Ff gene 5 single-stranded DNA-binding protein assembles on nucleotides constrained by a DNA hairpin

The gene 5 protein (g5p) encoded by filamentous Ff phages is an ssDNA-binding protein, which binds to and sequesters the nascent ssDNA phage genome in the process of phage morphogenesis. The g5p also binds with high affinity to DNA and RNA sequences that form G-quadruplex structures. However, sequences that would form G-quadruplexes are absent in single copies of the phage genome. Using SELEX (systematic evolution of ligands by exponential enrichment), we have now identified a family of DNA hairpin structures to which g5p binds with high affinity. After eight rounds of selection from a library of 58-mers, 26 of 35 sequences of this family contained two regions of complete or partial complementarity. This family of DNA hairpins is represented by the sequence: 5'-d(CGGGATCCAACGTTTTCACCAGATCTACCTCCTCGGGATCCCAAGAGGCAGAATTCGC)-3' (named U-4), where complementary regions are italicized or underlined. Diethyl pyrocarbonate modification, UV-melting profiles, and BamH I digestion experiments revealed that the italicized sequences form an intramolecular hairpin, and the underlined sequences form intermolecular base pairs so that a dimer exists at higher oligomer concentrations. Gel shift assays and end boundary experiments demonstrated that g5p assembles on the hairpin of U-4 to give a discrete, intermediate complex prior to saturation of the oligomer at high g5p concentrations. Thus, biologically relevant sequences at which g5p initiates assembly might be typified better by DNA hairpins than by G-quadruplexes. Moreover, the finding that hairpins of U-4 can dimerize emphasizes the unexpected nature of sequence-dependent structures that can be recognized by the g5p ssDNA-binding protein.     

Ff gene 5 protein has a high binding affinity for single-stranded phosphorothioate DNA

The gene 5 protein (g5p) of Ff bacteriophages is a well-studied model ssDNA-binding protein that binds cooperatively to the Ff ssDNA genome and single-stranded polynucleotides. Its affinity, K omega (the intrinsic binding constant times a cooperativity factor), can differ by several orders of magnitude for ssDNAs of different nearest-neighbor base compositions [Mou, T. C., Gray, C. W., and Gray, D. M. (1999) Biophys. J. 76, 1537-1551]. We found that the DNA backbone can also dramatically affect the binding affinity. The K omega for binding phosphorothioate-modified S-d(A)(36) was >300-fold higher than for binding unmodified P-d(A)(36) at 0.2 M NaCl. CD titrations showed that g5p bound phosphorothioate-modified oligomers with the same stoichiometry as unmodified oligomers. The CD spectrum of S-d(A)(36) underwent the same qualitative change upon protein binding as did the spectrum of unmodified DNA, and the phosphorothioate-modified DNA appeared to bind in the normal g5p binding site. Oligomers of d(A)(36) with different proportions of phosphorothioate nucleotides had binding affinities and CD perturbations intermediate to those of the fully modified and unmodified sequences. The influence of phosphorothioation on binding affinity was nearly proportional to the extent of the modification, with a small nearest-neighbor dependence. These and other results using d(ACC)(12) oligomers and mutant proteins indicated that the increased binding affinity of g5p for phosphorothioate DNA was not a polyelectrolyte effect and probably was not an effect due to the altered nucleic acid structure, but was more likely a general effect of the properties of the sulfur in the context of the phosphorothioate group.     

The product of the lexC gene of Escherichia coli is single-stranded DNA-binding protein.

Extracts from lexC113 cells could not support phage G4 DNA-dependent replication unless supplemented with single-stranded DNA-binding protein. Purified lexC113 binding protein supported synthesis in a reconstituted replication assay, using purified proteins at 30 but not at 42 degrees C, indicating that the product of the lexC113 gene is an altered single-stranded DNA-binding protein.     

Interaction of a folded chromosome-associated protein with single-stranded DNA-binding protein of Escherichia coli, identified by affinity chromatography

A single-stranded DNA-binding protein (SSB) affinity column was prepared by optimizing the coupling of Escherichia coli single-stranded DNA-binding protein to Affi-Gel 10. The bound SSB retained its ability to specifically bind single-stranded DNA. When nuclease-treated cell extracts were incubated with the SSB beads overnight at 4 degrees C, a major protein of Mr = 25,000 was bound. At shorter incubation times, two additional proteins of Mr = 32,000 and 36,000 were also detected. In the absence of nuclease treatment, eight additional proteins ranging from Mr = 14,000 to 160,000 also bound to the affinity column. The major Mr = 25,000 protein has been shown to be a folded chromosome-associated protein. Its binding to SSB is strongly enhanced by the addition of DNA polymerase III or DNA polymerase III holoenzyme.     

The single-stranded DNA-binding protein of Escherichia coli.

The single-stranded DNA-binding protein (SSB) of Escherichia coli is involved in all aspects of DNA metabolism: replication, repair, and recombination. In solution, the protein exists as a homotetramer of 18,843-kilodalton subunits. As it binds tightly and cooperatively to single-stranded DNA, it has become a prototypic model protein for studying protein-nucleic acid interactions. The sequences of the gene and protein are known, and the functional domains of subunit interaction, DNA binding, and protein-protein interactions have been probed by structure-function analyses of various mutations. The ssb gene has three promoters, one of which is inducible because it lies only two nucleotides from the LexA-binding site of the adjacent uvrA gene. Induction of the SOS response, however, does not lead to significant increases in SSB levels. The binding protein has several functions in DNA replication, including enhancement of helix destabilization by DNA helicases, prevention of reannealing of the single strands and protection from nuclease digestion, organization and stabilization of replication origins, primosome assembly, priming specificity, enhancement of replication fidelity, enhancement of polymerase processivity, and promotion of polymerase binding to the template. E. coli SSB is required for methyl-directed mismatch repair, induction of the SOS response, and recombinational repair. During recombination, SSB interacts with the RecBCD enzyme to find Chi sites, promotes binding of RecA protein, and promotes strand uptake.     

Three-dimensional structure of complexes of single-stranded DNA-binding proteins with DNA. IKe and fd gene 5 proteins form left-handed helices with single-stranded DNA

Specimen-tilting in an electron microscope was used to determine the three-dimensional architecture of the helical complexes formed with DNA by the closely related single-stranded DNA binding proteins of fd and IKe filamentous viruses. The fd gene 5 protein is the only member of the DNA-helix-destabilizing class of proteins whose structure has been determined crystallographically, and yet a parameter essential to molecular modeling of the co-operative interaction of this protein with DNA, the helix handedness, has not been available prior to this work. We find that complexes formed by titrating fd viral DNA with either the fd or IKe gene 5 protein have a left-handed helical sense. Complexes isolated from Escherichia coli infected by fd virus are also found to be left-handed helical; hence, the left-handed fd helices are not an artefact of reconstitution in vitro. Because the proteins and nucleic acid of the complexes are composed of asymmetric units which cannot be fitted equivalently to right-handed and left-handed helices, these results rule out a previous computer graphics atomic model for the helical fd complexes: a right-handed helix had been assumed for the model. Our work provides a defined three-dimensional structural framework within which to model the protein-DNA and protein-protein interactions of two structurally related proteins that bind contiguously and co-operatively on single-stranded DNAs.     

SELEX selection of high-affinity oligonucleotides for bacteriophage Ff gene 5 protein

The Ff gene 5 protein (g5p) is a cooperative ssDNA-binding protein. SELEX was used to identify DNA sequences favorable for g5p binding at physiological ionic strength (200 mM NaCl) and 37 degrees C. Sequences were selected from a library of 58-mers that contained a central variable segment of 26 nucleotides. DNA sequences selected after eight rounds of SELEX were mostly G-rich, with multiple copies of CPuGGPy, TPuGGGPy, and/or PyPuPuGGGPy motifs. This was unexpected, since g5p has higher binding affinities for polypyrimidine than for polypurine sequences. The most recurrent G-rich sequence, named I-3, was found to have g5p-binding properties that were correlated with a structural transition. At 10 mM NaCl, I-3 existed in a single-stranded form that was saturated by g5p in an all-or-none fashion. At 200 mM NaCl, I-3 existed in a structured form that showed CD spectral features of G-quadruplexes. The g5p binding affinity for this structured form of I-3 was >100-fold higher than for the single-stranded form. Moreover, the structured I-3 was saturated by g5p in two steps, the first of which was the formation of an apparent initiation complex consisting of one I-3 strand and about three g5p dimers. Nuclease S1 footprinting and other experiments showed that g5p molecules in the initiation complex at 200 mM NaCl were bound directly to the G-rich variable segment and that the structure of I-3 was retained after saturation by g5p. Thus, G-rich motifs may form structures favorable for initiation of g5p binding and also provide the actual g5p-binding sites.     

The DNA binding domain of the gene 2.5 single-stranded DNA-binding protein of bacteriophage T7

Gene 2.5 of bacteriophage T7 encodes a single-stranded DNA-binding protein that is essential for viral survival. Its crystal structure reveals a conserved oligosaccharide/oligonucleotide binding fold predicted to interact with single-stranded DNA. However, there is no experimental evidence to support this hypothesis. Recently, we reported a genetic screen for lethal mutations in gene 2.5 that we are using to identify functional domains of the gene 2.5 protein. This screen uncovered a number of mutations that led to amino acid substitutions in the proposed DNA binding domain. Three variant proteins, gp2.5-Y158C, gp2.5-K152E, and gp2.5-Y111C/Y158C, exhibit a decrease in binding affinity for oligonucleotides. A fourth, gp2.5-K109I, exhibits an altered mode of binding single-stranded DNA. A carboxyl-terminal truncation of gene 2.5 protein, gp2.5-Delta26C, binds single-stranded DNA 10-fold more tightly than the wild-type protein. The three altered proteins defective in single-stranded DNA binding cannot mediate the annealing of homologous DNA, whereas gp2.5-Delta26C mediates the reaction more effectively than does wild-type. Gp2.5-K109I retains this annealing ability, albeit slightly less efficiently. With the exception of gp2.5-Delta26C, all variant proteins form dimers in solution and physically interact with T7 DNA polymerase.     

The DEAH-box RNA helicase RHAU binds an intramolecular RNA G-quadruplex in TERC and associates with telomerase holoenzyme

Guanine-quadruplexes (G4) consist of non-canonical four-stranded helical arrangements of guanine-rich nucleic acid sequences. The bulky and thermodynamically stable features of G4 structures have been shown in many respects to affect normal nucleic acid metabolism. In vivo conversion of G4 structures to single-stranded nucleic acid requires specialized proteins with G4 destabilizing/unwinding activity. RHAU is a human DEAH-box RNA helicase that exhibits G4-RNA binding and resolving activity. In this study, we employed RIP-chip analysis to identify en masse RNAs associated with RHAU in vivo. Approximately 100 RNAs were found to be associated with RHAU and bioinformatics analysis revealed that the majority contained potential G4-forming sequences. Among the most abundant RNAs selectively enriched with RHAU, we identified the human telomerase RNA template TERC as a true target of RHAU. Remarkably, binding of RHAU to TERC depended on the presence of a stable G4 structure in the 5'-region of TERC, both in vivo and in vitro. RHAU was further found to associate with the telomerase holoenzyme via the 5'-region of TERC. Collectively, these results provide the first evidence that intramolecular G4-RNAs serve as physiologically relevant targets for RHAU. Furthermore, our results suggest the existence of alternatively folded forms of TERC in the fully assembled telomerase holoenyzme.     

Specificity of binding of single-stranded DNA-binding protein to its target

Single-stranded DNA-binding proteins (SSBs) bind single-stranded DNA (ssDNA) and participate in all genetic processes involving ssDNA, such as replication, recombination, and repair. Here we applied atomic force microscopy to directly image SSB-DNA complexes under various conditions. We used the hybrid DNA construct methodology in which the ssDNA segment is conjugated to the DNA duplex. The duplex part of the construct plays the role of a marker, allowing unambiguous identification of specific and nonspecific SSB-DNA complexes. We designed hybrid DNA substrates with 5'- and 3'-ssDNA termini to clarify the role of ssDNA polarity on SSB loading. The hybrid substrates, in which two duplexes are connected with ssDNA, were the models for gapped DNA substrates. We demonstrated that Escherichia coli SSB binds to ssDNA ends and internal ssDNA regions with the same efficiency. However, the specific recognition by ssDNA requires the presence of Mg(2+) cations or a high ionic strength. In the absence of Mg(2+) cations and under low-salt conditions, the protein is capable of binding DNA duplexes. In addition, the number of interprotein interactions increases, resulting in the formation of clusters on double-stranded DNA. This finding suggests that the protein adopts different conformations depending on ionic strength, and specific recognition of ssDNA by SSB requires a high ionic strength or the presence of Mg(2+) cations.     

Binding and reversible denaturation of double-stranded DNA by Ff gene 5 protein

The gene 5 protein (g5p) from Ff filamentous virus is a model single-stranded DNA (ssDNA) binding protein that has an oligonucleotide/oligosaccharide binding (OB)-fold structure and binding properties in common with other ssDNA-binding proteins. In the present work, we use circular dichroism (CD) spectroscopy to analyze the effects of amino acid substitutions on the binding of g5p to double-stranded DNA (dsDNA) compared to its binding to ssDNA. CD titrations of poly[d(A). d(T)] with mutants of each of the five tyrosines of the g5p showed that the 229-nm CD band of Tyr34, a tyrosine at the interface of adjacent protein dimers, is reversed in sign upon binding to the dsDNA, poly[d(A). d(T)]. This effect is like that previously found for g5p binding to ssDNAs, suggesting there are similarities in the protein-protein interactions when g5p binds to dsDNA and ssDNA. However, there are differences, and the possible perturbation of a second tyrosine, Tyr41, in the complex with dsDNA. Three mutant proteins (Y26F, Y34F, and Y41H) reduced the melting temperature of poly[d(A). d(T)] by 67 degrees C, but the wild-type g5p only reduced it by 2 degrees C. This enhanced ability of the mutants to denature dsDNA suggests that their binding affinities to dsDNA are reduced more than are their binding affinities to ssDNA. Finally, we present evidence that when poly[d(A). d(T)] is melted in the presence of the wild-type, Y26F, or Y34F proteins, the poly[d(A)] and poly[d(T)] strands are separately sequestered such that renaturation of the duplex is facilitated in 2 mM Na(+).     

The binding affinity of Ff gene 5 protein depends on the nearest-neighbor composition of the ssDNA substrate

The Ff gene 5 protein (g5p) is considered to be a nonspecific single-stranded DNA binding protein, because it binds cooperatively to and saturates the Ff bacteriophage single-stranded DNA genome and other single-stranded polynucleotides. However, the binding affinity Komega (the intrinsic binding constant times a cooperativity factor) differs by over an order of magnitude for binding to single-stranded polynucleotides such as poly[d(A)] and poly[d(C)]. A polynucleotide that is more stacked, like poly[d(A)], binds more weakly than one that is less stacked, like poly[d(C)]. To test the hypothesis that DNA base stacking, a nearest-neighbor property, is involved in the binding affinity of the Ff g5p for different DNA sequences, Komega values were determined as a function of NaCl concentration for binding to six synthetic sequences 48 nucleotides in length: dA48, dC48, d(AAC)16, d(ACC)16, d(AACC)12, and d(AAACC)9A3. The binding affinities of the protein for these sequences were indeed found to be related to the nearest-neighbor compositions of the sequences, rather than to simple base compositions. That is, the g5p binding site, which is spanned by four nucleotides, discriminates among these sequences on the basis of the relative numbers of nearest neighbors (AA, CC, and AC plus CA) in the sequence. The results support the hypothesis that the extent of base stacking/unstacking of the free, nonbound ssDNA plays an important role in the binding affinity of the Ff gene 5 protein.     

The process of displacing the single-stranded DNA-binding protein from single-stranded DNA by RecO and RecR proteins

The regions of single-stranded (ss) DNA that result from DNA damage are immediately coated by the ssDNA-binding protein (SSB). RecF pathway proteins facilitate the displacement of SSB from ssDNA, allowing the RecA protein to form protein filaments on the ssDNA region, which facilitates the process of recombinational DNA repair. In this study, we examined the mechanism of SSB displacement from ssDNA using purified Thermus thermophilus RecF pathway proteins. To date, RecO and RecR are thought to act as the RecOR complex. However, our results indicate that RecO and RecR have distinct functions. We found that RecR binds both RecF and RecO, and that RecO binds RecR, SSB and ssDNA. The electron microscopic studies indicated that SSB is displaced from ssDNA by RecO. In addition, pull-down assays indicated that the displaced SSB still remains indirectly attached to ssDNA through its interaction with RecO in the RecO-ssDNA complex. In the presence of both SSB and RecO, the ssDNA-dependent ATPase activity of RecA was inhibited, but was restored by the addition of RecR. Interestingly, the interaction of RecR with RecO affected the ssDNA-binding properties of RecO. These results suggest a model of SSB displacement from the ssDNA by RecF pathway proteins.     

The cytoplasmic DNA-binding protein TraM binds to the inner membrane protein TraD in vitro.

The cytoplasmic protein TraM is one of four essential gene products of the F factor which are involved in DNA transfer after mating pair formation. TraM binds to three specific sites within the oriT region. Besides regulation of its own synthesis, the precise function of TraM during conjugation is not yet known. In the present work, the affinity of TraM to TraD was studied in vitro by an overlay assay and by affinity chromatography. Whether the interaction between TraM and TraD causes a transient or permanent anchoring of the F factor to the site of transfer is discussed. A 35-kDa host membrane protein of yet unknown function also shows affinity to TraM and may be involved in this anchoring process as well.     

The major herpes simplex virus DNA-binding protein holds single-stranded DNA in an extended configuration

Properties of the major DNA-binding protein found in herpes simplex virus-infected cells were investigated by using a filter binding assay and electron microscopy. Filter binding indicated that the stoichiometry of binding of the protein with single-stranded DNA is approximately 40 nucleotides per protein molecule at saturation. Strong clustering of the protein in DNA-protein complexes, indicative of cooperative binding, was seen with the electron microscope. Measurements of single-stranded fd DNA molecules saturated with protein and spread for electron microscopy by using both the aqueous and formamide spreading techniques indicated that the DNA is held in an extended configuration with a base spacing of approximately 0.13 nm per base.     

Temperature-sensitive mutants of adenovirus single-stranded DNA-binding protein. Inability to support DNA replication is associated with an altered DNA-binding activity of the protein.

The adenovirus single-stranded DNA-binding protein (DBP) is an essential factor in viral DNA replication. Three temperature-sensitive (ts) adenoviruses (Ad2+ND1ts23, Ad2ts111A, and Ad5ts125) are known to have single amino acid substitutions in their DBPs that result in defective DNA replication at the nonpermissive temperature. To elucidate the mechanism(s) involved in the ts phenotype, we purified the three mutant DBPs and studied their DNA-binding properties and their ability to support DNA replication in an in vitro system. The results confirm that the three ts DBPs were incapable of supporting DNA replication at the nonpermissive temperature (40 degrees C). The defect was found at both the initiation and elongation steps of DNA replication. The 2-fold stimulation of pTP.dCMP formation by the DBP was lost by prior heating of the ts DBPs. The pronounced effect of the DBP on the early elongation process was severely diminished, but not abolished, by prior heating to 40 degrees C. The functional change at 40 degrees C was irreversible, as the ts DBPs preincubated at 40 degrees C were no longer active when assayed at 30 degrees C. Upon heating to 40 degrees C, all three ts DBPs lost their ability to bind to oligonucleotides, although they still retained some binding activity for large single-stranded DNAs such as M13 DNA. Thus, the inability of these three ts DBPs to support DNA replication is attributable to their altered DNA-binding properties.     

Role of tryptophan 54 in the binding of E. coli single-stranded DNA-binding protein to single-stranded polynucleotides

Fluorescence and optical detection of triplet state magnetic resonance spectroscopy have been employed to study the complexes formed by single-stranded polynucleotides with both E. coli single-stranded DNA-binding protein and an E. coli ssb gene product in which Trp-54 is replaced by phenylalanine using site specific oligonucleotide mutagenesis. Our results strongly suggest the involvement of Trp-54 in stabilizing the protein-nucleic acid complexes via stacking interactions of the aromatic residue with the nucleotide bases.     

The lef-3 gene of Autographa californica nuclear polyhedrosis virus encodes a single-stranded DNA-binding protein.

The Autographa californica nuclear polyhedrosis virus (AcNPV) replicates in the nuclei of infected cells and encodes several proteins required for viral DNA replication. As a first step in the functional characterization of viral replication proteins, we purified a single-stranded DNA-binding protein (SSB) from AcNPV-infected insect cells. Nuclear extracts were chromatographed on single-stranded DNA agarose columns. An abundant protein with an apparent molecular weight of 43,000 was eluted from the columns at 0.9 to 1.0 M NaCl. This protein was not evident in extracts prepared from control cells, suggesting that the SSB was encoded by the virus. SSB bound to single-stranded DNA in solution, and binding was nonspecific with respect to base sequence, as single-stranded vector DNA competed as efficiently as single-stranded DNA containing the AcNPV origin of DNA replication. Competition binding experiments indicated that SSB showed a preference for single-stranded DNA over double-stranded DNA. To determine whether SSB was encoded by the lef-3 gene of AcNPV, the lef-3 open reading frame was cloned under the control of the bacteriophage T7 promoter. Immunochemical analyses indicated that LEF-3 produced in bacteria or in rabbit reticulocyte lysates specifically reacted with antiserum produced by immunization with purified SSB. Immunoblot analyses of infected cell extracts revealed that SSB/LEF-3 was detected by 4 h postinfection and accumulated through 48 h postinfection.