 T cells is further demonstrated in subject 111. This subject with chronic infection targeted fully conserved epitopes with T cells with low CD127 expression; with clearance of viremia under antiviral therapy, CD127-negative HCV-specific CD8 T cells were no longer detectable and were replaced by populations expressing CD127 (data not shown). Overall these data support the notion that CD127 expression on HCV-specific CD8+ T-cell populations is dependent on an absence of ongoing antigenic stimulation.To further evaluate the dynamic relationship between antigenic stimulation and CD127 expression, we also analyzed HCV-specific T-cell responses longitudinally during acute HCV infection (Fig. (Fig.2a).2a). CD127 expression was generally low or absent during the earliest time points. After resolution of infection, we see a contraction of the HCV-specific T-cell response together with a continuous increase in CD127 expression, until virtually all tetramer-positive cells express CD127 approximately 6 months after the onset of disease (Fig. (Fig.2a).2a). A similar increase in CD127 expression was not seen in one subject (no. 554) with untreated persisting infection that maintained a significant tetramer-positive T-cell population for an extended period of time (Fig. (Fig.2a).2a). Importantly, sequence analysis of the autologous virus demonstrated the conservation of this epitope throughout persistent infection (8). In contrast, subject 03-32 (with untreated persisting infection) developed a CD8 T-cell response targeting a B35-restricted epitope in NS3 from which the virus escaped (8). The T cells specific for this epitope acquired CD127 expression in a comparable manner to those controlling infection (Fig. (Fig.2a).2a). In other subjects with persisting infection, HCV-specific T-cells usually disappeared from blood before the time frame in which CD127 upregulation was observed in the other subjects.Open in a separate windowFIG. 2.CD127 expression levels during acute HCV infection. (a) CD127 expression levels on HCV-specific T cells during the acute phase of HCV infection (data shown for 5 individuals who resolve and two individuals who remain chronically infected). (b) HCV RNA viral load and CD127 expression levels on HCV-specific T cells (A2 NS3 1073-1083 and A1 NS3 1436-1444) for chronically infected individual 00-23. PEG-IFN-α, pegylated alpha interferon. (c) Fluorescence-activated cell sorter (FACS) plots showing longitudinal CD127 expression levels on HCV-specific T cells (A2 NS3 1073-1083 and A1 NS3 1436-1444) from individual 00-23.We also characterized the levels of CD127 expression on HCV-specific CD4+ T-cell populations with similar results: low levels were observed during the acute phase of infection and increased levels in individuals after infection was cleared (data not shown). CD127 expression on CD4 T cells could not be assessed in viral persistence since we failed to detect significant numbers of HCV-specific CD4+ T cells, in agreement with other reports.In our cohort of subjects with acute HCV infection, we had the opportunity to study the effect of reencounter with antigen on T cells with high CD127 expression in 3 subjects in whom HCV viremia returned after a period of viral control. Subject 00-23 experienced viral relapse after interferon treatment (11), while subjects 05-13 and 04-11 were reinfected with distinct viral isolates. In all subjects, reappearance of HCV antigen that corresponded to the HCV-specific T-cell population was associated with massive expansion of HCV-specific T-cell populations and a decrease in CD127 expression on these T cells (Fig. (Fig.22 and and3)3) (data not shown). In contrast, T-cell responses that did not recognize the current viral isolate did not respond with an expansion of the population or the downregulation of CD127. This was observed in 00-23, where the sequence of the A1-restricted epitope 143D was identical to the frequent escape mutation described above in chronically infected subjects associated with diminished T-cell recognition (Fig. (Fig.2b2b and and3a).3a). In 05-13, the viral isolate during the second episode of viremia contained a variant in one of the anchor residues of the epitope A2-61 (Fig. (Fig.2d).2d). These results show that CD127 expression on HCV-specific T cells follows the established principles observed in other viral infections.Open in a separate windowFIG. 3.Longitudinal phenotypic changes on HCV-specific T cells. (a) HCV RNA viral load and CD127 expression (%) levels on A2 NS5B 2594-2602 HCV-specific T cells for individual 04-11. This individual was administered antiviral therapy, which resulted in a sustained virological response. Following reinfection, the individual spontaneously cleared the virus. (b) Longitudinal frequency of A2 NS5B 2594-2602 HCV-specific T cells and PD-1 expression levels (mean fluorescent intensity [MFI]) for individual 04-11. (c) Longitudinal analysis of 04-11 reveals the progressive differentiation of HCV-specific A2 259F CD8+ T cells following repetitive antigenic stimulation. FACS plots show longitudinal CD127, CD27, CD57, and CCR7 expression levels on A2 NS5B 2594-2602 tetramer-positive cells from individual 04-11. PE-A, phycoerthrin-conjugated antibody.In addition to the changes in CD127 expression for T cells during reencounter with antigen, we detected comparable changes in other phenotypic markers shortly after exposure to viremia. First, we detected an increase in PD-1 and CD38 expression—both associated with recent T-cell activation. Additionally, we observed a loss of CD27 expression, a feature of repetitive antigenic stimulation (Fig. (Fig.3).3). The correlation of CD127 and CD27 expression further supports the notion that CD127 downregulation is a marker of continuous antigenic stimulation (1, 7).In conclusion we confirm that high CD127 expression levels are common for detectable HCV-specific CD8+ T-cell populations in chronic infection and find that this phenotype is based on the existence of viral sequence variants rather than on unique properties of HCV-specific T cells. This is further demonstrated by our data from acute HCV infection showing that viral escape as well as viral resolution is driving the upregulation of CD127. We also show that some, but not all, markers typically used to phenotypically describe virus-specific T cells show a similar dependence on cognate HCV antigen. Our data further highlight that sequencing of autologous virus is vital when interpreting data obtained in chronic HCV infection and raise the possibility that previous studies, focused on individuals with established chronic infection, may have been confounded by antigenic variation within epitopes or superinfection with different non-cross-reactive genotypes. Interestingly, it should be pointed out that this finding is supported by previous data from both the chimpanzee model of HCV and from human HBV infection (3, 13).Overall our data clearly demonstrate that the phenotype of HCV-specific CD8+ T cells is determined by the level of antigen-specific stimulation. The high number of CD127 positive virus-specific CD8+ T cells that is associated with the presence of viral escape mutations is a hallmark of chronic HCV infection that clearly separates HCV from other chronic viral infections (4, 14).  相似文献   

8.
9.
10.
11.
12.
Cj0859c variants fspA1 and fspA2 from 669 human, poultry, and bovine Campylobacter jejuni strains were associated with certain hosts and multilocus sequence typing (MLST) types. Among the human and poultry strains, fspA1 was significantly (P < 0.001) more common than fspA2. FspA2 amino acid sequences were the most diverse and were often truncated.Campylobacter jejuni is the leading cause of bacterial gastroenteritis worldwide and responsible for more than 90% of Campylobacter infections (7). Case-control studies have identified consumption or handling of raw and undercooked poultry meat, drinking unpasteurized milk, and swimming in natural water sources as risk factors for acquiring domestic campylobacteriosis in Finland (7, 9). Multilocus sequence typing (MLST) has been employed to study the molecular epidemiology of Campylobacter (4) and can contribute to virulotyping when combined with known virulence factors (5). FspA proteins are small, acidic, flagellum-secreted nonflagellar proteins of C. jejuni that are encoded by Cj0859c, which is expressed by a σ28 promoter (8). Both FspA1 and FspA2 were shown to be immunogenic in mice and protected against disease after challenge with a homologous strain (1). However, FspA1 also protected against illness after challenge with a heterologous strain, whereas FspA2 failed to do the same at a significant level. Neither FspA1 nor FspA2 protected against colonization (1). On the other hand, FspA2 has been shown to induce apoptosis in INT407 cells, a feature not exhibited by FspA1 (8). Therefore, our aim was to study the distributions of fspA1 and fspA2 among MLST types of Finnish human, chicken, and bovine strains.In total, 367 human isolates, 183 chicken isolates, and 119 bovine isolates (n = 669) were included in the analyses (3). PCR primers for Cj0859c were used as described previously (8). Primer pgo6.13 (5′-TTGTTGCAGTTCCAGCATCGGT-3′) was designed to sequence fspA1. Fisher''s exact test or a chi-square test was used to assess the associations between sequence types (STs) and Cj0859c. The SignalP 3.0 server was used for prediction of signal peptides (2).The fspA1 and fspA2 variants were found in 62.6% and 37.4% of the strains, respectively. In 0.3% of the strains, neither isoform was found. Among the human and chicken strains, fspA1 was significantly more common, whereas fspA2 was significantly more frequent among the bovine isolates (Table (Table1).1). Among the MLST clonal complexes (CCs), fspA1 was associated with the ST-22, ST-45, ST-283, and ST-677 CCs and fspA2 was associated with the ST-21, ST-52, ST-61, ST-206, ST-692, and ST-1332 CCs and ST-58, ST-475, and ST-4001. Although strong CC associations of fspA1 and fspA2 were found, the ST-48 complex showed a heterogeneous distribution of fspA1 and fspA2. Most isolates carried fspA2, and ST-475 was associated with fspA2. On the contrary, ST-48 commonly carried fspA1 (Table (Table1).1). In our previous studies, ST-48 was found in human isolates only (6), while ST-475 was found in both human and bovine isolates (3, 6). The strict host associations and striking difference between fspA variants in human ST-48 isolates and human/bovine ST-475 isolates suggest that fspA could be important in host adaptation.

TABLE 1.

Percent distributions of fspA1 and fspA2 variants among 669 human, poultry, and bovine Campylobacter jejuni strains and their associations with hosts, STs, and CCs
Host or ST complex/ST (no. of isolates)% of strains witha:
P valueb
fspA1fspA2
Host
    All (669)64.335.4
    Human (367)69.530.0<0.001
    Poultry (183)79.220.8<0.001
    Bovine (119)25.274.8<0.0001
ST complex and STs
    ST-21 complex (151)2.697.4<0.0001
        ST-50 (76)NF100<0.0001
        ST-53 (19)NF100<0.0001
        ST-451 (9)NF100<0.0001
        ST-883 (11)NF100<0.0001
    ST-22 complex (22)100NF<0.0001
        ST-22 (11)100NF<0.01
        ST-1947 (9)100NF0.03
    ST-45 complex (268)99.30.7<0.0001
        ST-11 (7)100NFNA
        ST-45 (173)99.40.6<0.0001
        ST-137 (22)95.54.50.001
        ST-230 (14)100NF<0.0001
    ST-48 complex (18)44.455.6NA
        ST-48 (7)100NFNA
        ST-475 (8)NF100<0.001
    ST-52 complex (5)NF100<0.01
        ST-52 (4)NF1000.02
    ST-61 complex (21)NF100<0.0001
        ST-61 (11)NF100<0.0001
        ST-618 (3)NF1000.04
    ST-206 complex (5)NF100<0.01
    ST-283 complex (24)100NF<0.0001
        ST-267 (23)100NF<0.0001
    ST-677 complex (59)100NF<0.0001
        ST-677 (48)100NF<0.0001
        ST-794 (11)100NF<0.001
    ST-692 complex (3)NF1000.04
    ST-1034 complex (5)NF80NA
        ST-4001 (3)NF1000.04
    ST-1287 complex/ST-945 (8)100NFNA
    ST-1332 complex/ST-1332 (4)NF1000.02
    Unassigned STs
        ST-58 (6)NF100<0.01
        ST-586 (6)100NFNA
Open in a separate windowaIn 0.3% of the strains, neither isoform was found. NF, not found.bNA, not associated.A total of 28 isolates (representing 6 CCs and 13 STs) were sequenced for fspA1 and compared to reference strains NCTC 11168 and 81-176. All isolates in the ST-22 CC showed the same one-nucleotide (nt) difference with both NCTC 11168 and 81-176 strains, resulting in a Thr→Ala substitution in the predicted protein sequence (represented by isolate FB7437, GenBank accession number HQ104931; Fig. Fig.1).1). Eight other isolates in different CCs showed a 2-nt difference (isolate 1970, GenBank accession number HQ104932; Fig. Fig.1)1) compared to strains NCTC 11168 and 81-176, although this did not result in amino acid substitutions. All 28 isolates were predicted to encode a full-length FspA1 protein.Open in a separate windowFIG. 1.Comparison of FspA1 and FspA2 isoforms. FspA1 is represented by 81-176, FB7437, and 1970. FspA2 is represented by C. jejuni strains 76763 to 1960 (GenBank accession numbers HQ104933 to HQ104946). Scale bar represents amino acid divergence.In total, 62 isolates (representing 7 CCs and 35 STs) were subjected to fspA2 sequence analysis. Although a 100% sequence similarity between different STs was found for isolates in the ST-21, ST-45, ST-48, ST-61, and ST-206 CCs, fspA2 was generally more heterogeneous than fspA1 and we found 13 predicted FspA2 amino acid sequence variants in total (Fig. (Fig.1).1). In several isolates with uncommon and often unassigned (UA) STs, the proteins were truncated (Fig. (Fig.1),1), with most mutations being ST specific. For example, all ST-58 isolates showed a 13-bp deletion (isolate 3074_2; Fig. Fig.1),1), resulting in a premature stop codon. Also, all ST-1332 CC isolates were predicted to have a premature stop codon by the addition of a nucleotide between nt 112 and nt 113 (isolate 1960; Fig. Fig.1),1), a feature shared with two isolates typed as ST-4002 (UA). A T68A substitution in ST-1960 (isolate T-73494) also resulted in a premature stop codon. Interestingly, ST-1959 and ST-4003 (represented by isolate 4129) both lacked one triplet (nt 235 to 237), resulting in a shorter FspA2 protein. SignalP analysis showed the probability of a signal peptide between nt 22 and 23 (ACA-AA [between the underlined nucleotides]). An A24C substitution in two other strains, represented by isolate 76580, of ST-693 and ST-993 could possibly result in a truncated FspA2 protein as well.In conclusion, our results showed that FspA1 and FspA2 showed host and MLST associations. The immunogenic FspA1 seems to be conserved among C. jejuni strains, in contrast to the heterogeneous apoptosis-inducing FspA2, of which many isoforms were truncated. FspA proteins could serve as virulence factors for C. jejuni, although their roles herein are not clear at this time.  相似文献   

13.
Vertebrate genomic assemblies were analyzed for endogenous sequences related to any known viruses with single-stranded DNA genomes. Numerous high-confidence examples related to the Circoviridae and two genera in the family Parvoviridae, the parvoviruses and dependoviruses, were found and were broadly distributed among 31 of the 49 vertebrate species tested. Our analyses indicate that the ages of both virus families may exceed 40 to 50 million years. Shared features of the replication strategies of these viruses may explain the high incidence of the integrations.It has long been appreciated that retroviruses can contribute significantly to the genetic makeup of host organisms. Genes related to certain other viruses with single-stranded RNA genomes, formerly considered to be most unlikely candidates for such contribution, have recently been detected throughout the vertebrate phylogenetic tree (1, 6, 13). Here, we report that viruses with single-stranded DNA (ssDNA) genomes have also contributed to the genetic makeup of many organisms, stretching back as far as the Paleocene period and possibly the late Cretaceous period of evolution.Determining the evolutionary ages of viruses can be problematic, as their mutation rates may be high and their replication may be rapid but also sporadic. To establish a lower age limit for currently circulating ssDNA viruses, we analyzed 49 published vertebrate genomic assemblies for the presence of sequences derived from the NCBI RefSeq database of 2,382 proteins from known viruses in this category, representing a total of 23 classified genera from 7 virus families. Our survey uncovered numerous high-confidence examples of endogenous sequences related to the Circoviridae and to two genera in the family Parvoviridae: the parvoviruses and dependoviruses (Fig. (Fig.11).Open in a separate windowFIG. 1.Phylogenetic tree of vertebrate organisms and history of ssDNA virus integrations. Times of integration of ancestral dependoviruses (yellow icosahedrons), parvoviruses (blue icosahedrons), and circoviruses (triangles) are approximate.The Dependovirus and Parvovirus genomes are typically 4 to 6 kb in length, include 2 major open reading frames (encoding replicase proteins [Rep and NS1, respectively] and capsid proteins [Cap and VP1, respectively]), and have characteristic hairpin structures at both ends (Fig. (Fig.2).2). For replication, these viruses depend on host enzymes that are recruited by the viral replicase proteins to the hairpin regions, where self-primed viral DNA synthesis is initiated (2). Circovirus genomes are typically ∼2-kb circles. DNA of the type species, porcine circovirus 1 (PCV-1), contains a stem-loop structure within the origin of replication (Fig. (Fig.2),2), and the largest open reading frame includes sequences that are homologous to the Parvovirus replicase open reading frame (9, 11). The circoviruses also depend on host enzymes for replication, and DNA synthesis is self-primed from a 3′-OH end formed by endonucleolytic cleavage of the stem-loop structure (4). The frequency of Dependovirus infection is estimated to be as high as 90% within an individual''s lifetime. None of the dependoviruses have been associated with human disease, but related viruses in the family Parvoviridae (e.g., erythrovirus B19 and possibly human bocavirus) are pathogenic for humans, and members of both the Parvoviridae and the Circoviridae can cause a variety of animal diseases (2, 4).Open in a separate windowFIG. 2.Schematics illustrating the structure and organization of Parvoviridae and Circoviridae genomes and origins of several of the longest-integrated ancestral viral sequences found in vertebrates. Integrations were aligned to the Dependovirus adeno-associated virus 2 (AAV2), the Parvovirus minute virus of mice (MVM), and the Circovirus porcine circovirus 1 (PCV-1). The inverted terminal repeat (ITR) sequences in the Dependovirus and Parvovirus genomes are depicted on an expanded scale. A linear representation of the circular genome of PCV-1 is shown with the 10-bp stem-loop structure on an expanded scale. Horizontal lines beneath the maps indicate the lengths of similar sequences that could be identified by BLAST. The numbers indicate the locations of amino acids in the viral proteins where the sequence similarities in the endogenous insertions start and end. The actual ancestral virus-derived integrated sequences may extend beyond the indicated regions.With some ancestral endogenous sequences that we identified, phylogenetic comparisons can be used to estimate age. For example, as a Dependovirus-like sequence is present at the same location in the genomes of mice and rats, the ancestral virus must have existed before their divergence, more than 20 million years ago. Some Circovirus- and Dependovirus-related integrations also predate the split between dog and panda, about 42 million years ago. However, in most other cases, we rely on an indirect method for estimating age (1). As genomic sequences evolve, they accumulate new stop codons and insertion/deletion-induced frameshifts. The rates of these events can be tied directly to the rates of neutral sequence drift and, therefore, the time of evolution. To apply this method, we first performed a BLAST search of vertebrate genomes for all known ssDNA virus proteins (BLAST options, -p tblastn -M BLOSUM62 -e 1e−4). Candidate sequences were then recorded, along with 5 kb of flanking regions, and then again aligned against the database of ssDNA viruses to find the most complete alignment (BLAST options, -t blastx -F F -w 15 -t 1500 -Z 150 -G 13 -E 1 -e 1e−2). Detected alignments were then compared with a neutral model of genome evolution, as described in the supplemental material, and the numbers of stop codons and frameshifts were converted into the expected genomic drift undergone by the sequences. The age of integration was then estimated from the known phylogeny of vertebrates (7, 10). Using these methods, we discovered that as many as 110 ssDNA virus-related sequences have been integrated into the 49 vertebrate genomes considered, during a time period ranging from the present to over 40 to 60 million years ago (Table (Table1;1; see also Tables S1 to S3 in the supplemental material).

TABLE 1.

Selected endogenous sequences in vertebrate genomes related to single-stranded DNA viruses
Virus group and vertebrate speciesInitial genomic search using TBLASTN
Best sequence homology identified using BLASTX
Predicted nucleotide drift (%)Integration labelAge (million yr) or timing of integration based on sequence aging
Chromosomal or scaffold locationProteinBLAST E value/% sequence identityMost similar virusaProteinCoordinatesNo. of stop codons/frameshifts
Circoviruses
    CatScaffold_62068Rep6E−05/37Canary circovirusRep4-2833/7 in 268 aab14.2fcECLG-182
Scaffold_24038Rep6E−06/51Columbid circovirusRep44-3174/5 in 231 aac15.2fcECLG-287
    DogChr5dRep7E−16/46Raven circovirusRep16-2636/5 in 250 aa17.6cfECLG-198
Chr22Rep1E−14/43Beak and feather disease virusRep7-2642/1 in 261 aac4.5cfECLG-254
    OpossumChr3Rep4E−46/44Finch circovirusRep2-2910/2 in 282 aa2.3mdECLG12
Cap6-360/0 in 30 aa
Dependoviruses
    DogChrXRep6E−05/55AAV5Rep239-4453/4 in 200 aa14.0cfEDLG-178
    DolphinGeneScaffold1475Rep8E−39/39Avian AAV DA1Rep79-4863/4 in 379 aac6.6ttEDLG-255
Cap4E−61/47Cap1-7384/7 in 678 aac
    ElephantScaffold_4Rep0/55AAV5Rep3-5890/0 in 579 aa0.0laEDLGRecent
    HyraxGeneScaffold5020Cap3E−34/53AAV3Cap485-7350/5 in 256 aa7.0pcEDLG-129
Scaffold_19252Rep9E−72/47Bovine AAVRep2-3488/4 in 348 aa14.3pcEDLG-260
    MegabatScaffold_5601Rep2E−13/31AAV2Rep315-4791/5 in 175 aa13.1pvEDLG-376
    MicrobatGeneScaffold2026Rep1E−117/50AAV2Rep1-6172/5 in 612 aa5.8mlEDLG-127
Cap9E−33/51Cap1-7312/9 in 509 aac
Scaffold_146492Cap6E−32/42AAV2Cap479-7320/3 in 252 aa4.2mlEDLG-219
    MouseChr1Rep2E−06/34AAV2Rep4-2063/5 in 191 aa17.1mmEDLG-139
Chr3Rep2E−24/31AAV5Rep71-47812/7 in 389 aa16.5mmEDLG-237
Cap2E−22/45Cap22-72412/10 in 649aac
Chr8Rep1E−08/46AAV2Rep314-4733/3 in 147 aa13.8mmEDLG-331
Cap1-1371/2 in 114 aa
    PandaScaffold2359Rep2E−06/37Bovine AAVRep238-4262/3 in 186 aa10.4amEDLG-159
    PikaScaffold_9941Rep4E−14/28AAV5Rep126-4152/2 in 282 aa5.4opEDLG14
    PlatypusChr2Rep9E−10/35Bovine AAVRep297-4374/3 in 138 aa17.1oaEDLG-179
Cap272-4191/2 in 150 aac
Contig12430Rep2E−09/47Bovine AAVRep353-4503/1 in 123 aa12.0oaEDLG-255
Cap2E−05/32Cap253-3672/1 in 116 aa
    RabbitChr10Rep3E−97/39AAV2Rep1-6193/9 in 613 aa9.3ocEDLG43
Cap5E−50/45Cap1-72310/9 in 675 aa
    RatChr13Rep2E−09/33AAV2Rep4-1752/4 in 177 aa13.3rnEDLG-128
Chr2Rep4E−18/40AAV5Rep1-46112/12 in 454 aa22.7rnEDLG-251
Chr19Rep2E−07/33AAV5Rep329-4642/4 in 136 aa16.1rnEDLG-335
Cap31-1332/1 in 93 aa
    TarsierScaffold_178326Rep4E−14/23AAV5Rep96-4652/3 in 356 aa5.3tsEDLG23
Parvoviruses
    Guinea pigScaffold_188Rep3E−24/46Porcine parvovirusRep313-5675/3 in 250 aa12.3cpEPLG-140
Cap1E−16/36Cap10-68911/12 in 672 aa
Scaffold_27Rep1E−50/39Canine parvovirusRep11-6401/4 in 616 aa5.3cpEPLG-217
Cap1E−38/39Porcine parvovirusCap3-7192/14 in 700 aa
    TenrecScaffold_260946Rep2E−20/38LuIII virusRep406-5984/4 in 190 aa19.0etEPLG-260
Cap11-63916/15 in 595 aa
    RatChr5Rep6E−10/56Canine parvovirusRep1-2820/0 in 312 aa0.6rnEPLGRecent
Cap0/62Cap637-6670/2 in 760 aa
Rep0/631-751
    OpossumChr3Rep2E−39/33LuIII virusRep7-57011/3 in 502 aa10.9mdEPLG-256
Cap7E−8/33Cap11-72914/7 in 704 aa
Chr6Rep6E−58/44Porcine parvovirusRep16-5633/7 in 534 aac4.6mdEPLG-324
Cap6E−60/38Cap10-7152/5 in 707 aac
    WallabyScaffold_108040Rep4E−74/62Canine parvovirusRep341-6450/0 in 287 aa1.3meEPLG-37
Cap8E−37/32Cap35-7380/4 in 687 aa
Scaffold_72496Rep2E−61/42Porcine parvovirusRep23-5674/3 in 531 aa5.7meEPLG-630
Cap2E−31/38Cap10-5326/4 in 514 aa
Scaffold_88340Rep7E−37/55Mouse parvovirus 1Rep344-5660/3 in 223 aa6.7meEPLG-1636
Cap7E−22/33Cap11-7136/9 in 700 aa
Open in a separate windowaSome ambiguity in choosing the most similar virus is possible. We generally used the alignment with the lowest E value in the BLAST results. However, one or two points in the exponent of an E value were sometimes sacrificed to achieve a longer sequence alignment.baa, amino acids.cThese sequences have long insertions compared to the present-day viruses. In all cases tested, these insertions originated from short interspersed elements (SINEs). These insertions were excluded from the counts of stop codons and frameshifts and the estimation of integration age.dChr, chromosome.It is important to recognize that there is an intrinsic limit on how far back in time we can reach to identify ancient endogenous viral sequences. First, the sequences must be identified with confidence by BLAST or similar programs. This requirement places a lower limit on sequence identity at about 20 to 30% of amino acids, or about 75% of nucleotides (nucleotides evolve nearly 2.5 times slower than the amino acid sequence they encode). Second, the related, present-day virus must have evolved at a rate that is not much higher than that of the endogenous sequences. The viruses for which ancestral endogenous sequences were identified in this study exhibit sequence drift similar to that associated with mammalian genomes. Setting this rate at 0.14% per million years of evolution (8), we arrive at 90 million years as the theoretical limit for the oldest sequences that can be identified using our methods. This limit drops to less than 35 million years for endogenous viral sequences in rodents and even lower for sequences related to viruses that evolve faster than mammalian genomes.The most widespread integrations found in our survey are derived from the dependoviruses. These include nearly complete genomes related to adeno-associated virus (AAV) in microbat, wallaby, dolphin, rabbit, mouse, and baboon (Fig. (Fig.2).2). We did not detect inverted terminal repeats in several integrations tested, even though repeats are common in the present-day dependoviruses. This result could be explained by sequence decay or the absence of such structures in the ancestral viruses. However, we do see sequences that resemble degraded hairpin structures to which Dependovirus Rep proteins bind, with an example from microbat integration mlEDLG-1 shown in Fig. Fig.3.3. The second most widespread endogenous sequences are related to the parvoviruses. They are found in 6 of 49 vertebrate species considered, with nearly complete genomes in rat, opossum, wallaby, and guinea pig (Fig. (Fig.22).Open in a separate windowFIG. 3.Hairpin structure of the inverted terminal repeat of adeno-associated virus 2 (left) and a candidate degraded hairpin structure located close to the 5′ end of the mlEDLG-1 integration in microbats (right). Structures and mountain plots were generated using default parameters of the RNAfold program (5), with nucleotide coloring representing base-pairing probabilities: blue is below average, green is average, and red is above average. Mountain plots represent hairpin structures based on minimum free energy (mfe) calculations and partition function (pf) calculations, as well as the centroid structure (5). Height is expressed in numbers of nucleotides; position represents nucleotide.The Dependovirus AAV2 has strong bias for integration into human chromosome 19 during infection, driven by a host sequence that is recognized by the viral Rep protein(s). Rep mediates the formation of a synapse between viral and cellular sequences, and the cellular sequences are nicked to serve as an origin of viral replication (14). The related integrations in mice and rats, located in the same chromosomal locations, might be explained by such a mechanism. However, the extent of endogenous sequence decay and the frequency of stop codons indicate that these integrations occurred some 30 to 35 million years ago, implying that they are derived from a single event in a rodent ancestor rather than two independent integration events at the same location. Similarly, integrations EDLG-1 in dog and panda lie in chromosomal regions that can be readily aligned (based on University of California—Santa Cruz [UCSC] genome assemblies) and show sequence decay consistent with the age of the common ancestor, about 42 million years. Endogenous sequences related to the family Parvoviridae can thus be traced to over 40 million years back in time, and viral proteins related to this family have remained over 40% conserved.Sequences related to circoviruses were detected in five vertebrate species (Table (Table11 and Table S1 in the supplemental material). At least one of these sequences, the endogenous sequence in opossum, likely represents a recent integration. Several integrations in dog, cat, and panda, on the other hand, appear to date from at least 42 million years ago, which is the last time when pandas and dogs shared a common ancestor. We see evidence for this age in data from sequence degradation (Table (Table1),1), phylogenetic analyses of endogenous Circovirus-like genomes (see Fig. S2 in the supplemental material), and genomic synteny where integration ECLG-3 is surrounded by genes MTA3 and ARID5A in both dog and panda and integration ECLG-2 lies 35 to 43 kb downstream of gene UPF3A. In fact, Circovirus integrations may even precede the split between dogs and cats, about 55 million years ago, although the preliminary assembly and short genomic contigs for cats make synteny analysis impossible.The most common Circovirus-related sequences detected in vertebrate genomes are derived from the rep gene. We speculate that, like those of the Parvoviridae, the ancestral Circoviridae sequences might have been copied using a primer sequence in the host DNA that resembled the viral origin and was therefore recognized by the virus Rep protein. Higher incidence of rep gene identifications may represent higher conservation of this gene with time, or alternatively, possession of these sequences may impart some selective advantage to the host species. The largest Circovirus-related integration detected, in the opossum, comprises a short fragment of what may have been the cap gene immediately adjacent to and in the opposite orientation from the rep gene. This organization is similar to that of the present day Circovirus genome in which these genes share a promoter in the hairpin regions but are translated in opposite directions (Fig. (Fig.22).In summary, our results indicate that sequences derived from ancestral members of the families Parvoviridae and Circoviridae were integrated into their host''s genomes over the past 50 million years of evolution. Features of their replication strategies suggest mechanisms by which such integrations may have occurred. It is possible that some of the endogenous viral sequences could offer a selective advantage to the virus or the host. We note that rep open reading frame-derived proteins from some members of these families kill tumor cells selectively (3, 12). The genomic “fossils” we have discovered provide a unique glimpse into virus evolution but can give us only a lower estimate of the actual ages of these families. However, numerous recent integrations suggest that their germ line transfer has been continuing into present times.   相似文献   

14.
15.
16.
17.
Basal cell carcinoma (BCC) is a very common malignant skin tumor that rarely metastatizes, but is often locally aggressive. Several factors, like large size (more than 3 cm), exposure to ultraviolet rays, histological variants, level of infiltration and perineural or perivascular invasion, are associated with a more aggressive clinical course. These morphological features seem to be more determinant in mideface localized BCC, which frequently show a significantly higher recurrence rate. An immunohistochemical profile, characterized by reactivity of tumor cells for p53, Ki67 and alpha-SMA has been associated with a more aggressive behaviour in large BCCs. The aim of this study was to verify if also little (<3 cm) basal cell carcinomas can express immunohistochemical markers typical for an aggressive behaviour.Basal cell carcinoma (BCC) is a very common malignant skin tumor that rarely metastatizes, even If Is often locally aggressive. Several factors, like large size (more than 3 cm), face localization, exposure to ultraviolet rays, histological variants, infiltration level and perineural or perivascular invasion, are associated with a more aggressive clinical course. In particular, the incidence of metastasis and/or death correlates with tumors greater than 3 cm in diameter in which setting patients are said to have 1–2 % risk of metastases that increases to 20–25% in lesions greater than 5 cm and to 50% in lesions greater than 10 cm in diameter (Snow et al., 1994). Histologically morpheiform, keratotic types and infiltrative growth of BCC are also considered features of the most aggressive course (Crowson, 2006). This can be explained by the fact that both the superficial and nodular variants of BCC are surrounded by a continuous basement membrane zone comprising collagens type IV and V admixed with laminin, while the aggressive growth variants (i.e. morpheiform, metatypical, and infiltrative growth subtypes) manifest the absence of basement membrane (Barsky et al., 1987).The molecular markers which characterize aggressive BCC include: increased expression of stromolysin (MMP-3) and collagenase-1 (MMP-1) (Cribier et al., 2001), decreased expression of syndecan-1 proteoglycan (Bayer-Garner et al., 2000) and of anti-apoptotic protein bcl-2 (Ramdial et al., 2000; Staibano et al., 2001).C-ras , c-fos (Urabe et al., 1994; Van der Schroeff et al., 1990) and p53 tumor supressor gene mutations (Auepemikiate et al., 2002) are indicative of an aggressive course.Focusing upon bcl-2 and p53 expression in BCC, there have been numerous studies documenting the utility of bcl-2 as a marker of favourable clinical behaviour while p53 expression may be a feature of a more aggressive outcome (Ramdial et al., 2000; Staibano et al., 2001; Bozdogan et al., 2002).An increased expression of cytoskeletal microfilaments like α–smooth muscle actin, frequently found in invasive BCC subtypes (Jones JCR et al., 1989), may explain an enhanced tumor mobility and deep tissue invasion through the stroma. (Cristian et al., 2001; Law et al., 2003). The aim of this preliminary study was to verify if also little (<3 cm) basal cell carcinomas may express aggressive immunohistochemical markers like p53, Ki67 and alpha-SMA. We used 31 excisional BCCs with tumor size less than 2 cm (ranging from 2 up to 20 mm) and with different skin localization (19 in the face, 6 in the trunk and 6 in the body extremities). All cases were immunostained for p53, BCL2, Ki67 and alpha-smooth muscle actin (α-SMA) (
AgeSexLocationHystotypeMax.DimDepthUlcEssInfp53Bcl-2Ki67AML
161MExtrKeratotic10×81No+++URD+++++-
261MFaceAdenoid10×94No+URD+++---
364MExtrSup mult11×130.8No+DRD+---
473MFaceNodular10×82Yes+DRD+++++++++
584MFaceNodular9×122Yes+DRD----
684MFaceAdenoid50.8No+URD+++---
784MExtrNodular13×103No+DRD+++++-
852FFaceNodular40.8No+URD+++-
976FFaceAdenoid10×44No+DRD+++-++-
1077FFaceMorph8×61Yes+++DRD+++---
1186MFaceMorph81Yes+DRD+++-++
1263FFaceAdenoid41No+URD+++++
1376FFaceNodular71.5No+DRD++++++-
1484MFaceNodular114Yes+++DRD+--+
1563FFaceKeratotic10×61.8No++DRD-+++-
1668FTrunkSup mult10×60.7No++URD++--
1767MFaceSup mult12×60.4No+URD+-+-
1867MExtrSup mult4×30.3No+URD+++++-
1932FExtrSup mult1×30.4No+URD+++-
2045MTrunkNodular7×52Yes+++URD+++-
2162MTrunkSup mult11×70.9No++URD-++-++
2265MTrunkAdenoid7×61.5No+URD+++++-
2372MTrunkNodular12×61No+URD+++-++
2486FFaceKeratotic20×113.1No++DRD+++-
2585MFaceNodular0.51.3No++DRD++++-
2674FExtrNodular4×40.9No+URD--+-
2771MFaceNodular6×121.7No+DRD--+-
2864FTrunkSup mult1.3×1.50.4No++URD+++---
2978FFaceNodular4×31.5No++DRD+++-+++
3080MFaceKeratotic4×41.6Yes+DRD--++++
Open in a separate window Our data show that p53 (75%), Bcl2 (50%) and Ki67 (63%) positivity was generally diffuse in the majority of cases. On the contrary, cytoplasmatic α-SMA expression was present only in 8 out of 31 cases (25,8%). All these 8 α-SMA positive BCCs, prevalently found in the mideface (6 out of 8), were characterized by an initial invasion beyond the dermis. Among these 6 face-localized α-SMA positive BCCs, 1 showed a sclerosing aggressive histotype, 1 a keratotic type and 4 a nodular histotype.These 8 little α-SMA-positive BCCs, compared to the others 23 α-SMA negative samples, all showed a major aggressiveness features: facial location, ulceration, morpheiform histotype and deeper infiltration into the dermis (Location
Histotype
Local aggressiveness
Immunohistochemistry
FaceKeratoticMorpheiformDepht of invasion Mean value(mm)UlcerationInfiltration of the dermisP53Bcl-2Ki678 α-SMA Positive cases75%12%12%1.650%63%75%50%63%23 α-SMA Negative cases56%13%4%1.413%48%78%43%65%
Open in a separate windowGiven the absence of a specific difference between α-SMA positive cases and α-SMA negative cases in the expression of aggressive immunohistochemical markers, except for a light reduction of bcl-2 in the α-SMA positive group (and2).2). By the analysis of the data, we selected the combination that could better define an aggressive behaviour even for little BCC: α-SMA, p53, Ki67 positivity and bcl-2 negativity. We considered p53 and ki67 markers of proliferation and cell-cycle alteration, combined with a loss of apoptotic activity expressed by Bcl-2 negativity, quite characteristic of aggressiveness; moreover α-SMA positivity probably reflects invasive potential and acquired mobility by neoplastic cells.This immunohistochemical profile (α-SMA, p53, Ki67 positivity and bcl-2 negativity) in our cases of BCC is present in two of them; one is a morpheiform BCC, that is an aggressive variant, while the other one is a nodular subtype (less aggressive).Therefore, our preliminary data suggest that only α-SMA positivity should be considered as an early diagnostic marker of potential aggressiveness in little BCC: all α-SMA positive little BCC in fact showed clinical and histological features of aggressiveness. Invasive potential is probably acquired by some BCCs not only when they reach large size, but it is probably present also when they have still little size, and can be revealed by α-SMA positivity in the neoplastic cells. Open in a separate windowFigure 1BCC, nodular type, HE, 10×. Open in a separate windowFigure 2BCC, nodular type, α-SMA positivity, 10×.  相似文献   

18.
Physiological Versatility of the Extremely Thermoacidophilic Archaeon Metallosphaera sedula Supported by Transcriptomic Analysis of Heterotrophic,Autotrophic, and Mixotrophic Growth     
Kathryne S. Auernik  Robert M. Kelly 《Applied and environmental microbiology》2010,76(3):931-935
  相似文献   

19.
Spontaneous Quinolone Resistance in the Zoonotic Serovar of Vibrio vulnificus     
Francisco J. Roig  A. Llorens  B. Fouz  C. Amaro 《Applied and environmental microbiology》2009,75(8):2577-2580
This work demonstrates that Vibrio vulnificus biotype 2, serovar E, an eel pathogen able to infect humans, can become resistant to quinolone by specific mutations in gyrA (substitution of isoleucine for serine at position 83) and to some fluoroquinolones by additional mutations in parC (substitution of lysine for serine at position 85). Thus, to avoid the selection of resistant strains that are potentially pathogenic for humans, antibiotics other than quinolones must be used to treat vibriosis on farms.Vibrio vulnificus is an aquatic bacterium from warm and tropical ecosystems that causes vibriosis in humans and fish (http://www.cdc.gov/nczved/dfbmd/disease_listing/vibriov_gi.html) (33). The species is heterogeneous and has been subdivided into three biotypes and more than eight serovars (6, 15, 33; our unpublished results). While biotypes 1 and 3 are innocuous for fish, biotype 2 can infect nonimmune fish, mainly eels, by colonizing the gills, invading the bloodstream, and causing death by septicemia (23). The disease is rapidly transmitted through water and can result in significant economic losses to fish farmers. Surviving eels are immune to the disease and can act as carriers, transmitting vibriosis between farms. Interestingly, biotype 2 isolates belonging to serovar E have been isolated from human infections, suggesting that serovar E is zoonotic (2). This serovar is also the most virulent for fish and has been responsible for the closure of several farms due to massive losses of fish. A vaccine, named Vulnivaccine, has been developed from serovar E isolates and has been successfully tested in the field (14). Although the vaccine provides fish with long-term protection from vibriosis, at present its use is restricted to Spain. For this reason, in many fish farms around the world, vibriosis is treated with antibiotics, which are usually added to the food or water.Quinolones are considered the most effective antibiotics against human and fish vibriosis (19, 21, 31). These antibiotics can persist for a long time in the environment (20), which could favor the emergence of resistant strains under selective pressure. In fact, spontaneous resistances to quinolones by chromosomal mutations have been described for some gram-negative bacteria (10, 11, 17, 24, 25, 26). Therefore, improper antibiotic treatment of eel vibriosis or inadequate residue elimination at farms could favor the emergence of human-pathogenic serovar E strains resistant to quinolones by spontaneous mutations. Thus, the main objective of the present work was to find out if the zoonotic serovar of biotype 2 can become quinolone resistant under selective pressure and determine the molecular basis of this resistance.Very few reports on resistance to antibiotics in V. vulnificus have been published; most of them have been performed with biotype 1 isolates. For this reason, the first task of this study was to determine the antibiotic resistance patterns in a wide collection of V. vulnificus strains belonging to the three biotypes that had been isolated worldwide from different sources (see Table S1 in the supplemental material). Isolates were screened for antimicrobial susceptibility to the antibiotics listed in Table S1 in the supplemental material by the agar diffusion disk procedure of Bauer et al. (5), according to the standard guideline (9). The resistance pattern found for each isolate is shown in Table S1 in the supplemental material. Less than 14% of isolates were sensitive to all the antibiotics tested, and more than 65% were resistant to more than one antibiotic, irrespective of their biotypes or serovars. The most frequent resistances were to ampicillin-sulbactam (SAM; 65.6% of the strains) and nitrofurantoin (F; 60.8% of the strains), and the least frequent were to tetracycline (12%) and oxytetracycline (8%). In addition, 15% of the strains were resistant to nalidixic acid (NAL) and oxolinic acid (OA), and 75% of these strains came from fish farms (see Table S1 in the supplemental material). Thus, high percentages of strains of the three biotypes were shown to be resistant to one or more antibiotics, with percentages similar to those found in nonbiotyped environmental V. vulnificus isolates from Asia and North America (4, 27, 34). In those studies, resistance to antibiotics could not be related to human contamination. However, the percentage of quinolone-resistant strains found in our study is higher than that reported in other ones, probably due to the inclusion of fish farm isolates, where the majority of quinolone-resistant strains were concentrated. This fact suggests that quinolone resistance could be related to human contamination due to the improper use of these drugs in therapy against fish diseases, as has been previously suggested (18, 20). Although no specific resistance pattern was associated with particular biotypes or serovars, we found certain differences in resistance distribution, as shown in Table Table1.1. In this respect, biotype 3 displayed the narrowest spectrum of resistances and biotype 1 the widest. The latter biotype encompassed the highest number of strains with multiresistance (see Table S1 in the supplemental material). Within biotype 2, there were differences among serovars, with quinolone resistance being restricted to the zoonotic serovar (Table (Table11).

TABLE 1.

Percentage of resistant strains distributed by biotypes and serovars
V. vulnificusNo. of isolatesResistance distribution (%) for indicated antibiotica
SAMCTXENALFOTOASXT-TMPTE
Biotype 14975.524.514.330.683.78.230.628.68.2
Biotype 2 (whole)7258.313.912.54.247.29.74.24.213.9
Biotype 2
    Serovar E3630.312.139.127.315.29.1321.2
    Serovar A231009.118.2077.3009.14.6
    Nontypeable82914.325057.114.30014.3
    Serovar I5100202002020000
Biotype 3510002008000020
Open in a separate windowaCTX, cefotaxime; E, erythromycin; OT, oxytetracycline; SXT-TMP, sulfamethoxazole-trimethoprim; TE, tetracycline.The origin of resistance to quinolones in the zoonotic serovar was further investigated. To this end, spontaneous mutants of sensitive strains were selected from colonies growing within the inhibition halo around OA or NAL disks. Two strains (strain CG100 of biotype 1 and strain CECT 4604 of biotype 2, serovar E) developed isolated colonies within the inhibition zone. These colonies were purified, and maintenance of resistance was confirmed by serial incubations on medium without antibiotics. Using the disk diffusion method, CG100 was shown to be resistant to SAM and F and CECT 4604 to F (see Table S1 in the supplemental material). The MICs for OA, NAL, flumequine (UB), and ciprofloxacin (CIP) were determined by using the microplate assay according to the recommendations of the Clinical and Laboratory Standards Institute and the European Committee for Antimicrobial Susceptibility Testing of the European Society of Clinical Microbiology and Infectious Diseases (8, 12) and interpreted according to the European Committee for Antimicrobial Susceptibility Testing of the European Society of Clinical Microbiology and Infectious Diseases (13). The MICs for OA and NAL and for the fluoroquinolones UB and CIP exhibited by the mutants and their counterparts are shown in Table Table2.2. The inhibition zone diameters correlated well with MICs (data not shown). Mutants FR1, FR2, FR3, and FR4 were resistant to NAL and sensitive to the remaining quinolones, although they showed higher resistances than their parental strains (Table (Table2).2). Thus, these four mutants showed increases of 32- to 128-fold for NAL MICs, 4- to 8-fold for UB MICs, and 16-fold for CIP MICs (Table (Table2).2). The fifth mutant, FR5, was resistant to the two tested quinolones and to UB, a narrow-spectrum fluoroquinolone. This mutant, although sensitive to CIP, multiplied its MIC for this drug by 128 with respect to the parental strain (Table (Table22).

TABLE 2.

MICs for quinolones and fluoroquinolones and mutations in gyrA, gyrB, and parC detected in naturally and artificially induced resistant strains
Strain(s)MIC (μg ml−1) for indicated antibioticb
Gene mutationa
gyrA
gyrB
parC
Position
Codon changeaa changePosition
Codon changeaa changePosition
Codon changeaa change
NALOAUBCIPntaantaantaa
CG1000.5 (S)0.125 (S)0.0625 (S)0.0078 (S)
FR116 (R)1 (S)0.25 (S)0.125 (S)24883AGT→ATTS→INCNCNCNCNCNCNCNC
FR216 (R)1 (S)0.25 (S)0.125 (S)24883AGT→ATTS→INCNCNCNCNCNCNCNC
CECT 46040.25 (S)0.0625 (S)0.0625 (S)0.0078 (S)
FR332 (R)2 (S)0.5 (S)0.125 (S)24883AGT→ATTS→INCNCNCNCNCNCNCNC
FR432 (R)2 (S)0.5 (S)0.125 (S)24883AGT→ATTS→INCNCNCNCNCNCNCNC
FR5256 (R)16 (R)16 (R)1 (S)24883AGT→ATTS→I1156386GCA→ACAA→T25485TCA→TTAS→L
1236412CAG→CACQ→H
CECT 4602128 (R)8 (R)64 (R)1 (S)24883AGT→ATTS→INCNCNCNC25485TCA→TTAS→L
CECT 4603, CECT 4606, CECT 4608, PD-5, PD-12, JE32 (R)2 (S)<1 (S)<1 (S)24883AGT→ATTS→INCNCNCNCNCNCNCNC
CECT 486264 (R)2 (S)2 (S)<1 (S)24983AGT→AGAS→RNCNCNCNCNCNCNCNC
A2, A4, A5, A6, A7, PD-1, PD-364-128 (R)2 (S)4 (S)<1 (S)24883AGT→ATTS→INCNCNCNC338113GCA→GTAA→V
V1128 (R)4 (S)4 (S)<1 (S)24883AGT→ATTS→I1274425GAG→GGGE→GNCNCNCNC
1314438AAC→AAAN→K
Open in a separate windowaMutations in a nucleotide (nt) that gave rise to a codon change and to a change in amino acids (aa) are indicated. NC, no change detected.bThe resistance (R) or sensitivity (S) against the antibiotic determined according to the Clinical and Laboratory Standards Institute and the European Committee for Antimicrobial Susceptibility Testing of the European Society of Clinical Microbiology and Infectious Diseases (9, 13) is indicated in parentheses.For other gram-negative pathogens, quinolone resistance relies on spontaneous mutations in the gyrA, gyrB, parC, and parE genes that occur in a specific region of the protein known as the quinolone resistance-determining region (QRDR) (1, 11, 17, 24, 25, 26, 28). To test the hypothesis that mutations in these genes could also produce quinolone resistance in V. vulnificus, the QRDRs of these genes were sequenced in the naturally resistant strains and in the two sensitive strains that had developed resistances by selective pressure in vitro. The genomic DNA was extracted (3), and the QRDRs of gyrA, gyrB, parE, and parC were amplified using the primers shown in Table Table3,3, which were designed from the published genomes of biotype 1 strains YJ016 and CMCP6 (7, 22). PCR products of the predicted size were sequenced in an ABI 3730 sequencer (Applied Biosystems). Analysis of the QRDR sequences for gyrA, gyrB, parC, and parE of the mutants and the naturally resistant strains revealed that all naturally resistant strains, except one, shared a specific mutation at nucleotide position 248 with the laboratory-induced mutants (Table (Table2).2). This mutation gave rise to a change from serine to isoleucine at amino acid position 83. The exception was a mutation in the adjacent nucleotide that gave rise to a substitution of arginine for serine at the same amino acid position (Table (Table2).2). All the isolates that were resistant to the quinolone NAL had a unique mutation in the gyrA gene, irrespective of whether resistance was acquired naturally or in the laboratory (Table (Table2).2). This result strongly suggests that a point mutation in gyrA that gives rise to a change in nucleotide position 83 can confer resistance to NAL in V. vulnificus biotypes 1 and 2 and that this mutation could be produced by selective pressure under natural conditions. gyrA mutations consisting of a change from serine 83 to isoleucine have also been described in isolates of Aeromonas from water (17) and in diseased fish isolates of Vibrio anguillarum (26). Similarly, replacement of serine by arginine at amino acid position 83 in diseased fish isolates of Yersinia ruckeri (16) suggests that this mechanism of quinolone resistance is widespread among gram-negative pathogens. In all cases, these single mutations were also related to increased resistance to other quinolones (OA) and fluoroquinolones (UB and CIP) (Table (Table2),2), although the mutants remained sensitive according to the standards of the Clinical and Laboratory Standards Institute and the European Committee for Antimicrobial Susceptibility Testing of the European Society of Clinical Microbiology and Infectious Diseases (9, 13). A total of 50% of the naturally resistant strains, all of them of biotype 1, showed additional mutations that affected parC (a change in amino acid position 113) or gyrB (changes in amino acids at positions 425 and 438) (Table (Table2).2). These strains exhibited higher MICs for OA and fluoroquinolones (Table (Table2),2), although they were still sensitive to these drugs (9, 13). Finally, one isolate of biotype 2, serovar E, which was naturally resistant to quinolones and UB, showed a mutation in parC that gave rise to a substitution of leucine for serine at amino acid position 85 (Table (Table2).2). This mutation was shared only with the laboratory-induced mutant, also a biotype 2, serovar E mutant, which was resistant to the fluoroquinolone UB. The same mutation in parC had been previously described in diseased fish isolates of V. anguillarum that were highly resistant to quinolones (28), but this had not been related to fluoroquinolone resistance in Vibrio spp. nor in other gram-negative bacteria. These results strongly suggest that resistance to fluoroquinolones in V. vulnificus is related to specific mutations in gyrA and parC and that mutations in different positions for parC or in gyrB could contribute to increased resistance to quinolones and fluoroquinolones. Our results also agree with previous studies confirming that the acquisition of higher quinolone resistance is more probable when arising from a gyrA parC double mutation than from a gyrA gyrB double mutation (29).

TABLE 3.

Oligonucleotides used in this study
PrimerSequenceAnnealing temp (°C)Size (bp)
GyrAFGGCAACGACTGGAATAAACC55.8416
GyrARCAGCCATCAATCACTTCCGTC
ParCFCGCAAGTTCACCGAAGATGC56.6411
ParCRGGCATCCGCAACTTCACG
GyrBFCGACTTCTGGTGACGATGCG57.4642
GyrBRGACCGATACCACAACCTAGTG
ParEFGCCAGGTAAGTTGACCGATTG56.8512
ParERCACCCAGACCTTTGAATCGTTG
Open in a separate windowFinally, the evolutionary history for each protein was inferred from previously published DNA sequences of the whole genes from different Vibrio species after multiple sequence alignment with MEGA4 software (32) by applying the neighbor-joining method (30) with the Poisson correction (35). The distance tree for each whole protein showed a topology similar to the phylogenetic tree based on 16S rRNA analysis, with the two isolates of V. vulnificus forming a single group, closely related to Vibrio parahaemolyticus, Vibrio cholerae, V. anguillarum, and Vibrio harveyi (see Fig. S1A in the supplemental material). A second analysis was performed with the QRDR sequences of the different mutants and isolates of V. vulnificus (GenBank accession numbers FJ379836 to FJ379927) to infer the intraspecies relationships (see Fig. S1B in the supplemental material). This analysis showed that QRDRs of gyrA, gyrB, parC, and parE were highly homogeneous within V. vulnificus.In summary, the zoonotic serovar of V. vulnificus can mutate spontaneously to gain quinolone resistance, under selective pressure in vitro, due to specific mutations in gyrA that involve a substitution of isoleucine for serine at amino acid position 83. This mutation appears in biotype 2, serovar E diseased-fish isolates and biotype 1 strains, mostly recovered from fish farms. An additional mutation in parC, resulting in a substitution of lysine for serine at amino acid position 85, seems to endow partial fluoroquinolone resistance on biotype 2, serovar E strains. This kind of double mutation is present in diseased-fish isolates of the zoonotic serovar but not in resistant biotype 1 isolates, which show different mutations in gyrB or in parC that increase their resistance levels but do not make the strains resistant to fluoroquinolones. Thus, antibiotics other than quinolones should be used at fish farms to prevent the emergence and spread of quinolone resistances, especially to CIP, a drug widely recommended for human vibriosis treatment.  相似文献   

20.
Identification of a Polyketide Synthase Coding Sequence Specific for Anatoxin-a-Producing Oscillatoria Cyanobacteria     
Sabrina Cadel-Six  Isabelle Iteman  Caroline Peyraud-Thomas  Stéphane Mann  Olivier Ploux  Annick Méjean 《Applied and environmental microbiology》2009,75(14):4909-4912
  相似文献   

设为首页 | 免责声明 | 关于勤云 | 加入收藏

Copyright©北京勤云科技发展有限公司  京ICP备09084417号