共查询到20条相似文献,搜索用时 46 毫秒
1.
2.
Antonio Foddai Christopher T. Elliott Irene R. Grant 《Applied and environmental microbiology》2010,76(22):7550-7558
In order to introduce specificity for Mycobacterium avium subsp. paratuberculosis prior to a phage amplification assay, various magnetic-separation approaches, involving either antibodies or peptides, were evaluated in terms of the efficiency of capture (expressed as a percentage) of M. avium subsp. paratuberculosis cells and the percentage of nonspecific binding by other Mycobacterium spp. A 50:50 mixture of MyOne Tosylactivated Dynabeads coated with the chemically synthesized M. avium subsp. paratuberculosis-specific peptides biotinylated aMp3 and biotinylated aMptD (i.e., peptide-mediated magnetic separation [PMS]) proved to be the best magnetic-separation approach for achieving 85 to 100% capture of M. avium subsp. paratuberculosis and minimal (<1%) nonspecific recovery of other Mycobacterium spp. (particularly if beads were blocked with 1% skim milk before use) from broth samples containing 103 to 104 CFU/ml. When PMS was coupled with a recently optimized phage amplification assay and used to detect M. avium subsp. paratuberculosis in 50-ml volumes of spiked milk, the mean 50% limit of detection (LOD50) was 14.4 PFU/50 ml of milk (equivalent to 0.3 PFU/ml). This PMS-phage assay represents a novel, rapid method for the detection and enumeration of viable M. avium subsp. paratuberculosis organisms in milk, and potentially other sample matrices, with results available within 48 h.The prospect of being able to detect viable Mycobacterium avium subsp. paratuberculosis organisms in food or veterinary samples within 48 h using a commercially available phage amplification assay (FASTPlaqueTB assay; Biotec Laboratories Limited, Ipswich, United Kingdom), rather than waiting weeks for conventional culture results, is an exciting recent development (7, 8, 26). However, the mycobacteriophage used in the phage amplification assay has a broader mycobacterial host range than M. avium subsp. paratuberculosis alone (23). Consequently, plaques obtained when naturally infected, rather than artificially spiked, samples are tested may not necessarily emanate from M. avium subsp. paratuberculosis alone if other Mycobacterium spp. are also present in the sample. Some additional selective step prior to phage infection, such as magnetic separation (12), is needed to introduce selectivity for M. avium subsp. paratuberculosis.Magnetic separation (MS) has become a routine method in food and veterinary microbiology laboratories and is commonly used in combination with culture or molecular methods for the detection and isolation of pathogenic bacteria such as Listeria monocytogenes (13, 31), Salmonella spp. (22, 25), and Escherichia coli O157:H7 in both the food (15) and veterinary (20) clinical sample testing context. Magnetic-separation methods selectively separate the target bacterium from other, nontarget microorganisms and inhibitory sample components while concentrating the target bacterial cells into a smaller volume. Collectively, these properties of magnetic separation enhance the analytical specificity and sensitivity of the subsequent detection method, which can be culture, PCR, microscopy, an antigen detection immunoassay, or a phage assay. The latter is our proposed endpoint detection method. The combination of phage amplification and MS is not a new concept. Immunomagnetic (IMS)-phage assays for Salmonella enterica serovar Enteritidis and Escherichia coli O157:H7 have been described previously (5, 6).The original IMS approach for M. avium subsp. paratuberculosis, employing a polyclonal anti-M. avium subsp. paratuberculosis antibody, was described by Grant et al. (9). This IMS approach showed good detection specificity for M. avium subsp. paratuberculosis as well as high detection sensitivity, because it was able to recover ≤10 CFU/ml directly from both spiked broth and milk. Its subsequent use in combination with IS900 PCR enhanced the speed of detection of M. avium subsp. paratuberculosis (10), and IMS-PCR was able to detect as few as 103 CFU/50 ml, 1 to 2 log10 units lower than the number detected by IS900 PCR applied directly to milk. However, our experience of using this and another polyclonal-antibody-based IMS method (Pathatrix PM-50 beads; Matrix Microscience, Newmarket, England) in conjunction with culture on Herrold''s egg yolk medium for the isolation of M. avium subsp. paratuberculosis from mixed-broth cultures from milk (unpublished data) and from raw-milk cheeses (27) has been that these polyclonal-antibody-based IMS methods lack sufficient specificity for M. avium subsp. paratuberculosis, and that consequently, nontarget bacteria, which bind nonspecifically to the beads, often overgrow this bacterium in culture. With other food-borne pathogens, an appropriate selective culture medium can be employed after IMS to prevent the outgrowth of any nontarget bacteria. Unfortunately, no truly selective culture medium exists for M. avium subsp. paratuberculosis at present, so specificity for this bacterium via magnetic separation must be achieved by optimizing the types of bead and capture ligands used.A monoclonal-antibody-based IMS method for M. avium subsp. paratuberculosis was reported by Metzger-Boddien et al. (17). Other groups have been attempting to produce monoclonal antibodies for application in IMS (3, 4). However, as an alternative to either polyclonal or monoclonal antibodies for the capture of M. avium subsp. paratuberculosis, new magnetic-separation approaches involving an M. avium subsp. paratuberculosis-specific peptide, aMp3 (30) or aMptD (28), have been described (i.e., peptide-mediated magnetic separation [PMS]). The first peptide (aMp3) was screened from nine recombinant bacteriophages specifically binding M. avium subsp. paratuberculosis that were produced using a commercially available phage-peptide display library (30). The second peptide, aMptD, was identified by biopanning of the M. avium subsp. paratuberculosis-specific ABC transponder operon (mpt) (29). The two chemically synthesized peptides, aMp3 and aMptD, were linked via carbodiimide to paramagnetic beads and were used in peptide-based capture PCR. Both PMS methods were reported to have high selectivity for M. avium subsp. paratuberculosis (i.e., no cross-reaction with other Mycobacterium spp.), and the analytical detection sensitivity, 5 ×102 CFU per ml (28), was comparable to the results previously reported by Grant et al. (10).As with other pathogenic bacteria that are likely to be present in raw milk, low numbers of viable M. avium subsp. paratuberculosis organisms are expected to be encountered in milk and dairy products (2, 11, 24). For other food-borne pathogens, such as Listeria monocytogenes (31), Salmonella spp. (22), and Escherichia coli O157:H7 (15), magnetic separation is generally applied after an enrichment culture step. This enrichment culture step aims to dilute food components known to be growth/PCR inhibitors, revive stressed or injured cells, and boost the numbers of the target bacterium (18, 21), so that magnetic separation and subsequent detection are likely to be more successful. Unfortunately, a prior enrichment culture step is impractical for M. avium subsp. paratuberculosis, since it would take too long, due to the slow-growing nature of this bacterium; thus, MS really needs to be applied directly to the sample. Consequently, any IMS or PMS method for M. avium subsp. paratuberculosis must achieve close to 100% capture efficiency, with minimal nonspecific binding by other mycobacteria, to limit false-negative or false-positive results. Capture efficiency is a measure of the completeness of capture of the original population of target cells present in the sample. Analytical specificity refers to the ability of an assay to measure one particular organism or substance, rather than others, in a sample (19). Therefore, the objectives of this study were (i) to identify the best magnetic-separation approach for the isolation of M. avium subsp. paratuberculosis from milk, in terms of capture efficiency and the percentage of nonspecific binding, by comparing as many paramagnetic-bead-coating antigen combinations as possible and (ii) to evaluate the potential use of the best magnetic-separation approach in conjunction with the previously optimized phage assay (7) as a novel IMS- or PMS-phage assay for the detection of M. avium subsp. paratuberculosis in milk. 相似文献
3.
Navneet K. Dhand Jenny-Ann L. M. L. Toribio Richard J. Whittington 《Applied and environmental microbiology》2009,75(17):5581-5585
Attachment of Mycobacterium avium subsp. paratuberculosis to soil particles could increase their availability to farm animals, as well as influence the transportation of M. avium subsp. paratuberculosis to water sources. To investigate the possibility of such attachment, we passed a known quantity of M. avium subsp. paratuberculosis through chromatography columns packed with clay soil, sandy soil, pure silica, clay-silica mixture, or clay-silica complexes and measured the organisms recovered in the eluent using culture or quantitative PCR. Experiments were repeated using buffer at a range of pH levels with pure silica to investigate the effect of pH on M. avium subsp. paratuberculosis attachment. Linear mixed-model analyses were conducted to compare the proportional recovery of M. avium subsp. paratuberculosis in the eluent between different substrates and pH levels. Of the organisms added to the columns, 83 to 100% were estimated to be retained in the columns after adjustment for those retained in empty control columns. The proportions recovered were significantly different across different substrates, with the retention being significantly greater (P < 0.05) in pure substrates (silica and clay-silica complexes) than in soil substrates (clay soil and sandy soil). However, there were no significant differences in the retention of M. avium subsp. paratuberculosis between silica and clay-silica complexes or between clay soil and sandy soil. The proportion retained decreased with increasing pH in one of the experiments, indicating greater adsorption of M. avium subsp. paratuberculosis to soil particles at an acidic pH (P < 0.05). The results suggest that under experimental conditions M. avium subsp. paratuberculosis adsorbs to a range of soil particles, and this attachment is influenced by soil pH.Mycobacterium avium subsp. paratuberculosis is a pathogen of great significance for livestock since it causes a fatal and economically important disease called paratuberculosis or Johne''s disease (JD). The significance of M. avium subsp. paratuberculosis has further increased due to speculation over its role in the causation of Crohn''s disease in humans (10). Although reports trying to establish a causative association between M. avium subsp. paratuberculosis and Crohn''s disease are conflicting and inconclusive, they have aroused concerns among public health authorities (13); therefore, greater attention is now being paid to understand the natural ecology of M. avium subsp. paratuberculosis (32, 34). We investigated a largely unexplored aspect of the natural ecology of M. avium subsp. paratuberculosis: its attachment to soil particles, which could influence its availability to farm animals and humans (see below).Bacteria can become loosely associated with clay or soil particles through reversible adsorption mediated by electrostatic and van der Waals'' forces or by cell surface hydrophobicity (20). An irreversible firm attachment may later occur usually mediated by extracellular bridging polymers (8). The attachment of microbiota such as Escherichia coli, Arthrobacter spp., and poliovirus to soil or clay particles has been reported previously (2, 3, 11, 22, 26), but there is only indirect evidence of the association of mycobacteria with soil particles. A study reported the recovery of only 3.5% of nontuberculous mycobacteria inoculated into soil samples and attributed this to their adsorption to clay particles (5). Later, a similar phenomenon was inferred for M. avium subsp. paratuberculosis because 99% of these organisms in feces could not be detected upon culture of feces mixed with soil, suggesting the binding of M. avium subsp. paratuberculosis to soil particles (33). An association between M. avium subsp. paratuberculosis and clay particles was also suggested by an epidemiological study conducted to investigate the risk factors for ovine JD, indicating the possibility of bacterial attachment to clay particles (6).M. avium subsp. paratuberculosis is transmitted primarily by the feco-oral route. Infected animals shed huge numbers of M. avium subsp. paratuberculosis in their feces (29, 35), thus contaminating soil and the farm environment. The ability of M. avium subsp. paratuberculosis to survive for extended periods in an external environment, in spite of it being an obligate parasite (32, 34), facilitates the build-up of soil and pasture contamination levels over time. The attachment of M. avium subsp. paratuberculosis to soil particles could help retain the bacteria in the upper layers of the soil, thus further enhancing contamination levels. The contaminated farm environment thus becomes a potential source of infection for farm animals because grazing ruminants normally consume soil with pasture, and the amounts can be substantial, up to 300 or more grams per day for sheep (9, 21).In addition, runoff from contaminated farm soils can contaminate water bodies (23), which can be a potential health hazard for humans because the routine chlorine disinfection of water is not able to eliminate M. avium subsp. paratuberculosis completely (28). The transportation of bacteria from the farm environment to water sources is influenced by their attachment to soil or clay particles (11, 12). Generally, bacterial adsorption to soil particles decreases the rate of transportation through soil (3), but it also helps retain bacteria in the top surface layers of the soil, thus increasing the possibility of the contamination of runoff water (24). Note that soil particles can be dislodged and moved by wind, water, and mechanical factors.The aim of the present study was to verify whether M. avium subsp. paratuberculosis attaches to clay and other soil particles and whether this attachment is influenced by soil pH. The study findings improve our knowledge and understanding of the natural ecology of M. avium subsp. paratuberculosis. 相似文献
4.
David C. Alexander Christine Y. Turenne Marcel A. Behr 《Journal of bacteriology》2009,191(3):1018-1025
Mycobacterium avium comprises genetically related yet phenotypically distinct subspecies. Consistent with their common origin, whole-genome sequence comparisons have revealed extensive synteny among M. avium organisms. However, the sequenced strains also display numerous regions of heterogeneity that likely contribute to the diversity of the individual subspecies. Starting from a phylogenetic framework derived by multilocus sequence analysis, we examined the distribution of 25 large sequence polymorphisms across a panel of genetically defined M. avium strains. This distribution was most variable among M. avium subsp. hominissuis isolates. In contrast, M. avium subsp. paratuberculosis strains exhibited a characteristic profile, with all isolates containing a set of genomic insertions absent from other M. avium strains. The emergence of the pathogen from its putative M. avium subsp. hominissuis ancestor entailed the acquisition of approximately 125 kb of novel genetic material, followed by a second phase, characterized by reductive genomics. One genomic deletion is common to all isolates while additional deletions distinguish two major lineages of M. avium subsp. paratuberculosis. For the average strain, these losses total at least 38 kb (sheep lineage) to 90 kb (cattle lineage). This biphasic pattern of evolution, characterized by chromosomal gene acquisition with subsequent gene loss, describes the emergence of M. avium subsp. paratuberculosis and may serve as a general model for the origin of pathogenic mycobacteria.Mycobacterium avium organisms are nontuberculous mycobacteria prevalent in environmental and clinical settings. M. avium infections result in diverse diseases, including avian tuberculosis, Johne''s disease, and Lady Windermere''s syndrome. Isolates are phenotypically different and were historically classified as separate species. However, current taxonomy, based on molecular analyses, recognizes a single species, M. avium, which is divided into distinct subgroups (21, 22).At present, M. avium subsp. hominissuis denotes environmental organisms associated with opportunistic infections in humans and swine (13, 23). M. avium subsp. avium is the classical agent of tuberculosis in birds and, along with M. avium subsp. silvaticum, represents a distinct lineage of bird pathogens (22). M. avium subsp. paratuberculosis causes Johne''s disease (Paratuberculosis), a chronic granulomatous intestinal disease (5). Although primarily associated with livestock, the bacterium may infect a wide range of mammalian hosts. A number of studies, using molecular testing for the M. avium subsp. paratuberculosis-specific insertion element IS900, have found an association between the presence of M. avium subsp. paratuberculosis and Crohn''s disease in humans (1, 9).Previous studies, including bigenomic comparisons of the sequenced strains M. avium subsp. hominissuis 104 and M. avium subsp. paratuberculosis K-10 (11), have revealed inter- and intrasubspecies differences (6, 12, 15, 16, 18, 19, 26). The phenotypic heterogeneity of M. avium strains may stem from genomic differences, but in the absence of a phylogenetic framework it has been difficult to define the key variations associated with the emergence of an individual subspecies. Recently, we proposed a phylogeny for M. avium based on multilocus sequence analysis (MLSA) of 10 genes and 56 M. avium isolates. This phylogeny is consistent with the current taxonomy and indicates that M. avium subsp. paratuberculosis is a distinct, clonal lineage of M. avium (22). To better understand the evolution of this subspecies, we have now examined the distribution of large sequence polymorphisms among a genetically defined panel of M. avium strains. Our findings reveal a characteristic genomic profile for M. avium subsp. paratuberculosis and provide insight into the biphasic evolution of this successful pathogen. 相似文献
5.
Amy Beumer Dawn King Maura Donohue Jatin Mistry Terry Covert Stacy Pfaller 《Applied and environmental microbiology》2010,76(21):7367-7370
It has been suggested that Mycobacterium avium subspecies paratuberculosis has a role in Crohn''s disease. The organism may be acquired but is difficult to culture from the environment. We describe a quantitative PCR (qPCR) method to detect M. avium subsp. paratuberculosis in drinking water and the results of its application to drinking water and faucet biofilm samples collected in the United States.Mycobacterium avium subspecies paratuberculosis is a member of the Mycobacterium avium complex. M. avium subsp. paratuberculosis causes Johne''s disease in bovine and ovine animals and has been hypothetically linked to Crohn''s disease in humans. Several review articles have been written describing the association between M. avium subsp. paratuberculosis and Crohn''s disease (1, 2, 10, 11, 16, 23). Most mycobacterial infections are acquired from the environment; however, M. avium subsp. paratuberculosis can elude laboratory culture from environmental samples (28). M. avium subsp. paratuberculosis has been cultured only once from drinking water in the United States; therefore, its occurrence in drinking water is unknown (17). There are several reasons one could expect to find M. avium subsp. paratuberculosis in drinking water. The bacterium has been isolated from surface water used as a source of drinking water (19, 20, 24, 26). It is resistant to chlorine disinfection (25). Also, other subspecies of M. avium have been detected in biofilms obtained from drinking water pipes in the United States (8, 22, 27).Due to the potential for waterborne transmission of mycobacteria and the association of M. avium subsp. paratuberculosis with human illness, the focus of this study was to estimate the organism''s occurrence in drinking water in the United States using quantitative PCR (qPCR) (15). A comprehensive method was developed for detection of M. avium subsp. paratuberculosis in drinking water and biofilms that includes the concentration of microorganisms from samples using membrane filtration, total DNA extraction and purification, and detection of two targets unique to this bacterium: IS900 and target 251. IS900 is a common target used to identify M. avium subsp. paratuberculosis, and the average number of copies per genome is 14 to 18 (13). Target 251 qPCR analysis, which corresponds to the M. avium subsp. paratuberculosis gene 2765c (David Alexander, personal communication), was developed by Rajeev et al. (21). Samples positive for both targets are considered positive for M. avium subsp. paratuberculosis. TaqMan primer and probe sequences and qPCR assay characteristics are described in Table Table1.1. The complete method is described in Fig. S1 in the supplemental material.
Open in a separate windowaFAM, 6-carboxyfluorescein; TAMRA, 6-carboxytetramethylrhodamine; ND, not determined.bThe limit of detection (LOD) of the IS900 qPCR assay was defined as the lowest copy number resulting in a CT of <40, determined from six independent dilution series.cThe limit of quantification (LOQ) was defined as the lowest copy number per assay yielding a coefficient of variation (CV) of less than 25% (33).A master standard curve was generated from six series of 10-fold dilutions of genomic DNA from M. avium subsp. paratuberculosis strain 49164 for quantification of IS900 target copies (see Fig. S2A in the supplemental material). Each dilution series contained eight standards run in triplicate for a total of 18 threshold cycle (CT) measurements per standard. A linear regression was performed on CT versus log IS900 copy number and R2 was 0.997. The standard error of y was used to create two equations to estimate the upper and lower concentration, or range, of M. avium subsp. paratuberculosis IS900 copy number.The specificities of the IS900 and target 251 primer/probe sets were evaluated by Rajeev et al. (21) on 211 M. avium subsp. paratuberculosis and 38 non-M. avium subsp. paratuberculosis isolates, and each assay was 100% specific for M. avium subsp. paratuberculosis. We further evaluated specificity using 22 M. avium subsp. paratuberculosis isolates from animals and 10 non-M. avium subsp. paratuberculosis ATCC reference strains (see Table S1 in the supplemental material) (18). Target 251 was 100% specific; however, one M. avium subsp. paratuberculosis isolate (3063) repeatedly produced a negative result by IS900 qPCR. Results suggest that a small subset of M. avium subsp. paratuberculosis isolates may not contain the IS900 element or may have a sequence that differs from that of the IS900 primer/probe set.The sensitivity of the method for detection of M. avium subsp. paratuberculosis in different drinking water matrices was evaluated by spiking serial dilutions of strain 1112 cells, ranging from 104 cells to no addition of cells, into 1-liter tap water samples obtained from five locations in the United States. The number of M. avium subsp. paratuberculosis cell equivalents was estimated by dividing the IS900 copy number obtained from the master standard curve by 18 (mean, 18 IS900 copies/M. avium subsp. paratuberculosis genome). The method provided consistent detection (5/5 samples) in a spiked sample of 100 cells/liter. In a spiked sample of 10 cells/liter, the IS900 target was detected 40% (2/5 samples) of the time, and at 1 cell/liter we did not detect the target in any spiked sample. Percent recovery was variable and decreased as the number of spiked cells decreased (Fig. (Fig.1).1). At a spike level of 1 × 104 cells/liter, the average percent recovery was 64%; this decreased to 9.2% at 1 × 102 cells/liter. Cell surface hydrophobicity, a property of mycobacteria, may have influenced clumping of the spiked sample or partitioning of M. avium subsp. paratuberculosis onto the sample bottle or filtration unit, affecting recovery of the bacterium (3).Open in a separate windowFIG. 1.Average percent recovery of M. avium subsp. paratuberculosis spiked into drinking water collected from five sites in the United States. Error bars denote standard deviation. MAP, M. avium subsp. paratuberculosis. 相似文献
TABLE 1.
qPCR assay primers, probes, DNA targets, and assay characteristicsaDNA target | Primer or probe (sequence, 5′→3′) | Product (bp) | Reference | ||
---|---|---|---|---|---|
LODb | LOQc | ||||
IS900 | IS900F (CCGCTAATTGAGAGATGCGATTGG) | 230 | 1.8 | 1.8 | 13 |
IS900R (ATTCAACTCCAGCAGCGCGGCCTC) | |||||
IS900P (6-FAM-TCCACGCCCGCCCAGACAGG-TAMRA) | |||||
Target 251 | 251F (GCAAGACGTTCATGGGAACT) | 200 | ND | ND | 21 |
251R (GCGTAACTCAGCGAACAACA) | |||||
251P (6-FAM-CTGACTTCACGATGCGGTTCTTC-TAMRA) |
6.
Mycobacterium abscessus is a rapidly growing mycobacterial species that can be involved in pulmonary and disseminated infections in immunosuppressed or young cystic fibrosis patients. It is an emerging pathogen and has attracted recent attention due to the numerous cases of infection; furthermore, genomic tools have been developed for this species. Nevertheless, the study of this species has until now been limited to spontaneous variants. We report here a comparison of three different mutagenesis systems—the ts-sacB, the phage, and the recombineering systems—and show that there are important differences in their efficiency for the construction of allelic-exchange mutants. We show, using the mmpL4b gene of the glycopeptidolipid pathway as a target, that allelic-exchange mutants can be constructed with a reasonable efficiency (∼7%) using the recombineering system. These observations will facilitate genetic and cellular microbiology experiments involving the construction and use of well-defined mutants to study the virulence determinant of this emerging pathogen.The mycobacterial genus contains plethora of species that are pathogenic for either humans or animals. The most well-known are undoubtedly Mycobacterium leprae, M. tuberculosis, and M. ulcerans, the etiologic agents of human leprosy, tuberculosis, and Buruli ulcer, respectively (47-49). M. avium subsp. paratuberculosis, responsible for Johnes disease in ruminants, is also a serious health concern since it is suspected to be a threat to human via infected milk (9, 10). M. abscessus is an emerging pathogen involved in pulmonary and disseminated infection in young cystic fibrosis patients (26, 36). M. abscessus can cause nosocomial infections of skin and soft tissues in immunosuppressed patients (28, 35). It is also able to cross the blood-brain barrier and to cause meningoencephalitis (42). M. abscessus is phylogenetically related to M. chelonae and, indeed, these species have long been grouped together under the designation of the “M. abscessus-chelonae complex” (6). M. abscessus is a rapid grower that forms colonies in 5 days. Like other mycobacterial species, M. abscessus is equipped with a robust waxy cell wall that, as in other species, probably contributes to virulence (12). The emerging and growing interest in M. abscessus has led to its genome being sequenced (accession no. NC010397) (F. Ripoll et al., unpublished data) and to the development of DNA microarrays (Jean-Yves Coppée, unpublished data).The availability of genomic resources and animal models (32) makes M. abscessus a very attractive system. However, there is no defined mutagenesis system for this species and, to the best of our knowledge, no defined mutants have been constructed thus far. The consequence is that the study of this organism has been restricted to spontaneous variants. Utilization of spontaneous mutants has, nevertheless, allowed the characterization of morphotypically rough isolates that are hypervirulent both in vitro and in vivo (7, 8, 17). These rough isolates are low glycopeptidolipid producers. Glycopeptidolipid is an extractable lipid found at the surface of the bacilli (4, 11, 13). However, its role in the virulence process is currently unknown. The lack of a suitable genetic system is certainly responsible for the rarity of studies on this species (fewer than 500 references in Medline, whereas there are more than 32,000 for M. tuberculosis). Other mycobacterial species, especially M. tuberculosis, have been genetically intractable for many years (15, 18, 24). This has forced researchers to develop dedicated systems for the construction of allelic-exchange mutants. Three major systems have mainly been used thus far in M. tuberculosis and in other mycobacteria: (i) a thermosensitive counterselectable plasmid based on sucrose sensitivity (21-23), (ii) a thermosensitive mycobacteriophage (2) and, more recently, (iii) a mycobacterial recombinase-based system (43, 44). These three systems are effective in M. tuberculosis, M. smegmatis, and other refractory species, including M. avium subsp. avium, and allow straightforward construction of both marked and unmarked mutants.The aim of the present study was to compare the three main mutagenesis systems available for mycobacteria and to determine which system is best adapted to M. abscessus. To this end, we used mmpL4b as a target gene and the three genetic tools described above. The mmpL4b gene is involved in glycopeptidolipid synthesis (29, 40) and is a good model target because its mutation results in a rough phenotype that can be visually distinguished. We show here that there are large differences in efficacy between the three systems and that the mycobacterial recombinase-based system is the most efficient. For an unknown reason, allelic exchange is much less frequent in M. abscessus than in other species, including M. tuberculosis; this complicates the construction of defined mutants. The availability of a suitable genetic system will undoubtedly facilitates the characterization of the virulence determinants in this emerging pathogen. 相似文献
7.
8.
David Berry Matthias Horn Chuanwu Xi Lutgarde Raskin 《Applied and environmental microbiology》2010,76(19):6685-6688
Stable Mycobacterium avium infections of several Acanthamoeba strains were characterized by increased infection resistance of recent environmental isolates and reduced infectivity in the presence of other bacteria. Exposure of M. avium in coculture with Acanthamoeba castellanii to monochloramine yielded inactivation kinetics markedly similar to those observed for A. castellanii alone.Acanthamoebae are widely distributed in the environment (20) and generally function ecologically as predators of bacteria (23), although numerous types of bacteria resist predation (22). Acanthamoebae are very resistant to a range of disinfectants (5, 6, 8, 28), and bacteria within acanthamoebae are generally afforded extra protection (16). A notable example is the opportunistic pathogen Mycobacterium avium (10), which can survive within Acanthamoeba species trophozoites and cysts (4, 26), resulting in increased resistance to several antimicrobials (22). It has been demonstrated that many Mycobacterium spp. are able to infect the laboratory strain Acanthamoeba polyphaga (1). Acanthamoeba cultures undergo many physiological changes after several passages in the laboratory (15, 17, 21), although it is not known if prolonged cultivation of Acanthamoeba alters their capacity to be infected by M. avium. This knowledge is important for assessing the environmental relevance of associations between Acanthamoeba and M. avium. Therefore, we studied the infectivity and infection stability of M. avium with several laboratory and environmental Acanthamoeba strains for 28 days under high-nutrient (peptone-yeast extract-glucose [PYG] medium) and low-nutrient (Page''s amoeba saline [PAS]) conditions. 相似文献
9.
T. R. Blower P. C. Fineran M. J. Johnson I. K. Toth D. P. Humphreys G. P. C. Salmond 《Journal of bacteriology》2009,191(19):6029-6039
Bacteria are constantly challenged by bacteriophage (phage) infection and have developed multiple adaptive resistance mechanisms. These mechanisms include the abortive infection systems, which promote “altruistic suicide” of an infected cell, protecting the clonal population. A cryptic plasmid of Erwinia carotovora subsp. atroseptica, pECA1039, has been shown to encode an abortive infection system. This highly effective system is active across multiple genera of gram-negative bacteria and against a spectrum of phages. Designated ToxIN, this two-component abortive infection system acts as a toxin-antitoxin module. ToxIN is the first member of a new type III class of protein-RNA toxin-antitoxin modules, of which there are multiple homologues cross-genera. We characterized in more detail the abortive infection phenotype of ToxIN using a suite of Erwinia phages and performed mutagenesis of the ToxI and ToxN components. We determined the minimal ToxI RNA sequence in the native operon that is both necessary and sufficient for abortive infection and to counteract the toxicity of ToxN. Furthermore, site-directed mutagenesis of ToxN revealed key conserved amino acids in this defining member of the new group of toxic proteins. The mechanism of phage activation of the ToxIN system was investigated and was shown to have no effect on the levels of the ToxN protein. Finally, evidence of negative autoregulation of the toxIN operon, a common feature of toxin-antitoxin systems, is presented. This work on the components of the ToxIN system suggests that there is very tight toxin regulation prior to suicide activation by incoming phage.Interactions between bacteria and their natural parasites, bacteriophages (phage), have global-scale effects (42). Although the vast majority of the phage infections, which occur at a rate of 1025 infections per s (26), are overlooked by humans, en masse they affect environmental nutrient cycling (18) and have long been known to be vital to the spread and continued diversity of microbial genes (11). A tiny proportion of this activity can directly affect our everyday activities; the lysis of bacteria following phage infection has potential medical benefits, such as use in phage therapy (30), or can be economically damaging, as it is in cases of bacterial fermentation failure (for instance, in the dairy industry [31]).Gram-positive lactococcal strains used in dairy fermentation have been shown to naturally harbor multiple phage resistance mechanisms (16). These mechanisms can be broadly classed as systems which (i) prevent phage adsorption, (ii) interfere with phage DNA injection, (iii) restrict unmodified DNA, and (iv) induce abortive infection. There is also an increasing amount of research that focuses on new systems that use clustered regularly interspaced short palindromic repeats to mediate phage resistance (3). Clustered regularly interspaced short palindromic repeats and associated proteins, although widespread in archaea and bacteria (39), have not been identified yet in lactococcal strains (23).The abortive infection (Abi) systems induce cell death upon phage infection and often rely on a toxic protein to cause “altruistic cell suicide” in the infected host (16). Although Abi systems have been studied predominantly using lactococcal systems, because of their potential economic importance (8) they have been identified in some gram-negative species, such as Escherichia coli, Vibrio cholerae, Shigella dysenteriae, and Erwinia carotovora (9, 14, 36, 38). The prr and lit systems of E. coli have been studied at the molecular level, and their mode of action and mode of activation by incoming phage have been identified (2, 37, 38). In contrast, lactococcal Abi systems have been characterized mainly by the range of phages actively aborted and the scale of these effects, and the Abi systems have been grouped based on general modes of action (8, 12). More recently, research has begun to identify more specific lactococcal Abi activities at the molecular level (12, 17) and has revealed phage activation of two such Abi systems (6, 21).An Abi system was identified on plasmid pECA1039, which was isolated from a strain of the phytopathogen E. carotovora subsp. atroseptica (14). Designated ToxIN, this two-component Abi system operates as a novel protein-RNA toxin-antitoxin (TA) system to abort phage infection in multiple gram-negative bacteria. The toxic activity of the ToxN protein was inhibited by ToxI RNA, which consists of 5.5 direct repeats of 36 nucleotides. It is now recognized that TA loci, which were originally characterized as “plasmid addiction” modules (43), are widely distributed in the chromosomes of archaea and bacteria (19) and in phage genomes, such as that of the extrachromosomal prophage P1 (27). As a result, the precise biological role of TA systems is under debate (29). It is clear, however, that they can be effective phage resistance systems, as is the case for toxIN in E. carotovora subsp. atroseptica (14) and hok/sok and mazEF in E. coli (22, 33). Previously characterized TA systems operate with both components interacting as either RNAs (e.g., hok/sok) (type I) or proteins (e.g., MazE and MazF) (type II). In this study, a mutagenesis approach was used to further characterize the ToxI and ToxN components of the new (type III) protein-RNA TA Abi system. The regulation of the operon and the mode of phage activation were also examined. 相似文献
10.
11.
12.
Several mycoplasma species feature a membrane protrusion at a cell pole, and unknown mechanisms provide gliding motility in the direction of the pole defined by the protrusion. Mycoplasma gallisepticum, an avian pathogen, is known to form a membrane protrusion composed of bleb and infrableb and to glide. Here, we analyzed the gliding motility of M. gallisepticum cells in detail. They glided in the direction of the bleb at an average speed of 0.4 μm/s and remained attached around the bleb to a glass surface, suggesting that the gliding mechanism is similar to that of a related species, Mycoplasma pneumoniae. Next, to elucidate the cytoskeletal structure of M. gallisepticum, we stripped the envelopes by treatment with Triton X-100 under various conditions and observed the remaining structure by negative-staining transmission electron microscopy. A unique cytoskeletal structure, about 300 nm long and 100 nm wide, was found in the bleb and infrableb. The structure, resembling an asymmetrical dumbbell, is composed of five major parts from the distal end: a cap, a small oval, a rod, a large oval, and a bowl. Sonication likely divided the asymmetrical dumbbell into a core and other structures. The cytoskeletal structures of M. gallisepticum were compared with those of M. pneumoniae in detail, and the possible protein components of these structures were considered.Mycoplasmas are commensal and occasionally pathogenic bacteria that lack a peptidoglycan layer (50). Several species feature a membrane protrusion at a pole; for Mycoplasma mobile, this protrusion is called the head, and for Mycoplasma pneumoniae, it is called the attachment organelle (25, 34-37, 52, 54, 58). These species bind to solid surfaces, such as glass and animal cell surfaces, and exhibit gliding motility in the direction of the protrusion (34-37). This motility is believed to be essential for the mycoplasmas'' pathogenicity (4, 22, 27, 36). Recently, the proteins directly involved in the gliding mechanisms of mycoplasmas were identified and were found to have no similarities to those of known motility systems, including bacterial flagellum, pilus, and slime motility systems (25, 34-37).Mycoplasma gallisepticum is an avian pathogen that causes serious damage to the production of eggs for human consumption (50). The cells are pear-shaped and have a membrane protrusion, consisting of the so-called bleb and infrableb (29), and gliding motility (8, 14, 22). Their putative cytoskeletal structures may maintain this characteristic morphology because M. gallisepticum, like other mycoplasma species, does not have a cell wall (50). In sectioning electron microscopy (EM) studies of M. gallisepticum, an intracellular electron-dense structure in the bleb and infrableb was observed, suggesting the existence of a cytoskeletal structure (7, 24, 29, 37, 58). Recently, the existence of such a structure has been confirmed by scanning EM of the structure remaining after Triton X-100 extraction (13), although the details are still unclear.A human pathogen, M. pneumoniae, has a rod-shaped cytoskeletal structure in the attachment organelle (9, 15, 16, 31, 37, 57). M. gallisepticum is related to M. pneumoniae (63, 64), as represented by 90.3% identity between the 16S rRNA sequences, and it has some open reading frames (ORFs) homologous to the component proteins of the cytoskeletal structures of M. pneumoniae (6, 17, 48). Therefore, the cytoskeletal structures of M. gallisepticum are expected to be similar to those of M. pneumoniae, as scanning EM images also suggest (13).The fastest-gliding species, M. mobile, is more distantly related to M. gallisepticum; it has novel cytoskeletal structures that have been analyzed through negative-staining transmission EM after extraction by Triton X-100 with image averaging (45). This method of transmission EM following Triton X-100 extraction clearly showed a cytoskeletal “jellyfish” structure. In this structure, a solid oval “bell,” about 235 nm wide and 155 nm long, is filled with a 12-nm hexagonal lattice. Connected to this bell structure are dozens of flexible “tentacles” that are covered with particles 20 nm in diameter at intervals of about 30 nm. The particles appear to have 180° rotational symmetry and a dimple at the center. The involvement of this cytoskeletal structure in the gliding mechanism was suggested by its cellular localization and by analyses of mutants lacking proteins essential for gliding.In the present study, we applied this method to M. gallisepticum and analyzed its unique cytoskeletal structure, and we then compared it with that of M. pneumoniae. 相似文献
13.
Diversity and Abundance of Zoonotic Pathogens and Indicators in Manures of Feedlot Cattle in Australia 总被引:1,自引:0,他引:1
Marcus Klein Leearna Brown Robyn W. Tucker Nicholas J. Ashbolt Richard M. Stuetz David J. Roser 《Applied and environmental microbiology》2010,76(20):6947-6950
The occurrence of 10 pathogens and three fecal indicators was assessed by quantitative PCR in manures of Australian feedlot cattle. Most samples tested positive for one or more pathogens. For the dominant pathogens Campylobacter jejuni, Listeria monocytogenes, Giardia spp., Cryptosporidium spp., and eaeA-positive Escherichia coli, 102 to 107 genome copies g−1 (dry weight) manure were recovered.More than 600,000 tons of feedlot cattle manure are generated each year in Australia, which raises concern for potential water, air, and soil contamination (21, 27). Hence, better monitoring and knowledge of the resulting risks are needed (5, 26). Most zoonotic pathogens associated with cattle are well described in the literature, especially those of major health significance, including the bacterial pathogens Campylobacter spp., Listeria monocytogenes, pathogenic Escherichia coli (particularly serotypes O157 and O111), Salmonella enterica, Yersinia spp., Leptospira spp., Coxiella burnetii, Mycobacterium avium subsp. paratuberculosis, and the parasitic protozoa Giardia lamblia and Cryptosporidium parvum (2, 21, 27). While studies of pathogen occurrence in manure are numerous, data suited to quantitatively estimating end user risks are still limited. Few surveys quantify multiple pathogens (11, 12, 14, 28), and none have concurrently measured all 10 above in cattle manure. A further constraint on risk assessment is that most data were generated in North America or Europe, where cli-mate and environment can differ markedly from Australian conditions.Addressing this knowledge gap now appears feasible, as real-time quantitative PCR (qPCR) can be used as an alternative to culture-based methods for quantifying environmental pathogens (7, 23, 29). Improvements in sample preparation and nucleic acid cleanup methods have largely overcome problems associated with the molecular biology-based analysis of fecal matter (22). Further, qPCR can detect stressed, damaged, and otherwise nonculturable cells persisting in a state of dormancy or indeed dead (15, 17, 29). The aim of this paper is to report on a quantitative survey of zoonotic pathogens and indicators in manures from Australian feedlot beef cattle.A total of 128 composited samples (five subsamples each) representing fresh feces (n = 32), pen manure (n = 32), harvested pen manure (n = 28), stockpiled manure (n = 23), composted manure (n = 6), and carcass compost (n = 7) were collected from five cattle feedlots in eastern Australia in the winter/summer of 2009 (13). All samples were assayed for the 10 key pathogens listed above and also fecal indicators (total coliforms, E. coli, and enterococci). 相似文献
14.
15.
Most bacteriophages (phages) release their progeny through the action of holins that form lesions in the cytoplasmic membrane and lysins that degrade the bacterial peptidoglycan. Although the function of each protein is well established in phages infecting Streptococcus pneumoniae, the role—if any—of the powerful bacterial autolysin LytA in virion release is currently unknown. In this study, deletions of the bacterial and phage lysins were done in lysogenic S. pneumoniae strains, allowing the evaluation of the contribution of each lytic enzyme to phage release through the monitoring of bacterial-culture lysis and phage plaque assays. In addition, we assessed membrane integrity during phage-mediated lysis using flow cytometry to evaluate the regulatory role of holins over the lytic activities. Our data show that LytA is activated at the end of the lytic cycle and that its triggering results from holin-induced membrane permeabilization. In the absence of phage lysin, LytA is able to mediate bacterial lysis and phage release, although exclusive dependence on the autolysin results in reduced virion egress and altered kinetics that may impair phage fitness. Under normal conditions, activation of bacterial LytA, together with the phage lysin, leads to greater phage progeny release. Our findings demonstrate that S. pneumoniae phages use the ubiquitous host autolysin to accomplish an optimal phage exiting strategy.Streptococcus pneumoniae (pneumococcus), a common and important human pathogen, is characterized by the high incidence of lysogeny in isolates associated with infection (34, 44). Pneumococcal bacteriophages (phages) share with the majority of bacteriophages infecting other bacterial species the “holin-lysin” system to lyse the host cell and release their progeny at the end of the lytic cycle. Genes encoding both holins and lysins (historically termed “endolysins”) are indeed found in the genomes of all known pneumococcal phages (8, 28, 31, 37). Supporting this mechanism, a lytic phenotype in the heterologous Escherichia coli system was achieved only by the simultaneous expression of the Ejh holin and the Ejl endolysin of pneumococcal phage EJ-1 (8). When these proteins were independently expressed, cellular lysis was not perceived. Similar results were shown for pneumococcal phage Cp-1, not only in E. coli, but also in the pneumococcus itself (28).Phage lysins destroy the pneumococcal peptidoglycan network due to their muralytic activity, whereas holins have been shown in S. pneumoniae to form nonspecific lesions (8), most likely upon a process of oligomerization in the cytoplasmic membrane, as observed for the E. coli phage λ (13, 14, 43). It was generally proposed that holin lesions allow access of phage lysins to the cell wall (52, 54), as the majority of phage lysins, including the pneumococcal endolysins, lack a typical N-terminal secretory signal sequence and transmembrane domains (8). However, recent evidence also highlights the possibility for a holin-independent targeting of phage lysins to the cell wall, where holin lesions seem to be crucial for the activation of the already externalized phage lysins (42, 50, 51). Regardless of the mechanism operating in S. pneumoniae to activate phage lysins, holin activity compromises membrane integrity.Pneumococcal cells present their own autolytic activity, mainly due to the presence of a powerful bacterial cell wall hydrolase, LytA (an N-acetylmuramoyl-l-alanine-amidase), responsible for bacterial lysis under certain physiological conditions (47). Although other bacterial species also encode peptidoglycan hydrolases, the extensive lysis shortly after entering stationary phase caused by LytA is a unique feature of S. pneumoniae. Interestingly, LytA is translocated across the cytoplasmic membrane to the cell wall—where it remains inactive—in spite of the absence of a canonical N-terminal sequence signal (7). In the cell wall, autolysin activities are tightly regulated by mechanisms that seem to be related to the energized state of the cell membrane. In fact, depolarizing agents are able to trigger autolysis in Bacillus subtilis (16, 17), and bacteriocin-induced depletion of membrane potential triggers autolysis of some species of the genera Lactococcus and Lactobacillus, closely related to streptococci (29). It is therefore possible that the holin-inflicted perturbations of the S. pneumoniae cytoplasmic membrane upon the induction of the lytic cycle may trigger not only the lytic activity of the phage lysin, but also that of inactive LytA located in the cell wall. Accordingly, LytA could also participate in the release of phage particles at the end of the infectious cycle, especially considering its powerful autolytic activity. Previous studies have suggested a role for the host autolytic enzyme in the release of phage progeny (11, 38), but in fact, the evidence is unclear and dubious, considering that the existence of phage-encoded lysins was unknown or very poorly understood and some of the experimental conditions used to show a role of LytA could have also affected the activity of the phage lysin (38).To clarify the possible role of the bacterial autolysin in host lysis, we used the S. pneumoniae strain SVMC28, lysogenic for the SV1 prophage (34), which contains a typical “holin-lysin” cassette, and a different host strain lysogenized with the same SV1 phage. Our results show that LytA is activated by the holin-induced membrane disruption, just like the phage endolysin. In the absence of the endolysin, LytA is capable of mediating host lysis, releasing functional phage particles able to complete their life cycle. Still, sole dependence on LytA results in an altered pattern of phage release that may reduce phage fitness. Importantly, we also show that, together with the endolysin, the concurrent LytA activation is critical for optimal phage progeny release. 相似文献
16.
Ornella Preisner Raquel Guiomar Jorge Machado José Cardoso Menezes Jo?o Almeida Lopes 《Applied and environmental microbiology》2010,76(11):3538-3544
Fourier transform infrared (FT-IR) spectroscopy and chemometric techniques were used to discriminate five closely related Salmonella enterica serotype Enteritidis phage types, phage type 1 (PT1), PT1b, PT4b, PT6, and PT6a. Intact cells and outer membrane protein (OMP) extracts from bacterial cell membranes were subjected to FT-IR analysis in transmittance mode. Spectra were collected over a wavenumber range from 4,000 to 600 cm−1. Partial least-squares discriminant analysis (PLS-DA) was used to develop calibration models based on preprocessed FT-IR spectra. The analysis based on OMP extracts provided greater separation between the Salmonella Enteritidis PT1-PT1b, PT4b, and PT6-PT6a groups than the intact cell analysis. When these three phage type groups were considered, the method based on OMP extract FT-IR spectra was 100% accurate. Moreover, complementary local models that considered only the PT1-PT1b and PT6-PT6a groups were developed, and the level of discrimination increased. PT1 and PT1b isolates were differentiated successfully with the local model using the entire OMP extract spectrum (98.3% correct predictions), whereas the accuracy of discrimination between PT6 and PT6a isolates was 86.0%. Isolates belonging to different phage types (PT19, PT20, and PT21) were used with the model to test its robustness. For the first time it was demonstrated that FT-IR analysis of OMP extracts can be used for construction of robust models that allow fast and accurate discrimination of different Salmonella Enteritidis phage types.Over the past 10 years there has been an increase in the incidence of gastrointestinal infections caused by Salmonella enterica serovar Enteritidis, which is now one of the leading S. enterica serotypes worldwide (21, 27). Poultry, poultry products, cattle, and dairy products are the predominant sources of Salmonella-contaminated food products that cause human salmonellosis (28). Large-scale infections continue to occur in developed countries (8). Unrestricted international movement of commercially prepared food and food ingredients and dissimilarities in government and industry food safety controls during the processing, distribution, and marketing of products have surely contributed to the increase in food-borne outbreaks. Salmonella is a tremendous challenge for the agricultural and food processing industries because of its ability to survive under adverse conditions, such as low levels of nutrients and suboptimal temperatures (4, 13).Salmonella Enteritidis isolates can be categorized for epidemiological purposes by using a variety of typing tools (13). These tools include typing techniques such as serological and phage typing (29) and antibiotic resistance patterns (25). These methods are now supplemented by molecular genetics techniques, such as DNA fingerprinting (23), plasmid profiling (16), and pulsed-field gel electrophoresis (26). Phage typing has been used to diagnose Salmonella outbreaks, including S. enterica serovar Typhi and S. enterica serovar Typhimurium outbreaks (29). It is useful to evaluate whether isolates obtained from different sources at different times are similar or distinct in terms of their reactions with a specific collection of bacteriophages used for typing. The correlation between phage type and the source of an epidemic is high (22). Although very effective, existing classification methods are time-consuming, laborious, and expensive, and they often require special training of personnel and expertise, which can prevent a rapid response to the presence of pathogenic bacterial species.Fourier transform infrared (FT-IR) spectroscopy has been successfully used for differentiation and classification of microorganisms at the species and subspecies levels (7, 9, 12, 15, 18, 19, 20). This technique has been shown to have high discriminatory power and allows identification of bacteria at distinct taxonomic levels based on differences in the infrared absorption patterns of microbial cells. FT-IR spectroscopy has been used to differentiate and characterize intact microbial cells based on outer membrane cell components, including lipopolysaccharides (LPS), lipoproteins, and phospholipids (24). Several studies in which S. enterica serotypes have been discriminated using multivariate data analysis and FT-IR spectroscopy have been performed (1, 2, 10, 11). Kim et al. (11) compared the FT-IR spectra of intact cells and the FT-IR spectra of outer membrane protein (OMP) extracts from S. enterica serotypes to discriminate serotypes. Analysis of spectra of OMP extracts in the 1,800- to 1,500-cm−1 region resulted in 100% correct classification of the serotypes investigated.Previously, there have been no reports of differentiation of Salmonella Enteritidis phage types by FT-IR spectroscopy and chemometric methods. To discriminate closely related phage types of Salmonella Enteritidis in this study, intact cells and OMP extracts of bacterial cell membranes were subjected to FT-IR analysis. The isolates analyzed included isolates belonging to five of the phage types of Salmonella Enteritidis found most frequently in Portuguese hospitals in the period from 2004 to 2006, phage type 1 (PT1), PT1b, PT4b, PT6, and PT6a (5, 14). Chemometric models were used to discriminate between phage types based on infrared spectra. 相似文献
17.
Alejandra A. Latorre Jo Ann S. Van Kessel Jeffrey S. Karns Michael J. Zurakowski Abani K. Pradhan Ruth N. Zadoks Kathryn J. Boor Ynte H. Schukken 《Applied and environmental microbiology》2009,75(5):1315-1323
A longitudinal study aimed to detect Listeria monocytogenes on a New York State dairy farm was conducted between February 2004 and July 2007. Fecal samples were collected every 6 months from all lactating cows. Approximately 20 environmental samples were obtained every 3 months. Bulk tank milk samples and in-line milk filter samples were obtained weekly. Samples from milking equipment and the milking parlor environment were obtained in May 2007. Fifty-one of 715 fecal samples (7.1%) and 22 of 303 environmental samples (7.3%) were positive for L. monocytogenes. A total of 73 of 108 in-line milk filter samples (67.6%) and 34 of 172 bulk tank milk samples (19.7%) were positive for L. monocytogenes. Listeria monocytogenes was isolated from 6 of 40 (15%) sampling sites in the milking parlor and milking equipment. In-line milk filter samples had a greater proportion of L. monocytogenes than did bulk tank milk samples (P < 0.05) and samples from other sources (P < 0.05). The proportion of L. monocytogenes-positive samples was greater among bulk tank milk samples than among fecal or environmental samples (P < 0.05). Analysis of 60 isolates by pulsed-field gel electrophoresis (PFGE) yielded 23 PFGE types after digestion with AscI and ApaI endonucleases. Three PFGE types of L. monocytogenes were repeatedly found in longitudinally collected samples from bulk tank milk and in-line milk filters.Listeria monocytogenes can cause listeriosis in humans. This illness, despite being underreported, is an important public health concern in the United States (23) and worldwide. According to provisional incidence data provided by the Centers for Disease Control and Prevention (CDC), 762 cases of listeriosis were reported in the United States in 2007. In previous years (2003 to 2006), the number of reported annual listeriosis cases in the United States ranged between 696 and 896 cases per year (5).Exposure to food-borne L. monocytogenes may cause fever, muscle aches, and gastroenteritis (30), but does not usually cause septicemic illness in healthy nonpregnant individuals (7, 30). Elderly and immunocompromised people, however, are susceptible to listeriosis (22, 10), and they may develop more-severe symptoms (10). Listeriosis in pregnant women may cause abortion (22, 30) or neonatal death (22).Dairy products have been identified as the source of several human listeriosis outbreaks (4, 7, 10, 22). Listeria is ubiquitous on dairy farms (26), and it has been isolated from cows'' feces, feed (3, 26), and milk (21, 35). In ruminants, L. monocytogenes infections may be asymptomatic or clinical. Clinical cases typically present with encephalitis and uterine infections, often resulting in abortion (26, 39). Both clinically infected and healthy animals have been reported to excrete L. monocytogenes in their feces (20), which could eventually cause contamination of the bulk tank milk or milk-processing premises (39).On-farm epidemiologic research provides science-based information to improve farming and management practices. The Regional Dairy Quality Management Alliance (RDQMA) launched a combined United States Department of Agriculture (USDA)-RDQMA pilot project in January 2004 to scientifically validate intervention strategies in support of recommended best management practices among northeast dairy farms. The primary goal of the project was to track dynamics of infectious microorganisms on well-characterized dairy farms. Target species included Salmonella spp. (6, 36, 37), Mycobacterium avium subsp. paratuberculosis (13, 24), and L. monocytogenes.The objectives of this study were to describe the presence of L. monocytogenes on a dairy farm over time and to perform molecular subtyping by pulsed-field gel electrophoresis (PFGE) on L. monocytogenes isolates obtained from bulk tank milk, milk filters, milking equipment, feces, and the environmental samples to identify diversity among L. monocytogenes strains, persistence, and potential sources of bulk tank milk contamination. 相似文献
18.
Kohjiro Tanaka Seiichi Furukawa Naruo Nikoh Tetsuhiko Sasaki Takema Fukatsu 《Applied and environmental microbiology》2009,75(17):5676-5686
Wolbachia endosymbionts are ubiquitously found in diverse insects including many medical and hygienic pests, causing a variety of reproductive phenotypes, such as cytoplasmic incompatibility, and thereby efficiently spreading in host insect populations. Recently, Wolbachia-mediated approaches to pest control and management have been proposed, but the application of these approaches has been hindered by the lack of genetic transformation techniques for symbiotic bacteria. Here, we report the genome and structure of active bacteriophages from a Wolbachia endosymbiont. From the Wolbachia strain wCauB infecting the moth Ephestia kuehniella two closely related WO prophages, WOcauB2 of 43,016 bp with 47 open reading frames (ORFs) and WOcauB3 of 45,078 bp with 46 ORFs, were characterized. In each of the prophage genomes, an integrase gene and an attachment site core sequence were identified, which are putatively involved in integration and excision of the mobile genetic elements. The 3′ region of the prophages encoded genes with sequence motifs related to bacterial virulence and protein-protein interactions, which might represent effector molecules that affect cellular processes and functions of their host bacterium and/or insect. Database searches and phylogenetic analyses revealed that the prophage genes have experienced dynamic evolutionary trajectories. Genes similar to the prophage genes were found across divergent bacterial phyla, highlighting the active and mobile nature of the genetic elements. We suggest that the active WO prophage genomes and their constituent sequence elements would provide a clue to development of a genetic transformation vector for Wolbachia endosymbionts.Members of the genus Wolbachia are endosymbiotic bacteria belonging to the Alphaproteobacteria and infecting a wide range of arthropods, including over 60% of insect species, and some filarial nematodes. They are vertically transmitted through the maternal germ line of their host and are known to distort host reproduction by causing cytoplasmic incompatibility (CI), parthenogenesis, male killing, or feminization. The ability of Wolbachia to cause these reproductive phenotypes is thought to be responsible for their efficient and rapid spread into host populations (5, 21, 35, 51).Recently, Wolbachia-mediated pest control approaches have been proposed. A number of insect pests that have important medical and hygienic consequences, such as tsetse flies and mosquitoes that vector devastating human pathogens including African sleeping disease trypanosomes, malaria plasmodia, dengue viruses, Japanese encephalitis viruses, and others, often also carry Wolbachia infections (8, 24, 25, 34). In theory, if maternally transmitted genetic elements coinherited with a CI-inducing Wolbachia, such as mitochondria, the Wolbachia itself, or other coinfecting endosymbionts, are transformed with a gene of interest (like a gene that confers resistance of the vector insect against the pathogen infection), the genetic trait is expected to be spread and fixed in the host insect population, driven by the symbiont-induced reproductive phenotype (1, 2, 10, 11, 13, 32, 43, 44). The paratransgenesis and Wolbachia-driven population replacement approaches are, although potentially promising in controlling such insect-borne diseases, still at a conceptual stage mainly because no technique has been available for Wolbachia transformation.For genetic transformation of bacteria, mobile genetic elements such as plasmids, bacteriophages, and transposons have been used successfully. For example, pUC plasmids, λ phages, and transposons have been widely utilized for transforming Escherichia coli and other model bacterial species (38). While few plasmids and transposons have been reported from Wolbachia, a family of bacteriophages, called WO phages, has been detected from a diverse array of Wolbachia strains (3, 6, 7, 12, 17, 18, 31, 39, 49). For example, in the genomes of the Wolbachia strains wMel from the fruit fly Drosophila melanogaster and wPip from the mosquito Culex quinquefasciatus, three and five WO prophages are present, respectively (26, 52). Many of the prophages are pseudogenized and inactive while some are active and capable of producing phage particles (4, 7, 15, 17, 30, 40). Such active WO phage elements may provide tools for genetic transformation of Wolbachia endosymbionts.λ phage and many other temperate bacteriophages alternate between lytic phase and lysogenic phase in their life cycles. In the lytic phase, phage particles are produced and released via host cell lysis for infection to new host cells. In the lysogenic phase, the phage genome is integrated into the host genome via a site-specific recombination process, and the integrated phage genome, called prophage, is maintained in the host genome and multiplies together with the host DNA replication (38). Upon infection and lysogenic integration of λ phage, both ends of the linear phage genomic DNA are connected by DNA ligase, and the resultant circular phage genome is inserted into the E. coli genome by site-specific recombination at a region containing a core sequence of an attachment (att) site (28). att sites on the phage genome and the bacterial genome are called attP (phage att site) and attB (bacterial att site), respectively. After integration, attP and attB are located on both ends of the prophage, called attL (left prophage att site) and attR (right prophage att site), respectively. The integration and excision processes are mediated by a site-specific recombinase, called λ integrase, encoded in the phage genome (see Fig. S1 in the supplemental material) (27, 50). Hence, the att site and the integrase are the pivotal functional elements that mediate site-specific integration and excision of λ phage. Considering the structural similarity between λ phage and WO phage (31), identification of the att site and integrase from WO phage is of interest in that these elements could be utilized for delivering foreign genes into the Wolbachia genome.In order to identify a functional att site and integrase of WO phage, the complete genome sequences of active prophage elements producing phage particles should be determined. Here, the Wolbachia strain wCauB derived from the almond moth Cadra cautella was investigated because wCauB was reported to actively produce phage particles, and a partial genome sequence of its WO phage has been determined (15). In the original host insect, C. cautella, wCauB coexists with another Wolbachia strain wCauA, and both cause CI phenotypes and produce phage particles (15, 41). Not to be confounded by the coinfecting Wolbachia strains, we used a transfected line of the Mediterranean flour moth Ephestia kuehniella infected with wCauB only, which was generated by interspecific ooplasm transfer (42). It should be noted that a mass preparation procedure for WO phage particles by centrifugation has been established for the wCauB-infected E. kuehniella (15).In this study, we determined the complete genome sequences of two active WO prophages, named WOcauB2 and WOcauB3, that are capable of producing phage particles and that are located on the genome of the Wolbachia strain wCauB. Furthermore, we identified core sequences of att sites and integrase genes of these WO phages that are putatively involved in integration of the genetic elements into the Wolbachia genome. 相似文献
19.
James W. Wynne Torsten Seemann Dieter M. Bulach Scott A. Coutts Adel M. Talaat Wojtek P. Michalski 《Journal of bacteriology》2010,192(23):6319-6320
We report the resequencing and revised annotation of the Mycobacterium avium subsp. paratuberculosis K10 genome. A total of 90 single-nucleotide errors and a 51-bp indel in the original K10 genome were corrected, and the whole genome annotation was revised. Correction of these sequencing errors resulted in 28 frameshift alterations. The amended genome sequence is accessible via the supplemental section of study SRR060191 in the NCBI Sequence Read Archive and will serve as a valuable reference genome for future studies.The American bovine isolate K10 remains the only Mycobacterium avium subsp. paratuberculosis genome to be fully sequenced and published to date (1). Although this 4.8-Mbp genome likely contains some assembly errors (3), it has provided, and will continue to provide, an invaluable resource for Mycobacterium research. The assembly errors were identified through optical mapping of related M. avium subsp. paratuberculosis strain ATCC 19698, which revealed a 648-kb inversion around the origin of replication and two additional copies of the insertion sequences IS1311 and IS_MAP03 (3). These findings were subsequently validated via PCR, Southern blotting, and (Sanger) sequence analysis in ATCC 19698 and were also confirmed to be present in K10 (3). We designate this interim corrected genome M. avium subsp. paratuberculosis K10′. To further improve this resource, we undertook a resequencing project of the original M. avium subsp. paratuberculosis K10 genome.Whole-genome sequencing was performed on the Illumina GAIIx platform using one flow cell lane with 36-cycle paired-end chemistry. Reads were variably trimmed at the 3′ end based on the Illumina Read Segment Quality Indicator (Illumina manual), and read pairs containing ambiguous bases were removed. Read mapping onto the K10′ genome sequence was performed using SHRiMP (ver. 1.3.2) (2), and single-nucleotide polymorphisms and indels (deletion and insertion polymorphisms [DIPs]) were called using Nesoni (ver. 0.29; Monash University Victorian Bioinformatics Consortium) with default parameters. Read mapping determined that the data set comprised an average sequence coverage of 72.6 across the K10′ genome. This high sequence coverage allowed differences between K10\K10′ and the resequenced version of the genome, designated K10", to be identified with high confidence.Ninety single-nucleotide differences and one 51-bp indel were identified in the K10" genome. As confirmation that these differences are likely to represent errors in the original genome sequence, we have also detected these polymorphisms in two additional bovine M. avium subsp. paratuberculosis genomes recently sequenced and assembled within our laboratory (data not shown). Seven of the 90 differences and the 51-bp indel were subjected to PCR and Sanger sequencing for verification. All of the polymorphisms were confirmed to be present in K10" compared to the original genome sequence.Thirty-six single-nucleotide deletions and four nucleotide insertions were identified in K10" compared to the reference. These DIPs resulted in 27 frameshift mutations of protein coding loci. As a consequence of these frameshifts, one complete coding sequence (CDS) feature was removed (MAPK_3751), one novel CDS was created (MAPK_2081b), and one pseudogene was repaired (MAPK_4158-4159). In almost all of the other cases, the frameshifts resulted in proteins which more closely resembled their orthologs in M. avium subsp. hominissuis and M. intracellulare. Other frameshifts of biological interest include the truncation of a PPE family protein (MAPK_1173) and the extension of an MCE (mammalian cell entry) family protein (MAPK_4086). Compared to the reference, K10" also had a 51-bp indel within a possible MCE family protein (MAPK_1575). This indel consisted of an 11-bp deletion (bases 2436510 to 2436520 in the original K10 sequence) and an insertion of 51 bp. The resulting protein sequence now more closely resembles orthologs of the MCE family in other Mycobacterium spp. In conclusion, the fact that so many of the amended bases have resulted in revised coding regions indicates the underlying importance of this exercise. 相似文献