A specific internal RNA polymerase recognition site of VSV RNA is involved in the generation of DI particles.

The 3′ terminal sequences of four different DI particle RNAs ranging in size from 10S to 30S have been determined directly using rapid RNA sequencing methods or deduced, in the case of the fourth DI RNA, from the complementary sequence of a small RNA transcribed from this part of the genome (Schubert et al., 1978). One DI particle (DI 011) contains covalently linked genomic and antigenomic RNA. The 5′ end of this RNA is identical to that of VSV RNA, as determined by annealing for at least 1 kb, as well as to the other DI particle RNAs used in this study. The 3′ ends of the other three DI particle RNAs are exact copies of the common 5′ terminal sequence for 48 nucleotides in two cases and 45 nucleotides in the third. Beyond these complementary regions the sequences are different for each DI RNA. The fact that these regions differ in length by only three nucleotides, despite the wide differences in the overall size of the DI particle RNAs, indicates that if these DIs were formed by the copy-back mechanisms similar to those proposed by Leppert, Kort and Kolakofsky (1977) and Huang (1977), a specific recognition site for the RNA polymerase must be involved in copying the 5′ terminus. We determined the 5′ terminal sequence from position 43–48 at the end of the complementary region and found it to be 5′-GGUCUU-3′. This hexamer is also part of other highly conserved terminal RNA polymerase initiation sites (Keene et al., 1978; Keene, Schubert and Lazzarini, 1979) and may be a specific internal RNA polymerase recognition site. We conclude that this sequence is one of the elements involved in the genesis of DI particle chromosomes containing short complementary sequences at their termini. The ability of the polymerase to resume synthesis at or near a specific recognition site is discussed.     

Common and distinct regions of defective-interfering RNAs of Sindbis virus

Defective-interfering (DI) particles are helper-dependent deletion mutants which interfere specifically with the replication of the homologous standard virus. Serial passaging of alphaviruses in cultured cells leads to the accumulation of DI particles whose genomic RNAs are heterogeneous in size and sequence composition. In an effort to examine the sequence organization of an individual DI RNA species generated from Sindbis virus, we isolated and sequenced a representative cDNA clone derived from a Sindbis DI RNA population. Our data showed that: (i) the 3' end of the DI RNA template was identical to the 50 nucleotides at the 3' end of the standard RNA; (ii) the majority (75%) of the DI RNA template was derived from the 1,200 5'-terminal nucleotides of the standard RNA and included repeats of these sequences; and (iii) the 5' end of the DI RNA template was not derived from the standard RNA, but is nearly identical to a cellular tRNAAsp (S. S. Monroe and S. Schlesinger, Proc. Natl. Acad. Sci. U.S.A. 80:3279-3283, 1983). We have also utilized restriction fragments from cloned DNAs to probe by blot hybridization for the presence of conserved sequences in several independently derived DI RNA populations. These studies indicated that: (i) a 51-nucleotide conserved sequence located close to the 5' end of several alphavirus RNAs was most likely retained in the DI RNAs; (ii) the junction region containing the 5' end of the subgenomic 26S mRNA was deleted from the DI RNAs; and (iii) the presence of tRNAAsp sequences was a common occurrence in Sindbis virus DI RNAs derived by passaging in chicken embryo fibroblasts.     

Extreme ends of the genome are conserved and rearranged in the defective interfering RNAs of semliki forest virus

We have analyzed Semliki Forest virus defective interfering RNA molecules, generated by serial undiluted passaging of the virus in baby hamster kidney cells. The 42 S RNA genome (about 13 kb ²) has been greatly deleted to generate the DI RNAs, which are heterogeneous both in size (about 2 kb) and sequence content. The DI RNAs offer a system for exploring binding sites for RNA polymerase and encapsidation signals, which must have been conserved in them since they are replicated and packaged. In order to study the structural organization of DI RNAs, and to analyze which regions from the genome have been conserved, we have determined the nucleotide sequences of (1) a 2.3 kb long DI RNA molecule, DI309, (2) 3′-terminal sequences (each about 0.3 kb) of two other DI RNAs, and (3) the nucleotide sequence of 0.4 kb at the extreme 5′ end of the 42 S RNA genome.The DI309 molecule consists of a duplicated region with flanking unique terminal sequences. A 273-nucleotide sequence is present in four copies per molecule. The extreme 5′-terminal nucleotide sequence of the 42 S RNA genome is shown to contain domains that are conserved in the two DI RNAs of known structure: DI309, and the previously sequenced DI301 (Lehtovaara et al., 1981). Here we report which terminal genome sequences are conserved in the DI RNAs, and how they have been modified, rearranged or amplified.     

Studies of defective interfering RNAs of Sindbis virus with and without tRNAAsp sequences at their 5'' termini.

Three of six independently derived defective interfering (DI) particles of Sindbis virus generated by high-multiplicity passaging in cultured cells have tRNAAsp sequences at the 5' terminus of their RNAs (Monroe and Schlesinger, J. Virol. 49:865-872, 1984). In the present work, we found that the 5'-terminal sequences of the three tRNAAsp-negative DI RNAs were all derived from viral genomic RNA. One DI RNA sample had the same 5'-terminal sequence as the standard genome. The DI RNAs from another DI particle preparation were heterogeneous at the 5' terminus, with the sequence being either that of the standard 5' end or rearrangements of regions near the 5' end. The sequence of the 5' terminus of the third DI RNA sample consisted of the 5' terminus of the subgenomic 26S mRNA with a deletion from nucleotides 24 to 67 of the 26S RNA sequence. These data showed that the 5'-terminal nucleotides can undergo extensive variations and that the RNA is still replicated by virus-specific enzymes. DI RNAs of Sindbis virus evolve from larger to smaller species. In the two cases in which we followed the evolution of DI RNAs, the appearance of tRNAAsp-positive molecules occurred at the same time as did the emergence of the smaller species of DI RNAs. In pairwise competition experiments, one of the tRNAAsp-positive DI RNAs proved to be the most effective DI RNA, but under identical conditions, a second tRNAAsp-positive DI RNA was unable to compete with the tRNAAsp-negative DIs. Therefore, the tRNAAsp sequence at the 5' terminus of a Sindbis DI RNA is not the primary factor in determining which DI RNA becomes the predominant species in a population of DI RNA molecules.     

In vitro construction of poliovirus defective interfering particles.

To construct poliovirus defective interfering (DI) particles in vitro, we synthesized an RNA from a cloned poliovirus cDNA, pSM1(T7)1, which carried a deletion in the genome region corresponding to nucleotide positions 1663 to 2478 encoding viral capsid proteins, by using bacteriophage T7 RNA polymerase. The RNA was designed to retain the correct reading frame in nucleotide sequence downstream of the deletion. HeLa S3 monolayer cells were transfected with the deletion RNA and then superinfected with standard virus as a helper. The DI RNA was observed in the infected cells after three passages at high multiplicity of infection. The sequence analysis of RNA extracted from the purified DI particle clearly showed that this DI RNA had the same deletion in size and location as that in the RNA used for the transfection. Thus, we succeeded in construction of a poliovirus DI particle in vitro. To gain insight into the mechanism for DI generation, we constructed poliovirus cDNAs pSM1(T7)1a and pSM1(T7)1b that, in addition to the same deletion as that in pSM1(T7)1, had insertion sequences of 4 bases and 12 bases, respectively, at the corresponding nucleotide position, 2978. The RNA transcribed from pSM1(T7)1a was not a template for synthesis of poliovirus nonstructural proteins and therefore was inactive as an RNA replicon. On the other hand, the RNA from pSM1(T7)1b replicated properly in the transfected cells. Superinfection of the transfected cells with standard virus resulted in production of DI particles derived from pSM1(T7)1b and not from pSM1(T7)1a. These observations indicate that deletion RNAs that are inactive replicons have little or no possibility of being genomes of DI particles suggesting the existence of a nonstructural protein(s) that has an inclination to function as a cis-acting protein(s). The method described here will provide a useful technique to investigate genetic information essential for poliovirus replication.     

High-frequency leader sequence switching during coronavirus defective interfering RNA replication.

A system was developed that exploited defective interfering (DI) RNAs of coronavirus to study the role of free leader RNA in RNA replication. A cDNA copy of mouse hepatitis virus DI RNA was placed downstream of the T7 RNA polymerase promoter to generate DI RNAs capable of extremely efficient replication in the presence of a helper virus. We demonstrated that, in the DI RNA-transfected cells, the leader sequence of these DI RNAs was switched to that of the helper virus during one round of replication. This high-frequency leader sequence exchange was not observed if a nine-nucleotide stretch of sequence (UUUAUAAAC) at the junction between the leader and the remaining DI sequence was deleted. This observation suggests that a free leader RNA generated from the genomic RNA of mouse hepatitis virus may participate in the replication of DI RNA.     

Identification and characterization of a coronavirus packaging signal.

Previously, a mouse hepatitis virus (MHV) genomic sequence necessary for defective interfering (DI) RNA packaging into MHV particles (packaging signal) was mapped to within a region of 1,480 nucleotides in the MHV polymerase gene by comparison of two DI RNAs. One of these, DIssF, is 3.6 kb in size and exhibits efficient packaging, whereas the other, DIssE, which is 2.3 kb, does not. For more precise mapping, a series of mutant DIssF RNAs with deletions within this 1,480-nucleotide region were constructed. After transfection of in vitro-synthesized mutant DI RNA in MHV-infected cells, the virus product was passaged several times. The efficiency of DI RNA packaging into MHV virions was then estimated by viral homologous interference activity and by analysis of intracellular virus-specific RNAs and virion RNA. The results indicated that an area of 190 nucleotides was necessary for packaging. A computer-generated secondary structural analysis of the A59 and JHM strains of MHV demonstrated that within this 190-nucleotide region a stable stem-loop of 69 nucleotides was common between the two viruses. A DIssE-derived DI DNA which had these 69 nucleotides inserted into the DIssE sequence demonstrated efficient DI RNA packaging. Site-directed mutagenic analysis showed that of these 69 nucleotides, the minimum sequence of the packaging signal was 61 nucleotides and that destruction of the secondary structure abolished packaging ability. These studies demonstrated that an MHV packaging signal was present within the 61 nucleotides, which are located on MHV genomic RNA 1,381 to 1,441 nucleotides upstream of the 3' end of gene 1.     

Structure and origin of a snapback defective interfering particle RNA of vesicular stomatitis virus

The nucleotide sequence of the region which covalently links the complementary strands of the "snapback" RNA of vesicular stomatitis virus, DI011, is (Formula: see text). Both strands of the defective interfering (DI) particle RNA were complementary for their full length and were covalently linked by a single phosphate group. Because the strands were exactly the same length and complementary, template strand and daughter strand nucleocapsids generated during replication of DI 011 were undistinguishable on the basis of sequence, a property not shared by other types of DI particle RNAs. Treatment of the RNA with RNase T1 in high-ionic-strength solutions cleaved the RNA only between positions 1 and 1'. These results and the availability of the guanosine residue in position 1' to kethoxal, a reagent that specifically derivatizes guanosines of single-stranded RNA, suggest that steric constraints keep a small portion of the "turnaround" region in an open configuration. The sequence of the turnaround region was not related in any obvious way to the sequences at the 3' and 5' termini and limited the number of possible models for the origin of this type of DI particle RNA. Two models for the genesis of DI 011 RNA are discussed. We favor one in which the progenitor DI 011 RNA was generated by replication across a nascent replication fork.     

The complete sequence of a unique RNA species synthesized by a DI particle of VSV.

The 2S RNA synthesized in vitro by the RNA polymerase of a defective interfering (DI) particle of vesicular stomatitis virus was labeled at its 3' terminus with 32P-cytidine 3', 5' bisphosphate and RNA ligase. Analysis of the labeled RNA showed that it was a family of RNAs of different length but all sharing the same 5' terminal sequence. The largest labeled RNA was purified by gel electrophoresis, and the sequence of 41 of its 46 nucleotides was determined by rapid RNA sequencing methods. The assignment of the remaining 5 nucleotides was made on the basis of an analysis of one of the smaller RNAs and published data. A new approach in RNA sequencing based on the identification of 3' terminal nucleotides of rna fragments originally present in the DI product or generated during the ligation reaction confirmed most of the sequence. The complete sequence of this 46 nucleotide long plus-sense RNA is: ppACGAAGACCACAAAACCAGAUAAAAAA UAAAAACCACAAGAGGGUC-OH. This RNA anneals to the RNA of the DI particle from which it was synthesized, indicating that its synthesis is template-specified. At least the first 17 and possibly all of the nucleotides are also complementary to sequences at the 3' end of two other VSV DI particles which were derived independently and whose genomes differ significantly in length. These data suggest a common 3' terminal sequence among all VSV DI particles which contain part of the Lgene region of the parental genome.     

The nucleotide sequence of the 5'' terminus of vesicular stomatitis virus RNA.

We have determined the nucleotide sequence for the first 50 nucleotides at the 5' terminus of vesicular stomatitis virus (VSV) genome RNA. This sequence is identical to that of the in vitro RNA polymerase product synthesized by defective interfering (DI) particles of VSV. These results confirm previous conclusions rengarding DI and standard viral terminal sequences based on hybridization studies and earlier sequencing of the DI polymerase product RNA.     

Serial passage of tobacco rattle virus under different selection conditions results in deletion of structural and nonstructural genes in RNA 2.

The RNA genome of tobacco rattle virus (TRV) is bipartite. RNA 2 of the nematode-transmissible TRV isolate PPK20 encodes the viral coat protein (cp) and proteins with molecular weights of 29,400 and 32,800 (29.4K and 32.8K proteins). When this isolate was serially passaged in tobacco by using phenol-extracted RNA as the inoculum in each transfer, defective interfering (DI) RNAs rapidly accumulated. A number of these DI RNAs were cloned. Six DI RNAs had single internal deletions in RNA 2 that removed most of the cp gene, the 29.4K gene, and the 5' half of the 32.8K gene. The borders of the deletions in these DI RNAs were found to be flanked in the genomic RNA 2 by short nucleotide repeats or sequences resembling the 5' end of TRV genomic and subgenomic RNAs. Two DI RNAs were found to be recombinants containing a 5' sequence derived from RNA 2 and a 3' sequence derived from RNA 1. When serial passage of TRV isolate PPK20 was carried out by using leaf homogenates as inocula in each transfer, accumulation of a DI RNA (designated D7) with a functional cp gene was observed. The deletion in D7 covered the 3' end of the cp gene, the 29.4K gene, and the 5' half of the 32.8K gene. An infectious cDNA clone of D7 RNA was made. In mixed infections, D7 RNA rapidly outcompeted RNA 2 but did not compete with RNA 1. The deletion in D7 RNA abolished the nematode transmissibility of the PPK20 isolate. These results may explain the observation that many laboratory isolates of tobraviruses have lost their nematode transmissibility and contain RNA 2 molecules of widely different lengths.