A directional nucleation-zipping mechanism for triple helix formation

A detailed kinetic study of triple helix formation was performed by surface plasmon resonance. Three systems were investigated involving 15mer pyrimidine oligonucleotides as third strands. Rate constants and activation energies were validated by comparison with thermodynamic values calculated from UV-melting analysis. Replacement of a T·A base pair by a C·G pair at either the 5′ or the 3′ end of the target sequence allowed us to assess mismatch effects and to delineate the mechanism of triple helix formation. Our data show that the association rate constant is governed by the sequence of base triplets on the 5′ side of the triplex (referred to as the 5′ side of the target oligopurine strand) and provides evidence that the reaction pathway for triple helix formation in the pyrimidine motif proceeds from the 5′ end to the 3′ end of the triplex according to the nucleation-zipping model. It seems that this is a general feature for all triple helices formation, probably due to the right-handedness of the DNA double helix that provides a stronger base stacking at the 5′ than at the 3′ duplex–triplex junction. Understanding the mechanism of triple helix formation is not only of fundamental interest, but may also help in designing better triple helix-forming oligonucleotides for gene targeting and control of gene expression.     

Sequence specificity in triple-helix formation: experimental and theoretical studies of the effect of mismatches on triplex stability

The specificity of a homopyrimidine oligonucleotide binding to a homopurine-homopyrimidine sequence on double-stranded DNA was investigated by both molecular modeling and thermal dissociation experiments. The presence of a single mismatched triplet at the center of the triplex was shown to destabilize the triple helix, leading to a lower melting temperature and a less favorable energy of interaction. A terminal mismatch was less destabilizing than a central mismatch. The extent of destabilization was shown to be dependent on the nature of the mismatch. Both single base-pair substitution and deletion in the duplex DNA target were investigated. When a homopurine stretch was interrupted by one thymine, guanine was the least destabilizing base on the third strand. However, G in the third strand did not discriminate between a C.G and an A.T base pair. If the stretch of purines was interrupted by a cytosine, the presence of pyrimidines (C or T) in the third strand yielded a less destabilizing effect than purines. This study shows that oligonucleotides forming triple helices can discriminate between duplex DNA sequences that differ by one base pair. It provides a basis for the choice of antigene oligonucleotide sequences targeted to selected sequences on duplex DNA.     

Proton exchange and local stability in a DNA triple helix containing a G.TA triad

Recognition of a thymine-adenine base pair in DNA by triplex-forming oligonucleotides can be achieved by a guanine through the formation of a G.TA triad within the parallel triple helix motif. In the present work, we provide the first characterization of the stability of individual base pairs and base triads in a DNA triple helix containing a G.TA triad. The DNA investigated is the intramolecular triple helix formed by the 32mer d(AGATAGAACCCCTTCTATCTTATATCTGTCTT). The exchange rates of imino protons in this triple helix have been measured by nuclear magnetic resonance spectroscopy using magnetization transfer from water and real-time exchange. The exchange rates are compared with those in a homologous DNA triple helix in which the G.TA triad is replaced by a canonical C⁺.GC triad. The results indicate that, in the G.TA triad, the stability of the Watson–Crick TA base pair is comparable with that of AT base pairs in canonical T.AT triads. However, the presence of the G.TA triad destabilizes neighboring triads by 0.6–1.8 kcal/mol at 1°C. These effects extend to triads that are two positions removed from the site of the G.TA triad. Therefore, the lower stability of DNA triple helices containing G.TA triads originates, in large part, from the energetic effects of the G.TA triad upon the stability of canonical triads located in its vicinity.     

Rational design of switched triple helix-forming oligonucleotides: Extension of sequences for triple helix formation

A rational design by means of molecular mechanics has been carried out in an effort to extend the range of double-helical DNA sequences that could be recognized by triple helix-forming oligonucleotides. The DNA target is composed of alternating, adjacent fragments of oligopurine·oligopyrimidine sequences, instead of a long stretch of polypurine·polypyrimidine sequence used for canonical triple helix formation. Based on the combination of different triple helix motifs in eitherHoogsteen orreverse Hoogsteen configuration, mini-triple helices can be formed at each oligopurine·oligopyrimidine part of the target sequence with either parallel or antiparallel orientation with respect to the purine strand. As the adjacent purine target sequences are located in the complementary strands, the third strand oligonucleotides can be joined together through a natural phosphodiester backbone at the junctions in either a 5-3 or a 3-5 polarity. There are six distinct junction steps. Molecular modeling was aimed at optimizing the cooperative binding of the so-called switched triple helix-forming oligonucleotides by choosing appropriate nucleotide(s) at the junction between two adjacent minitriple helices. A comprehensiveswitch code describing the rules for forming switched triple helices has been established. Its practical applications in extending DNA recognition by this new generation of tailor-made triple helix-forming oligonucleotides are discussed.     

Extension of the range of DNA sequences available for triple helix formation: stabilization of mismatched triplexes by acridine-containing oligonucleotides.

Triple helix formation usually requires an oligopyrimidine*oligopurine sequence in the target DNA. A triple helix is destabilized when the oligopyrimidine*oligopurine target contains one (or two) purine*pyrimidine base pair inversion(s). Such an imperfect target sequence can be recognized by a third strand oligonucleotide containing an internally incorporated acridine intercalator facing the inverted purine*pyrimidine base pair(s). The loss of triplex stability due to the mismatch is partially overcome. The stability of triplexes formed at perfect and imperfect target sequences was investigated by UV thermal denaturation experiments. The stabilization provided by an internally incorporated acridine third strand oligonucleotide depends on the sequences flanking the inverted base pair. For triplexes containing a single mismatch the highest stabilization is observed for an acridine or a propanediol tethered to an acridine on its 3'-side facing an inverted A*T base pair and for a cytosine with an acridine incorporated to its 3'-side or a guanine with an acridine at its 5'-side facing an inverted G*C base pair. Fluorescence studies provided evidence that the acridine was intercalated into the triplex. The target sequences containing a double base pair inversion which form very unstable triplexes can still be recognized by oligonucleotides provided they contain an appropriately incorporated acridine facing the double mismatch sites. Selectivity for an A*T base pair inversion was observed with an oligonucleotide containing an acridine incorporated at the mismatched site when this site is flanked by two T*A*T base triplets. These results show that the range of DNA base sequences available for triplex formation can be extended by using oligonucleotide intercalator conjugates.     

Triplex formation by morpholino oligodeoxyribonucleotides in the HER-2/neu promoter requires the pyrimidine motif

Triplex-forming oligonucleotides (TFOs) are good candidates to be used as site-specific DNA-binding agents. Two obstacles encountered with TFOs are susceptibility to nuclease activity and a requirement for magnesium for triplex formation. Morpholino oligonucleotides were shown in one study to form triplexes in the absence of magnesium. In the current study, we have compared phosphodiester and morpholino oligonucleotides targeting a homopurine–homopyrimidine region in the human HER2/neu promoter. Using gel mobility shift analysis, our data demonstrate that triplex formation by phosphodiester oligonucleotides at the HER-2/neu promoter target is possible with pyrimidine-parallel, purine-antiparallel and mixed sequence (GT)-antiparallel motifs. Only the pyrimidine-parallel motif morpholino TFO was capable of efficient triple helix formation, which required low pH. Triplex formation with the morpholino TFO was efficient in low or no magnesium. The pyrimidine motif TFOs with either a phosphodiester or morpholino backbone were able to form triple helices in the presence of potassium ions, but required low pH. We have rationalized the experimental observations with detailed molecular modeling studies. These data demonstrate the potential for the development of TFOs based on the morpholino backbone modification and demonstrate that the pyrimidine motif is the preferred motif for triple helix formation by morpholino oligonucleotides.     

Selectivity and affinity of triplex-forming oligonucleotides containing 2'-aminoethoxy-5-(3-aminoprop-1-ynyl)uridine for recognizing AT base pairs in duplex DNA

We have used DNase I footprinting, fluorescence and ultraviolet (UV) melting experiments and circular dichroism to demonstrate that, in the parallel triplex binding motif, 2′-aminoethoxy-5-(3-aminoprop-1-ynyl)uridine (bis-amino-U, BAU) has very high affinity for AT relative to all other Watson–Crick base pairs in DNA. Complexes containing two or more substitutions with this nucleotide analogue are stable at pH 7.0, even though they contain several C.GC base triplets. These modified triplex-forming oligonucleotides retain exquisite sequence specificity, with enhanced discrimination against YR base pairs (especially CG). These properties make BAU a useful base analogue for the sequence-specific creation of stable triple helices at pH 7.0.     

Synthesis and duplex DNA recognition studies of oligonucleotides containing a ureido isoindolin-1-one homo-N-nucleoside. A comparison of host-guest and DNA recognition studies

In an effort to construct non-natural bases to be used in triplex-based antigene DNA recognition strategies, a uriedo-isoindolin-1-one homo-N-nucleoside base was designed to bind the cytosine-guanine (CG) base pair. An organic soluble analogue of this base was shown to effectively complex CG (K(assoc)=740M(-1)) in chloroform through formation of three hydrogen bonds (Mertz, E.; Mattei, S.; Zimmerman, S. C. Org. Lett. 2000, 2, 2931-2934). The novel nucleoside base was synthesized and successfully incorporated into oligonucleotides which were used in triple helix melting temperature studies. Low melting temperatures were observed when the isoindolin-1-one base was paired opposite CG as well as GC, TA, and AT, thus indicating that despite favorable recognition in model studies, the artificial base did not effectively recognize duplex DNA to form pyrimidine-purine-pyrimidine type triple helices.     

Triple helical DNA in a duplex context and base pair opening

It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region.     

Detection of competing DNA structures by thermal gradient gel electrophoresis: from self-association to triple helix formation by (G,A)-containing oligonucleotides

Sequence-specific recognition of DNA can be achieved by triple helix-forming oligonucleotides that bind to the major groove of double-helical DNA. These oligonucleotides have been used as sequence-specific DNA ligands for various purposes, including sequence-specific gene regulation in the so-called ‘antigene strategy’. In particular, (G,A)-containing oligonucleotides can form stable triple helices under physiological conditions. However, triplex formation may be in competition with self-association of these oligonucleotides. For biological applications it would be interesting to identify the conditions under which one structure is favoured as compared to the other(s). Here we have directly studied competition between formation of a parallel (G,A) homoduplex and that of a triple helix by a 13 nt (G,A)-containing oligonucleotide. Temperature gradient gel electrophoresis allows simultaneous detection of competition between the two structures, because of their different temperature dependencies and gel electrophoretic mobilities, and characterisation of this competition.     

An anti-parallel triple helix motif with oligodeoxynucleotides containing 2'-deoxyguanosine and 7-deaza-2'-deoxyxanthosine.

Triple helix formation of oligodeoxynucleotides (ODNs) with a 15 base pair poly-purine DNA target in the HER2 promoter was examined by footprinting analysis. 7-deaza-2'-deoxyxanthosine (dzaX) was identified as a purine analogue of thymidine (T) which forms dzaX:A-T triplets. ODNs containing 2'-deoxyguanosine (G) and dzaX were found to form triple helices in an anti-parallel orientation, with respect to the poly-purine strand of the target DNA. In comparative studies under physiological K+ and Mg++ concentrations and at pH 7.2, the ODNs containing G and dzaX showed high affinity to the target sequence while the ODNs containing G and T were not able to bind. In the absence of added monovalent salts both ODNs showed high affinity to the target sequence. The substitution of 7-deaza-2'-deoxyguanosine for G substantially decreased the capacity of the ODNs to form triple helices under physiological conditions, indicating that dzaX may be unique in its ability to enhance triple helix formation in the anti-parallel motif.     

Synthesis and properties of triple helix-forming oligodeoxyribonucleotides containing 7-chloro-7-deaza-2'-deoxyguanosine.

Multiple incorporations of 7-chloro-7-deaza-2'-deoxyguanosine in place of 2'-deoxyguanosine have been performed into a triple helix-forming oligodeoxyribonucleotide involving a run of six contiguous guanines designed to bind in a parallel orientation relative to the purine strand of the DNA target. The ability of these modified oligodeoxyribonucleotides to form triple helices in a buffer containing monovalent cations was studied by UV--melting curves analysis, gel shift assay and restriction enzyme protection assay. In the presence of Na(+), the incorporation of two, three or five modified nucleosides in the third strand has improved the efficacy of formation of the triplex as compared to that formed with the unmodified oligonucleotide. The stabilities of the three modified triplexes were similar. The coupling of 6-chloro-2-methoxy-9-(omega-hexylamino)-acridine to the 5'-end of the oligonucleotides containing modified nucleosides led to an increase in triplex stability similar to that observed when the acridine was added to the 5'-end of the unmodified oligonucleotide. In the presence of K(+), only the oligodeoxyribonucleotides containing modified G retained the ability to form triple helices with the same efficiency. The incorporation of the modified nucleoside has two effects: (i) it decreases TFO self-association, and (ii) it slightly increases triplex stability. The enhanced ability of the modified oligonucleotides containing 7-chloro-7-deaza-2'-deoxyguanosine over the parent oligomer to form triple helices was confirmed by inhibition of restriction enzyme cleavage using a circular plasmid containing the target sequence.     

Initiation of DNA replication by DNA polymerases from primers forming a triple helix

Despite extensive studies on oligonucleotide-forming triple helices, which were discovered in 1957, their possible relevance in the initiation of DNA replication remains unknown. Using sequences forming triple helices, we have developed a DNA polymerisation assay by using hairpin DNA templates with a 3′ dideoxynucleotide end and an unpaired 5′-end extension to be replicated. The T7 DNA polymerase successfully elongated nucleotides to the expected size of the template from the primers forming triple helices composed of 9–14 deoxyguanosine-rich residues. The triple helix-forming primer required for this reaction has to be oriented parallel to the homologous sequence of the hairpin DNA template. Substitution of the deoxyguanosine residues by N7 deazadeoxyguanosines in the hairpin of the template prevented primer elongation, suggesting that the formation of a triple helix is a prerequisite for primer elongation. Furthermore, DNA sequencing could be achieved with the hairpin template through partial elongation of the third DNA strand forming primer. The T4 DNA polymerase and the Klenow fragment of DNA polymerase I provided similar DNA elongation to the T7 polymerase–thioredoxin complex. On the basis of published crystallographic data, we show that the third DNA strand primer fits within the catalytic centre of the T7 DNA polymerase, thus underlying this new property of several DNA polymerases which may be relevant to genome rearrangements and to the evolution of the genetic apparatus, namely the DNA structure and replication processes.     

Monitoring denaturation behaviour and comparative stability of DNA triple helices using oligonucleotide–gold nanoparticle conjugates

Gold nanoparticle labels, combined with UV-visible optical absorption spectroscopic methods, are employed to probe the temperature-dependent solution properties of DNA triple helices. By using oligonucleotide–nanoparticle conjugates to characterize triplex denaturation, for the first time triplex to duplex melting transitions may be sensitively monitored, with minimal signal interference from duplex to single strand melting, for both parallel and antiparallel triple helices. Further, the comparative sequence-dependent stability of DNA triple helices may also be examined using this approach. Specifically, triplex to duplex melting transitions for triplexes formed using oligonucleotides that incorporate 8-aminoguanine derivatives were successfully monitored and stabilization of both parallel and antiparallel triplexes following 8-aminoguanine substitutions is demonstrated.     

A gene-specific DNA sequencing chip for exploring molecular evolutionary change

Sequencing by hybridization (SBH) approaches to DNA sequencing face two conflicting constraints. First, in order to ensure that the target DNA binds reliably, the oligonucleotide probes that are attached to the chip array must be >15 bp in length. Secondly, the total number of possible 15 bp oligonucleotides is too large (>4¹⁵) to fit on a chip with current technology. To circumvent the conflict between these two opposing constraints, we present a novel gene-specific DNA chip design. Our design is based on the idea that not all conceivable oligonucleotides need to be placed on a chip— only those that capture sequence combinations occurring in nature. Our approach uses a training set of aligned sequences that code for the gene in question. We compute the minimum number of oligonucleotides (generally 15–30 bp in length) that need to be placed on a DNA chip to capture the variation implied by the training set using a graph search algorithm. We tested the approach in silico using cytochrome-b sequences. Results indicate that on average, 98% of the sequence of an unknown target can be determined using the approach.     

Recognition of base pair inversions in duplex by chimeric (alpha,beta) triplex-forming oligonucleotides

DNA recognition by triplex-forming oligonucleotides (TFOs) is usually limited by homopurine-homopyrimidine sequence in duplexes. Modifications of the third strand may overcome this limitation. Chimeric alpha-beta TFOs are expected to form triplex DNA upon binding to non-regular sequence duplexes. In the present study we describe binding properties of chimeric alpha-beta oligodeoxynucleotides in the respect to short DNA duplexes with one, three, and five base pair inversions. Non-natural chimeric TFO's contained alpha-thymidine residues inside (GT) or (GA) core sequences. Modified residues were addressed to AT/TA inversions in duplexes. It was found in the non-denaturing gel-electrophoresis experiments that single or five adjacent base pair inversions in duplexes may be recognized by chimeric alpha-beta TFO's at 10 degrees C and pH 7.8. Three dispersed base pair inversions in the double stranded DNA prevented triplex formation by either (GT) or (GA) chimeras. Estimation of thermal stability of chimeric alpha-beta triplexes showed decrease in T(m) values as compared with unmodified complexes.     

Strand invasion by mixed base PNAs and a PNA-peptide chimera

Peptide nucleic acid oligomers (PNAs) have a remarkable ability to invade duplex DNA at polypurine–polypyrimidine target sequences. Applications for PNAs in medicine and biotechnology would increase if the rules governing their hybridization to mixed base sequences were also clear. Here we describe hybridization of PNAs to mixed base sequences and demonstrate that simple chemical modifications can enhance recognition. Easily synthesized and readily soluble eight and 10 base PNAs bind to plasmid DNA at an inverted repeat that is likely to form a cruciform structure, providing convenient tags for creating PNA–plasmid complexes. PNAs also bind to mixed base sequences that cannot form cruciforms, suggesting that recognition is a general phenomenon. Rates of strand invasion are temperature dependent and can be enhanced by attaching PNAs to positively charged peptides. Our results support use of PNAs to access the information within duplex DNA and demonstrate that simple chemical modifications can make PNAs even more powerful agents for strand invasion. Simple strategies for enhancing strand invasion should facilitate the use of PNAs: (i) as biophysical probes of double-stranded DNA; (ii) to target promoters to control gene expression; and (iii) to direct sequence-specific mutagenesis.     

Single strand targeted triplex-formation. Destabilization of guanine quadruplex structures by foldback triplex-forming oligonucleotides.

Oligonucleotides that can hybridize to single-stranded complementary polypurine nucleic acid targets by Watson-Crick base pairing as well as by Hoogsteen base pairing, referred to here as foldback triplex-forming oligonucleotides (FTFOs), have been designed. These oligonucleotides hybridize with target nucleic acid sequences with greater affinity than antisense oligonucleotides, which hybridize to the target sequence only by Watson-Crick hydrogen bonding [Kandimalla, E. R. and Agrawal, S. Gene(1994) 149, 115-121 and references cited therein]. FTFOs have been studied for their ability to destabilize quadruplexes formation by RNA or DNA target sequences. The influence of various DNA/RNA compositions of FTFOs on their ability to destabilize RNA and DNA quadruplexes has been examined. The ability of the FTFOs to destabilize quadruplex structures is related to the structurally and thermodynamically stable foldback triplex formed between the FTFO and its target sequence. Antisense oligonucleotides (DNA or RNA) that can form only a Watson-Crick double helix with the target sequence are unable to destabilize quadruplex structures of RNA and DNA target sequences and are therefore limited in their repertoire of target sequences. The quadruplex destabilization ability of FTFOs is dependent on the nature of the cation present in solution. The RNA quadruplex destabilization ability of FTFOs is -20% higher in the presence of sodium ion than potassium ion. The use of FTFOs, which can destabilize quadruplex structure, opens up new areas for development of oligonucleotide-based therapeutics, specifically, targeting guanine-rich sequences that exist at the ends of pro- and eukaryotic chromosomes and dimerization regions of retroviral RNA.