The course of the assembly of ribosomal subunits in yeast

The course of the assembly of the various ribosomal proteins of yeast into ribosomal particles has been studied by following the incorporation of radioactive individual protein species in cytoplasmic ribosomal particles after pulse-labelling of yeast protoplasts with tritiated amino acids. The pool of ribosomal proteins is small relative to the rate of ribosomal protein synthesis, and, therefore, does not affect essentially the appearance of labelled ribosomal proteins on the ribosomal particles. From the labelling kinetics of individual protein species it can be concluded that a number of ribosomal proteins of the 60 S subunit (L6, L7, L8, L9, L11, L15, L16, L23, L24, L30, L32, L36, L40, L41, L42, L44 and L45) associate with the ribonucleoprotein particles at a relatively late stage of the ribosomal maturation process. The same was found to be true for a number of proteins of the 40 S ribosomal subunit (S10, S27, S31, S32, S33 and S34). Several members (L7, L9, L24 and L30) of the late associating group of 60-S subunit proteins were found to be absent from a nuclear 66 S precursor ribosomal fraction. These results indicate that incorporation of these proteins into the ribosomal particles takes place in the cytoplasm at a late stage of the ribosomal maturation process.     

Mitochondrial and nuclear mutations that affect the biogenesis of the mitochondrial ribosomes of yeast. II. Biochemistry.

1. Several nuclear mutants have been isolated which showed thermo- or cryo-sensitive growth on non-fermentable media. Although the original strain carried mitochondrial drug resistance mutations (CR, ER, OR and PR), the resistance to one or several drugs was suppressed in these mutants. Two of them showed a much reduced amount of the mitochondrial small ribosomal subunit (37S) and of the corresponding 16S ribosomal RNA. Two dimensional electrophoretic analysis did not reveal any change in the position of any of the mitochondrial ribosomal proteins. However one of the mitochondrial ribosomal proteins. However one of the mutants showed a striking decrease in the amounts of three ribosomal proteins S3, S4 and S15. 2. Four temperature-sensitive mitochondrial mutations have been localized in the region of the gene coding for the large mitochondrial ribosomal RNA (23S). These mutants all showed a marked anomaly in the mitochondrial large ribosomal subunit (50S) and/or the corresponding 23S ribosomal RNA.     

Identification of the ribosomal proteins phosphorylated by the ribosome-associated casein kinase type II from cryptobiotic gastrulae of the brine shrimp Artemia sp

Phosphorylation of the ribosomal proteins by the extra-ribosomal protein kinase was investigated "in situ" and with purified 40 S or 60 S ribosomal proteins from cryptobiotic embryos of Artemia sp. Ribosomal proteins that were most readily phosphorylated in 80 S ribosomes included S6 and S8 of the 40 S subunit and proteins L9, L13 and L18 of the 60 S subunit. Several additional polypeptides were phosphorylated when purified 40 S or 60 S ribosomal proteins were separately incubated in the reconstituted system. The possible functions of ribosomal phosphorylation in protein synthesis will be discussed.     

Comparison of native and KCl treated 40S ribosomal subunits from the silkmoth Antherea pernyi and mammals

Native 40S ribosomal subunits and 18S ribosomal RNA from ovarian follicles of the silkmoth A. pernyi showed a lower sedimentation coefficient in comparison to ascites cells, in contrast to the KCl treated 40S ribosomal subunits where no difference was observed in both tissues. Moreover the silkmoth native 40S ribosomal subunits--in contrast to the KCl treated ones--could not reassociate with radioactive ascites cell 60S ribosomal subunits. These results, combined with the great similarities in the two dimensional electrophoretic patterns of 40S ribosomal proteins from silkmoth follicles and other mammalian cells lead to the possibility of the existence of a specific RNase associated with the 40S ribosomal subunit.     

Immunoelectron microscopic studies on the location of ribosomal proteins on the surface of the 40S ribosomal subunit from rat liver

Seven ribosomal proteins have been localized by means of immunoelectron microscopy on the surface of the 40S ribosomal subunit from rat liver using monospecific antibodies. The location of ribosomal proteins S13/16, S19, and S24 is described for the first time, and that of ribosomal proteins S2, S3, S3a, and S7, which has been published previously on the basis of experiments performed with less well characterized antibody preparations [Lutsch et al., Mol. Gen. Genet. 176, 281-291 (1979) and Biomed. Biochim. Acta 42, 705-723 (1983)], is corrected in this paper. The results are discussed with respect to the involvement of these proteins in functional sites of the 40S ribosomal subunit.     

Identification of the amino acid residues of proteins S5 and S8 adjacent to each other in the 30 S ribosomal subunit of Escherichia coli.

When Escherichia coli 30 S ribosomal subunits are reacted with protein-protein bifunctional reagents, a number of protein pairs as well as aggregates containing three or more ribosomal proteins are formed. In the present study we have purified one of the protein pairs obtained by reaction of 30 S ribosomal subunits with either radioactive or nonradioactive dimethylsuberimidate. Following molecular weight determination and ammonolysis, the pair was shown to consist of ribosomal proteins S5 and S8. The "native" structure of the complex was surmised from its capacity to be reconstituted into a biologically active 30 S ribosomal subunit. From peptide maps and primary structure determination of various peptides it was demonstrated that the cross-linking bond between ribosomal proteins S5 and S8 involves primarily the residues Lys-93 of protein S8 and the COOH-terminal lysine (Lys-166) of ribosomal protein S5. This result is substantiated by the finding that a mutant carrying an altered S5 lacking the COOH-terminal lysine yields a greatly reduced amount of S5-S8 cross-link. In addition to the points of cross-linking it was found that Lys-30, Lys-68, and Lys-86 of S8 and Lys-5 of S5 react with dimethylsuberimidate, indicating that these residues are available for reaction and suggesting their topographical localization on the ribosomal surface.     

On the biosynthesis of bacterial ribosomal RNA

By comparison of the fingerprints of 5S and 23S ribosomal RNAs from Bacillus licheniformis with that of the precursor of 23S ribosomal RNA, it can be shown that 5S RNA is not a part of the precursor of 23S ribosomal RNA.     

Effect of 5-fluorouracil on the synthesis and stability of ribosomal RNA in Saccharomyces carlsbergensis

A study has been made of the effects of 5-fluorouracil on the synthesis and stability of ribosomal RNA in yeast. The analog causes ribosomal precursor RNA to accumulate. Mature ribosomal RNA species synthesized in the presence of 5-fluorouracil are unstable and are degraded. Pulse chase experiments showed that the 26 S ribosomal RNA is more rapidly degraded than the 17 S component, explaining our observations that in long term experiments apparently less 26 S than 17 S ribosomal RNA is formed. Possible reasons for the instability of ribosomal RNA containing 5-fluorouracil are discussed.     

Effects of the ribosomal subunit association on the chemical modification of the 16S and 23S RNAs from Escherichia coli

70S ribosomes and 30S and 50S ribosomal subunits from Escherichia coli were modified under non-denaturing conditions with the chemical reagent dimethylsulfate. The ribosomal 23S and 16S RNAs were isolated after the reaction and the last 200 nucleotides from the 3' ends were analyzed for differences in the chemical modification. A number of accessibility changes could be detected for 23S and 16S RNA when 70S ribosomes as opposed to the isolated subunits were modified. In addition to a number of sites which were protected from modification several guanosines showed enhanced reactivities, indicating conformational changes in the ribosomal RNA structures when 30S and 50S subunits associate to a 70S particle. Most of the accessibility changes can be localized in double-helical regions within the secondary structures of the two RNAs. The results confirm the importance of the ribosomal RNAs for ribosomal functions and help to define the RNA domains which constitute the subunit interface of E. coli ribosomes.     

An excess of the small ribosomal subunits and a higher rate of turnover of the 60 S than of the 40 S ribosomal subunits in L cells grown in suspension culture.

A considerable excess of small ribosomal subunits was observed in L cells grown in suspension culture. The ratio between the small and large ribosomal subunits in the cytoplasm was estimated to be 1.17 ± 0.05 for cells dividing every 20 to 24 hours.The 60 S ribosomal subunits were turning over much faster than the 40 S subunits. Half-lives of 155 ± 20 hours for 18 S ribosomal RNA and 82 ± 15 hours for 28 S ribosomal RNA were observed under conditions where the cell number doubled every 24 hours and the viability was 95%. By correcting for cell death the half-lives of 18 S and 28 S ribosomal RNA were estimated to be approximately 300 hours and 110 hours, respectively. During storage of isolated ribosomes the small ribosomal subunits were degraded faster than the large subunits. This shows that the degradation of 60 S subunits was not an artifact taking place during the isolation procedure.It is postulated that the small ribosomal subunits are protected by protein to a greater extent than the 60 S subunits in these rapidly growing cells in suspension culture. The protection may take place both in the nucleus during synthesis, thus avoiding degradation (“wastage”) of nascent subunit precursors, and later in the cytoplasm. A calculation has been carried out to show that the observed excess of small subunits may be accounted for on the basis of a 1:1 synthesis of the small and large ribosomal subunits in the nucleus and different degradation rates in the cytoplasm. The results do not exclude the possibility of a difference in the “wastage” of 18 S and 28 S ribosomal RNA in the nucleus in addition to the difference in the turnover rates in the cytoplasm.     

The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.     

The organization of ribosomal RNA genes in the mitochondrial DNA of Tetrahymena pyriformis strain ST.

1. We have constructed a physical map of the mtDNA of Tetrahymena pyriformis strain ST using the restriction endonucleases EcoRI, PstI, SacI, HindIII and HhaI. 2. Hybridization of mitochondrial 21 S and 14 S ribosomal RNA to restriction fragments of strain ST mtDNA shows that this DNA contains two 21-S and only one 14-S ribosomal RNA genes. By S1 nuclease treatment of briefly renatured single-stranded DNA the terminal duplication-inversion previously detected in this DNA (Arnberg et al. (1975) Biochim. Biophys. Acta 383, 359--369) has been isolated and shown to contain both 21-S ribosomal RNA genes. 14 S ribosomal RNA hybridizes to a region in the central part of the DNA, about 8000 nucleotides or 20% of the total DNA length apart from the nearest 21 S ribosomal RNA gene. 3. We have confirmed this position of the three ribosomal RNA genes by electron microscopical analysis of DNA . RNA hybrid molecules and R-loop molecules. 4. Hybridization of 21 S ribosomal RNA with duplex mtDNA digested either with phage lambda-induced exonuclease or exonuclease III of Escherichia coli, shows that the 21-S ribosomal RNA genes are located on the 5'-ends of each DNA strand. Electron microscopy of denaturated mtDNA hybridized with a mixture of 14-S and 21-S ribosomal RNAs show that the 14 S ribosomal RNA gene has the same polarity as the nearest 21 S ribosomal RNA gene. 5. Tetrahymena mtDNA is (after Saccharomyces mtDNA) the second mtDNA in which the two ribosomal RNA cistrons are far apart and the first mtDNA in which one of the ribosomal RNA cistrons is duplicated.     

Identification of several proteins involved in the messenger RNA binding site of the 30 S ribosome by inactivation with 2-methoxy-5-nitrotropone

Chemical modification of unwashed 30 S ribosomal subunits with 2-methoxy-5-nitrotropone causes a rapid loss of their capacity to bind bacteriophage Qβ RNA. Reconstitution experiments show that ribosomal protein is the functionally inactivated species. When purified unmodified ribosomal proteins were included in a mixture of 16 S ribosomal RNA and total protein derived from 2-methoxy-5-nitrotropone-treated subunits, four proteins (S1, S12, S13 and S21) were found to promote the reconstitution of particles capable of binding natural messenger RNA.     

Ribosomal RNA genes of Saccharomyces cerevisiae. II. Physical map and nucleotide sequence of the 5 S ribosomal RNA gene and adjacent intergenic regions.

A DNA fragment containing the structural gene for the 5 S ribosomal RNA and intergenic regions before and after the 35 S ribosomal RNA precursor gene of Saccharomyces cerevisiae has been amplified in a bacterial plasmid and physically mapped by restriction endonuclease cleavage and hybridization to purified yeast 5 S ribosomal RNA. The nucleotide sequence of the DNA fragments carrying the 5 S ribosomal RNA gene and adjacent regions has been determined. The sequence unambiguously identifies the 5 S ribosomal RNA gene, determines its polarity within the ribosomal DNA repeating unit, and reveals the structure of its promoter and termination regions. Partial DNA sequence of the regions near the beginning and end of the 35 S ribosomal RNA gene has also been determined as a preliminary step in establishing the structure of promoter and termination regions for the 35 S ribosomal RNA gene.     

Ribosomal RNA genes of Saccharomyces cerevisiae. I. Physical map of the repeating unit and location of the regions coding for 5 S, 5.8 S, 18 S, and 25 S ribosomal RNAs.

The organization of the ribosomal DNA repeating unit from Saccharomyces cerevisiae has been analyzed. A cloned ribosomal DNA repeating unit has been mapped with the restriction enzymes Xma 1, Kpn 1, HindIII, Xba 1, Bgl I + II, and EcoRI. The locations of the sequences which code for 5 S, 5.8 S, 18 S, and 25 S ribosomal RNAs have been determined by hybridization of the purified RNA species with restriction endonuclease generated fragments of the repeating unit. The position of the 5.8 S ribosomal DNA sequences within the repeat was also established by sequencing the DNA which codes for 83 nucleotides at the 5' end of 5.8 S ribosomal RNA. The polarity of the 35 S ribosomal RNA precursor has been established by a combination of hybridization analysis and DNA sequence determination and is 5'-18 S, 5.8 S, 25 S-3'.     

Secondary structure of the 5'-terminal region of the 18S ribosomal RNA5.3S fragment from the rat liver

Two small RNA fragments, 5,3S and 4,7S, were observed in gel electrophoretic analysis of RNA of the 40S ribosomal subunit of rat liver. 5,3S RNA (134-136 nucleotides long) proved to be 5'-terminal fragment of 18S ribosomal RNA, whereas 4,7 RNA is the degradation product of 5,3S RNA with 27-28 5'-terminal nucleotides lost. The secondary structure of 5,3S RNA was probed with two structure-specific nucleases, S1 nuclease and the double-strand specific cobra venom endoribonuclease. The nuclease digestion data agree well with the computer generated secondary structure model for 5,3S RNA. This model predicts that the 5'-terminal part of rat liver ribosomal 18S RNA forms an independent structural domain. The affinity chromatography experiments with the immobilized 5,3S fragment show that 5,3S RNA does not bind rat liver ribosomal proteins.     

A region in the C-terminal domain of ribosomal protein SA required for binding of SA to the human 40S ribosomal subunit

The human ribosomal protein SA, known also as a precursor of the cell-surface laminin receptor, LAMR, is a protein of the 40S ribosomal subunit. It is homologous to eubacterial ribosomal protein S2p, but has a eukaryote-specific C-terminal domain (CTD) that is responsible in LAMR for the binding of laminin as well as prions and several viruses. Using serial deletions in the SA CTD, we showed that region between amino acids 236-262 is required for binding of the protein to 40S ribosomal subunits. All SA mutants containing this region protected nucleotides in hairpin 40 (which is not bound to any protein in the eubacterial 30S ribosomal subunit) of the 18S rRNA from hydroxyl radical attack. Comparison of our data with the cryo-EM models of the mammalian 40S ribosomal subunit allowed us to locate the SA CTD in the spatial structure of the 40S subunit.