Ablation of LKB1 in the heart leads to energy deprivation and impaired cardiac function

Energy deprivation in the myocardium is associated with impaired heart function and increased morbidity. LKB1 is a kinase that is required for activation of AMP-activated protein kinase (AMPK) as well as 13 AMPK-related protein kinases. AMPK stimulates ATP production during ischemia and prevents post-ischemic dysfunction. We used the Cre–Lox system to generate mice where LKB1 was selectively knocked out in cardiomyocytes and muscle cells (LKB1-KO) to assess the role of LKB1 on cardiac function in these mice.Heart rates of LKB1-KO mice were reduced and ventricle diameter was increased. Ex vivo, cardiac function was impaired during aerobic perfusion of isolated working hearts, and recovery of function after ischemia was reduced. Although oxidative metabolism and mitochondrial function were normal, the AMP/ATP ratio was increased in LKB1-KO hearts. This was associated with a complete ablation of AMPKα2 activity, and a stimulation of signaling through the mammalian target of rapamycin. Our results establish a critical role for LKB1 for normal cardiac function under both aerobic conditions and during recovery after ischemia. Ablation of LKB1 leads to a decreased cardiac efficiency despite normal mitochondrial oxidative metabolism.     

Deficiency of LKB1 in heart prevents ischemia-mediated activation of AMPKalpha2 but not AMPKalpha1

Recent studies indicate that the LKB1 is a key regulator of the AMP-activated protein kinase (AMPK), which plays a crucial role in protecting cardiac muscle from damage during ischemia. We have employed mice that lack LKB1 in cardiac and skeletal muscle and studied how this affected the activity of cardiac AMPKalpha1/alpha2 under normoxic, ischemic, and anoxic conditions. In the heart lacking cardiac muscle LKB1, the basal activity of AMPKalpha2 was vastly reduced and not increased by ischemia or anoxia. Phosphorylation of AMPKalpha2 at the site of LKB1 phosphorylation (Thr172) or phosphorylation of acetyl-CoA carboxylase-2, a downstream substrate of AMPK, was ablated in ischemic heart lacking cardiac LKB1. Ischemia was found to increase the ADP-to-ATP (ADP/ATP) and AMP-to-ATP ratios (AMP/ATP) to a greater extent in LKB1-deficient cardiac muscle than in LKB1-expressing muscle. In contrast to AMPKalpha2, significant basal activity of AMPKalpha1 was observed in the lysates from the hearts lacking cardiac muscle LKB1, as well as in cardiomyocytes that had been isolated from these hearts. In the heart lacking cardiac LKB1, ischemia or anoxia induced a marked activation and phosphorylation of AMPKalpha1, to a level that was only moderately lower than observed in LKB1-expressing heart. Echocardiographic and morphological analysis of the cardiac LKB1-deficient hearts indicated that these hearts were not overtly dysfunctional, despite possessing a reduced weight and enlarged atria. These findings indicate that LKB1 plays a crucial role in regulating AMPKalpha2 activation and acetyl-CoA carboxylase-2 phosphorylation and also regulating cellular energy levels in response to ischemia. They also provide genetic evidence that an alternative upstream kinase can activate AMPKalpha1 in cardiac muscle.     

Myocardial ischemia differentially regulates LKB1 and an alternate 5'-AMP-activated protein kinase kinase

During myocardial ischemia, activation of 5'-AMP-activated protein kinase (AMPK) leads to the stimulation of glycolysis and fatty acid oxidation. Together these metabolic changes contribute to cardiac dysfunction. Although AMPK signaling in the ischemic heart is well characterized, the relative contribution of phosphorylation by AMPK kinase (AMPKK), and positive allosterism by the ratios of AMP:ATP and creatine (Cr):phosphocreatine (PCr), in stimulating AMPK during ischemia are unknown. In hearts subjected to severe ischemia, the ratios of AMP:ATP and Cr:PCr were significantly elevated as compared with aerobic hearts. Severe ischemia stimulated AMPK signaling, as demonstrated by an increase in both AMPK activity and acetyl-CoA carboxylase phosphorylation. Although AMPK phosphorylation was increased by severe ischemia, the protein abundance and activity of the recently identified AMPKK, LKB1, were similar between aerobic and severely ischemic hearts. However, in contrast to LKB1, the activity of AMPKK was stimulated in severely ischemic hearts. To further delineate the relative roles of positive allosterism and AMPKK in the regulation of AMPK during ischemia, hearts were subjected to mild ischemia. Although mild ischemia did not alter the ratios of AMP:ATP and Cr:PCr, mild ischemia increased AMPK activity and increased AMPK phosphorylation. Mild ischemia also stimulated the activity of AMPKK. In summary, we demonstrate that myocardial ischemia stimulates AMPK via an AMPKK other than LKB1. Additionally, we show that changes in high energy phosphates are not essential for the activation of AMPK by ischemia. Our data emphasize the critical role AMPKK plays in mediating AMPK signaling during myocardial ischemia.     

Evidence against regulation of AMP-activated protein kinase and LKB1/STRAD/MO25 activity by creatine phosphate

Muscle contraction results in phosphorylation and activation of the AMP-activated protein kinase (AMPK) by an AMPK kinase (AMPKK). LKB1/STRAD/MO25 (LKB1) is the major AMPKK in skeletal muscle; however, the activity of LKB1 is not increased by muscle contraction. This finding suggests that phosphorylation of AMPK by LKB1 is regulated by allosteric mechanisms. Creatine phosphate is depleted during skeletal muscle contraction to replenish ATP. Thus the concentration of creatine phosphate is an indicator of cellular energy status. A previous report found that creatine phosphate inhibits AMPK activity. The purpose of this study was to determine whether creatine phosphate would inhibit 1) phosphorylation of AMPK by LKB1 and 2) AMPK activity after phosphorylation by LKB1. We found that creatine phosphate did not inhibit phosphorylation of either recombinant or purified rat liver AMPK by LKB1. We also found that creatine phosphate did not inhibit 1) active recombinant alpha1beta1gamma1 or alpha2beta2gamma2 AMPK, 2) AMPK immunoprecipitated from rat liver extracts by either the alpha1 or alpha2 subunit, or 3) AMPK chromatographically purified from rat liver. Inhibition of skeletal muscle AMPK by creatine phosphate was greatly reduced or eliminated with increased AMPK purity. In conclusion, these results suggest that creatine phosphate is not a direct regulator of LKB1 or AMPK activity. Creatine phosphate may indirectly modulate AMPK activity by replenishing ATP at the onset of muscle contraction.     

eNOS activation mediated by AMPK after stimulation of endothelial cells with histamine or thrombin is dependent on LKB1

Reports on the role of AMP-activated protein kinase (AMPK) in thrombin-mediated activation of endothelial nitric-oxide synthase (eNOS) in endothelial cells have been conflicting. Previously, we have shown that under culture conditions that allow reduction of ATP-levels after stimulation, activation of AMPK contributes to eNOS phosphorylation and activation in endothelial cells after treatment with thrombin. In this paper we examined the signaling pathways mediating phosphorylation and activation of eNOS after stimulation of cultured human umbilical vein endothelial cells (HUVEC) with histamine and the role of LKB1-AMPK in the signaling. In Morgan's medium 199 intracellular ATP was lowered by treatment with histamine or the ionophore A23187 while in medium RMPI 1640 ATP was unchanged after identical treatment. In medium 199 inhibition of Ca^+ 2/CaM kinase kinase (CaMKK) by STO-609 only partially inhibited AMPK phosphorylation but after gene silencing of LKB1 with siRNA there was a total inhibition of AMPK phosphorylation by STO-609 after treatment with either histamine or thrombin, demonstrating phosphorylation of AMPK by both upstream kinases, LKB1 and CaMKK. Downregulation of AMPK with siRNA partially inhibited eNOS phosphorylation caused by histamine in cells maintained in medium 199. Downregulation of LKB1 by siRNA inhibited both phosphorylation and activity of eNOS and addition of the AMPK inhibitor Compound C had no further effect on eNOS phosphorylation. When experiments were carried out in medium 1640, STO-609 totally prevented the phosphorylation of AMPK without affecting eNOS phosphorylation. AMPKα2 downregulation resulted in a loss of the integrity of the endothelial monolayer and increased expression of GRP78, indicative of endoplasmic reticular (ER) stress. Downregulation of AMPKα1 had no such effect. The results show that culture conditions affect endothelial signal transduction pathways after histamine stimulation. Under conditions where intracellular ATP is lowered by histamine, AMPK is activated by both LKB1 and CaMKK and, in turn, mediates eNOS phosphorylation in an LKB1 dependent manner. Both AMPKα1 and − α2 are involved in the signaling. Under conditions where intracellular ATP is unchanged after histamine treatment, CaMKK alone activates AMPK and eNOS is phosphorylated and activated independent of AMPK.     

Activation of the PI3K/mTOR Pathway following PARP Inhibition in Small Cell Lung Cancer

Small cell lung cancer (SCLC) is an aggressive malignancy with limited treatment options. We previously found that PARP is overexpressed in SCLC and that targeting PARP reduces cell line and tumor growth in preclinical models. However, SCLC cell lines with PI3K/mTOR pathway activation were relatively less sensitive to PARP inhibition. In this study, we investigated the proteomic changes in PI3K/mTOR and other pathways that occur following PAPR inhibition and/or knockdown in vitro and in vivo. Using reverse-phase protein array, we found the proteins most significantly upregulated following treatment with the PARP inhibitors olaparib and rucaparib were in the PI3K/mTOR pathway (p-mTOR, p-AKT, and pS6) (p≤0.02). Furthermore, amongst the most significantly down-regulated proteins were LKB1 and its targets AMPK and TSC, which negatively regulate the PI3K pathway (p≤0.042). Following PARP knockdown in cell lines, phosphorylated mTOR, AKT and S6 were elevated and LKB1 signaling was diminished. Global ATP concentrations increased following PARP inhibition (p≤0.02) leading us to hypothesize that the observed increased PI3K/mTOR pathway activation following PARP inhibition results from decreased ATP usage and a subsequent decrease in stress response signaling via LKB1. Based on these results, we then investigated whether co-targeting with a PARP and PI3K inhibitor (BKM-120) would work better than either single agent alone. A majority of SCLC cell lines were sensitive to BKM-120 at clinically achievable doses, and cMYC expression was the strongest biomarker of response. At clinically achievable doses of talazoparib (the most potent PARP inhibitor in SCLC clinical testing) and BKM-120, an additive effect was observed in vitro. When tested in two SCLC animal models, a greater than additive interaction was seen (p≤0.008). The data presented here suggest that combining PARP and PI3K inhibitors enhances the effect of either agent alone in preclinical models of SCLC, warranting further investigation of such combinations in SCLC patients.     

Deficiency of LKB1 in skeletal muscle prevents AMPK activation and glucose uptake during contraction

Recent studies indicate that the LKB1 tumour suppressor protein kinase is the major "upstream" activator of the energy sensor AMP-activated protein kinase (AMPK). We have used mice in which LKB1 is expressed at only approximately 10% of the normal levels in muscle and most other tissues, or that lack LKB1 entirely in skeletal muscle. Muscle expressing only 10% of the normal level of LKB1 had significantly reduced phosphorylation and activation of AMPKalpha2. In LKB1-lacking muscle, the basal activity of the AMPKalpha2 isoform was greatly reduced and was not increased by the AMP-mimetic agent, 5-aminoimidazole-4-carboxamide riboside (AICAR), by the antidiabetic drug phenformin, or by muscle contraction. Moreover, phosphorylation of acetyl CoA carboxylase-2, a downstream target of AMPK, was profoundly reduced. Glucose uptake stimulated by AICAR or muscle contraction, but not by insulin, was inhibited in the absence of LKB1. Contraction increased the AMP:ATP ratio to a greater extent in LKB1-deficient muscles than in LKB1-expressing muscles. These studies establish the importance of LKB1 in regulating AMPK activity and cellular energy levels in response to contraction and phenformin.     

A study of 45,X/46,XX mosaicism in Turner syndrome females: a novel primer pair for the (CAG)n repeat within the androgen receptor gene

This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome.     

ATP and MO25α Regulate the Conformational State of the STRADα Pseudokinase and Activation of the LKB1 Tumour Suppressor

Pseudokinases lack essential residues for kinase activity, yet are emerging as important regulators of signal transduction networks. The pseudokinase STRAD activates the LKB1 tumour suppressor by forming a heterotrimeric complex with LKB1 and the scaffolding protein MO25. Here, we describe the structure of STRADα in complex with MO25α. The structure reveals an intricate web of interactions between STRADα and MO25α involving the αC-helix of STRADα, reminiscent of the mechanism by which CDK2 interacts with cyclin A. Surprisingly, STRADα binds ATP and displays a closed conformation and an ordered activation loop, typical of active protein kinases. Inactivity is accounted for by nonconservative substitution of almost all essential catalytic residues. We demonstrate that binding of ATP enhances the affinity of STRADα for MO25α, and conversely, binding of MO25α promotes interaction of STRADα with ATP. Mutagenesis studies reveal that association of STRADα with either ATP or MO25α is essential for LKB1 activation. We conclude that ATP and MO25α cooperate to maintain STRADα in an “active” closed conformation required for LKB1 activation. It has recently been demonstrated that a mutation in human STRADα that truncates a C-terminal region of the pseudokinase domain leads to the polyhydramnios, megalencephaly, symptomatic epilepsy (PMSE) syndrome. We demonstrate this mutation destabilizes STRADα and prevents association with LKB1. In summary, our findings describe one of the first structures of a genuinely inactive pseudokinase. The ability of STRADα to activate LKB1 is dependent on a closed “active” conformation, aided by ATP and MO25α binding. Thus, the function of STRADα is mediated through an active kinase conformation rather than kinase activity. It is possible that other pseudokinases exert their function through nucleotide binding and active conformations.     

Insights into the structural dynamics of Liver kinase B1 (LKB1) by the binding of STe20 Related Adapterα (STRADα) and Mouse protein 25α (MO25α) co-activators

LKB1, the tumour suppressor, is found mutated in Peutz-Jeghers syndrome (PJS). The LKB1 is a serine-threonine kinase protein that is allosterically activated by the binding of STRADα and MO25α without phosphorylating the Thr212 present at activation loop. The present study aims to highlight the structural dynamics and complexation mechanism during the allosteric activation of LKB1 by these co-activators using molecular dynamics simulations. The all atom simulations performed on the complexes of LKB1 with ATP, STRADα, and MO25α for a period of 30 ns reveal that binding of STRADα and MO25α significantly stabilizes the highly flexible regions of LKB1 such as ATP binding region (β1-β2 loop), catalytic & activation loop segments and αG helix. Also, binding of STRADα and MO25α to LKB1 promotes coordinated motion between N- and C-lobes along with the catalytic & activation loops by forming H-bonds between LKB1 and co-activators, which further facilitate to establish the conserved attributes of active LKB1 such as (i) formation of salt bridge between Lys78 and Glu98, (ii) formation of stable hydrophobic R- and C-spines, and (iii) interaction between both catalytic and activation loops. Especially, the residues of LKB1 interacting with STRADα (Arg74, Glu342) and MO25α (Glu165, Pro203 and Phe204) are observed to play a significant role in stabilizing the (LKB1-ATP)-(STRADα-ATP)-MO25α complex. Overall, the present work highlighting the structural dynamics of LKB1 by the binding of allosteric co-activators is expected to provide a basic understanding on drug design specific to PJS syndrome.     

Bioluminescence Assay for Measuring the Number of Bacteria Adhering to the Hydrocarbon Phase in the BATH Test

A thorough validation of the bacterial adherence to hydrocarbons (BATH) test was performed by means of a bioluminescence assay. Ten different gram-negative strains were subjected to the BATH test. For the calculation of the adhesion index, several factors had to be taken into account: ATP leakage, the action of ATP-hydrolyzing enzymes, the change in the extraction efficiency of Nucleotide-Releasing Reagent for Microbial Cells (NRB; Lumac bv) after vortexing and the difference in light production after the addition of NRB. When the adhesion index values obtained by bioluminescence measurement were used as reference, the total plate count technique appeared to be unreliable in estimating the number of bacteria adhering to the hydrocarbon phase. A highly significant correlation was established, however, between those reference values and the adhesion index values obtained by the optical density reading for octane and especially for hexadecane. With xylene, no correlation was found between the optical density reading values and the total plate count or bioluminescence values.     

ATP and MO25α Regulate the Conformational State of the STRADα Pseudokinase and Activation of the LKB1 Tumour Suppressor

Pseudokinases lack essential residues for kinase activity, yet are emerging as important regulators of signal transduction networks. The pseudokinase STRAD activates the LKB1 tumour suppressor by forming a heterotrimeric complex with LKB1 and the scaffolding protein MO25. Here, we describe the structure of STRADα in complex with MO25α. The structure reveals an intricate web of interactions between STRADα and MO25α involving the αC-helix of STRADα, reminiscent of the mechanism by which CDK2 interacts with cyclin A. Surprisingly, STRADα binds ATP and displays a closed conformation and an ordered activation loop, typical of active protein kinases. Inactivity is accounted for by nonconservative substitution of almost all essential catalytic residues. We demonstrate that binding of ATP enhances the affinity of STRADα for MO25α, and conversely, binding of MO25α promotes interaction of STRADα with ATP. Mutagenesis studies reveal that association of STRADα with either ATP or MO25α is essential for LKB1 activation. We conclude that ATP and MO25α cooperate to maintain STRADα in an “active” closed conformation required for LKB1 activation. It has recently been demonstrated that a mutation in human STRADα that truncates a C-terminal region of the pseudokinase domain leads to the polyhydramnios, megalencephaly, symptomatic epilepsy (PMSE) syndrome. We demonstrate this mutation destabilizes STRADα and prevents association with LKB1. In summary, our findings describe one of the first structures of a genuinely inactive pseudokinase. The ability of STRADα to activate LKB1 is dependent on a closed “active” conformation, aided by ATP and MO25α binding. Thus, the function of STRADα is mediated through an active kinase conformation rather than kinase activity. It is possible that other pseudokinases exert their function through nucleotide binding and active conformations.     

Characterization of the liver kinase B1-mouse protein-25 -Ste-20-related adaptor protein complex in adult mouse skeletal muscle

In liver, the AMP-activated protein kinase kinase (AMPKK) complex was identified as the association of liver kinase B1 (LKB1), mouse protein 25 (MO25α/β), and Ste-20-related adaptor protein (STRADα/β); however, this complex has yet to be characterized in skeletal muscle. We demonstrate the expression of the LKB1-MO25-STRAD complex in skeletal muscle, confirm the absence of mRNA splice variants, and report the relative mRNA expression levels of these proteins in control and muscle-specific LKB1 knockout (LKB1(-/-)) mouse muscle. LKB1 detection in untreated control and LKB1(-/-) muscle lysates revealed two protein bands (50 and 60 kDa), although only the heavier band was diminished in LKB1(-/-) samples [55 ± 2.5 and 13 ± 1.5 arbitrary units (AU) in control and LKB1(-/-), respectively, P < 0.01], suggesting that LKB1 is not represented at 50 kDa, as previously cited. The 60-kDa LKB1 band was further confirmed following purification using polyethylene glycol (43 ± 5 and 8.4 ± 4 AU in control and LKB1(-/-), respectively, P < 0.01) and ion-exchange fast protein liquid chromatography. Mass spectrometry confirmed LKB1 protein detection in the 60-kDa protein band, while none was detected in the 50-kDa band. Coimmunoprecipitation assays demonstrated LKB1-MO25-STRAD complex formation. Quantitative PCR revealed significantly reduced LKB1, MO25α, and STRADβ mRNA in LKB1(-/-) muscle. These findings demonstrate that the LKB1-MO25-STRAD complex is the principal AMPKK in skeletal muscle.     

Rottlerin activates AMPK possibly through LKB1 in vascular cells and tissues

AMP-activated protein kinase (AMPK) is a cellular energy sensor involved in multiple cell signaling pathways that has become an attractive therapeutic target for vascular diseases. It is not clear whether rottlerin, an inhibitor of protein kinase Cδ, activates AMPK in vascular cells and tissues. In the present study, we have examined the effect of rottlerin on AMPK in vascular smooth muscle cells (VSMCs) and isolated rabbit aorta. Rottlerin reduced cellular ATP and activated AMPK in VSMCs and rabbit aorta; however, inhibition of PKCδ by three different methods did not activate AMPK. Both VSMCs and rabbit aorta expressed the upstream AMPK kinase LKB1 protein, and rottlerin-induced AMPK activation was decreased in VSMCs by overexpression of dominant-negative LKB1, suggesting that LKB1 is involved in the upstream regulation of AMPK stimulated by rottlerin. These data suggest for the first time that LKB1 mediates rottlerin-induced activation of AMPK in vascular cells and tissues.     

Correlation of staining for LKB1 and COX-2 in hamartomatous polyps and carcinomas from patients with Peutz-Jeghers syndrome.

Germline mutations of the LKB1 gene lead to Peutz-Jeghers syndrome (PJS), which is associated with a predisposition to gastrointestinal polyposis and cancer. In this study we tested for germline mutations of LKB1 in 11 patients with PJS from nine families and analyzed the expression patterns of the LKB1 and cyclo-oxygenase-2 (COX-2) proteins in 28 Peutz-Jeghers polyps (PJPs) and five carcinomas from these patients by immunohistochemical (IHC) analysis. In eight of those families we identified seven different mutations, which consisted of two splice site mutations, two nonsense mutations, one small in-frame deletion, one frame-shift mutation, and one silent mutation. Immunostaining revealed nuclear and cytoplasmic expression of LKB1 protein in 23 PJPs and five carcinomas, nuclear expression alone in one PJP, and loss of LKB1 protein expression in four PJPs, indicating a heterogeneous LKB1 expression pattern in PJPs. Overexpression of COX-2 was detected in 23 (82%) of 28 PJPs and in all carcinomas. Despite heterogeneity in staining of LKB1 among individuals and even among samples from the same individual, we found statistically significant correlations in staining of LKB1 relative to COX-2. These results suggest that COX-2 plays a role in tumorigenesis in PJS and may therefore be considered as a potential target for PJS chemoprevention.     

Endurance training increases LKB1 and MO25 protein but not AMP-activated protein kinase kinase activity in skeletal muscle

LKB1 complexed with MO25 and STRAD has been identified as an AMP-activated protein kinase kinase (AMPKK). We measured relative LKB1 protein abundance and AMPKK activity in liver (LV), heart (HT), soleus (SO), red quadriceps (RQ), and white quadriceps (WQ) from sedentary and endurance-trained rats. We examined trained RQ for altered levels of MO25 protein and LKB1, STRAD, and MO25 mRNA. LKB1 protein levels normalized to HT (1 +/- 0.03) were LV (0.50 +/- 0.03), SO (0.28 +/- 0.02), RQ (0.32 +/- 0.01), and WQ (0.12 +/- 0.03). AMPKK activities in nanomoles per gram per minute were HT (79 +/- 6), LV (220 +/- 9), SO (22 +/- 2), RQ (29 +/- 2), and WQ (42 +/- 4). Training increased LKB1 protein in SO, RQ, and WQ (P < 0.05). LKB1 protein levels after training (%controls) were SO (158 +/- 17), RQ (316 +/- 17), WQ (191 +/- 27), HT (106 +/- 2), and LV (104 +/- 7). MO25 protein after training (%controls) was 595 +/- 71. Training did not affect AMPKK activity. MO25 but not LKB1 or STRAD mRNA increased with training (P < 0.05). Trained values (%controls) were MO25 (164 +/- 22), LKB1 (120 +/- 16), and STRAD (112 +/- 17). LKB1 protein content strongly correlated (r = 0.93) with citrate synthase activity in skeletal muscle (P < 0.05). In conclusion, endurance training markedly increased skeletal muscle LKB1 and MO25 protein without increasing AMPKK activity. LKB1 may be playing multiple roles in skeletal muscle adaptation to endurance training.     

Phosphorylation of the protein kinase mutated in Peutz-Jeghers cancer syndrome, LKB1/STK11, at Ser431 by p90(RSK) and cAMP-dependent protein kinase, but not its farnesylation at Cys(433), is essential for LKB1 to suppress cell vrowth

Peutz-Jeghers syndrome is an inherited cancer syndrome that results in a greatly increased risk of developing tumors in those affected. The causative gene is a protein kinase termed LKB1, predicted to function as a tumor suppressor. The mechanism by which LKB1 is regulated in cells is not known. Here, we demonstrate that stimulation of Rat-2 or embryonic stem cells with activators of ERK1/2 or of cAMP-dependent protein kinase induced phosphorylation of endogenously expressed LKB1 at Ser(431). We present pharmacological and genetic evidence that p90(RSK) mediated this phosphorylation in response to agonists that activate ERK1/2 and that cAMP-dependent protein kinase mediated this phosphorylation in response to agonists that activate adenylate cyclase. Ser(431) of LKB1 lies adjacent to a putative prenylation motif, and we demonstrate that full-length LKB1 expressed in 293 cells was prenylated by addition of a farnesyl group to Cys(433). Our data suggest that phosphorylation of LKB1 at Ser(431) does not affect farnesylation and that farnesylation does not affect phosphorylation at Ser(431). Phosphorylation of LKB1 at Ser(431) did not alter the activity of LKB1 to phosphorylate itself or the tumor suppressor protein p53 or alter the amount of LKB1 associated with cell membranes. The reintroduction of wild-type LKB1 into a cancer cell line that lacks LKB1 suppressed growth, but mutants of LKB1 in which Ser(431) was mutated to Ala to prevent phosphorylation of LKB1 were ineffective in inhibiting growth. In contrast, a mutant of LKB1 that cannot be prenylated was still able to suppress the growth of cells.