Integration of an insertion-type transferred DNA vector from Agrobacterium tumefaciens into the Saccharomyces cerevisiae genome by gap repair.

Recently, it was shown that Agrobacterium tumefaciens can transfer transferred DNA (T-DNA) to Saccharomyces cerevisiae and that this T-DNA, when used as a replacement vector, is integrated via homologous recombination into the yeast genome. To test whether T-DNA can be a suitable substrate for integration via the gap repair mechanism as well, a model system developed for detection of homologous recombination events in plants was transferred to S. cerevisiae. Analysis of the yeast transformants revealed that an insertion type T-DNA vector can indeed be integrated via gap repair. Interestingly, the transformation frequency and the type of recombination events turned out to depend strongly on the orientation of the insert between the borders in such an insertion type T-DNA vector.     

Non-homologous end-joining proteins are required for Agrobacterium T-DNA integration.

Agrobacterium tumefaciens causes crown gall disease in dicotyledonous plants by introducing a segment of DNA (T-DNA), derived from its tumour-inducing (Ti) plasmid, into plant cells at infection sites. Besides these natural hosts, Agrobacterium can deliver the T-DNA also to monocotyledonous plants, yeasts and fungi. The T-DNA integrates randomly into one of the chromosomes of the eukaryotic host by an unknown process. Here, we have used the yeast Saccharomyces cerevisiae as a T-DNA recipient to demonstrate that the non-homologous end-joining (NHEJ) proteins Yku70, Rad50, Mre11, Xrs2, Lig4 and Sir4 are required for the integration of T-DNA into the host genome. We discovered a minor pathway for T-DNA integration at the telomeric regions, which is still operational in the absence of Rad50, Mre11 or Xrs2, but not in the absence of Yku70. T-DNA integration at the telomeric regions in the rad50, mre11 and xrs2 mutants was accompanied by gross chromosomal rearrangements.     

vir-induced recombination in Agrobacterium. Physical characterization of precise and imprecise T-circle formation

Induction of Ti plasmid virulence (vir) gene expression during the early stages of plant cell transformation by Agrobacterium tumefaciens initiates the generation of several T-DNA-associated molecular events: (1) site-specific nicks at T-DNA border sequences (border nicks); (2) free, unipolar, linear, single-stranded T-DNA copies (T-strands); and (3) double-stranded, circular T-DNA molecules (T-circles). The first two T-DNA products have been detected in A. tumefaciens, while T-circles have only been detected following Escherichia coli transformation or transduction. The relationship between the three events has not been evaluated since the genesis of T-circles in A. tumefaciens has not been clarified. Evidence is presented here that T-circles are not an artefact of E. coli transformation, but are present as free, double-stranded molecules in A. tumefaciens resulting from site-specific reciprocal recombination between the left and right 25-base-pair border sequences that flank the T-DNA. Furthermore, the frequency of T-circle formation correlates with the frequency of formation of its reciprocal product, the Ti plasmid deleted in the T-DNA region. Several types of recombinant T-DNA circles arise after activation of vir gene expression, a major class representing precise site-specific recombination between both T-DNA borders, and a minor class representing recombination events either utilizing only one T-DNA border sequence and other Ti plasmid sequences, or utilizing only Ti plasmid sequences (i.e. no T-DNA borders). Nucleotide sequence analyses show that when one (nicked) border recombines with other Ti plasmid sequences, a small stretch (16 to 17 base-pairs) of local homology suffices to allow crossing over.     

Genetic analysis of integration mediated by single T-DNA borders.

Transformation of plant cells by the T-DNA of the Ti plasmid of Agrobacterium tumefaciens depends in part upon a sequence adjacent to the right T-DNA end. When this sequence is absent, the T-DNA is almost avirulent; when it is present, DNA between it and the left T-DNA border region becomes integrated in plants. To investigate further this process of DNA transfer and integration, we introduced the right border region and the nopaline synthase (nos) gene of plasmid pTiC58 into a variety of new positions around Ti plasmids. The border region functioned when separated from the remainder of the T-DNA by almost 50 kilobases. It also worked when placed outside of the T-DNA region where there were no known left-border sequences with which to interact. Indeed, the nos gene could be transferred to plants even when no other Ti plasmid sequences were present on the same plasmid. These results may indicate that the sequence requirements for the left borders are not as stringent as those for the right borders. In addition, mutants with an extra copy of the right border region within their T-DNA were found to transfer or integrate only parts of the bacterial T-DNA region. It is possible that abnormally placed T-DNA borders interfere with the normal process of DNA transfer, integration, or both.     

Efficient octopine Ti plasmid-derived vectors for Agrobacterium-mediated gene transfer to plants.

A two-component cloning system to transfer foreign DNA into plants was derived from the octopine Ti plasmid pTiB6S3. pGV2260 is a non-oncogenic Ti plasmid from which the T-region is deleted and substituted by pBR322. pGV831 is a streptomycin-resistant pBR325 derivative that contains a kanamycin resistance marker gene for plant cells and a site for cloning foreign genes between the 25-bp border sequences of the octopine T-region. Conjugative transfer of pGV831 derivatives to Agrobacterium and cointegration by homologous recombination between the pBR322 sequences present on pGV831 and pGV2260, can be obtained in a single step. Strains carrying the resulting cointegrated plasmids transfer and integrate T-DNA into the genome of tobacco protoplasts, and transformed tobacco calli are readily selected as resistant to kanamycin. Intact plants containing the entire DNA region between the T-DNA borders have been regenerated from such clones. In view of these properties we present pGV831 and its derivatives as vectors for efficient integration of foreign genes into plants.     

Right 25 bp terminus sequence of the nopaline T-DNA is essential for and determines direction of DNA transfer from agrobacterium to the plant genome

We have determined which sequences at the right border of the T-DNA region of the nopaline C58 Ti plasmid are required for transfer and/or integration of the T-DNA into the plant cell genome. The results indicate that the 25 bp T-DNA terminus repeat sequence, TGACAGGATATATTGGCGGGTAAAC, is directly responsible for T-DNA transfer; furthermore, this sequence is directional in its mode of action. A transfer-negative nononcogenic Ti plasmid derivative, pGV3852, was constructed, in which 3 kb covering the right T-DNA border region was substituted for by pBR322 sequences. The pBR322 sequences in pGV3852 provide a site for homologous recombination with pBR-derived plasmids containing sequences to assay for transfer activity. First, a 3.3 kb restriction fragment overlapping the deleted region in pGV3852 was shown to restore transfer activity. Second, a sequence of only 25 bp, the T-DNA terminus sequence, was shown to be sufficient to restore normal transfer activity. The transfer-promoting sequences are most active when reinserted in one orientation, that normally found in the Ti plasmid.     

Ti plasmid type affects T-DNA processing in Agrobacterium tumefaciens

Agrobacterium tumefaciens can transfer the T-DNA region of a Ti plasmid to a recipient plant cell. An accepted model that describes the T-DNA transfer mechanism proposes that single-stranded T-complexes are transferred to a recipient plant via a conjugation-like mechanism. This model has been based on examination of a limited number of Ti plasmids. In this study, the type of processed T-DNA molecule created from multiple Ti plasmids was determined. The form of the processed T-DNA was found to vary and was correlated with whether the T-DNA region was organized as a single continuous region or two adjacent regions.     

Extrachromosomal homologous recombination and gene targeting in plant cells after Agrobacterium mediated transformation.

We determined whether T-DNA molecules introduced into plant cells using Agrobacterium are suitable substrates for homologous recombination. For the detection of such recombination events different mutant versions of a NPTII construct were used. In a first set of experiments protoplasts of Nicotiana tabacum SR1 were cocultivated with two Agrobacterium tumefaciens strains. Each strain contained a different T-DNA, one carrying a 5' deleted NPTII gene and the other a NPTII gene with a 3' deletion. A restored NPTII gene was found in 1-4% of the protoplasts that had been cotransformed with both T-DNAs. Restoration of the NPTII gene could only be the consequence of homologous recombination between the two different T-DNAs in the plant cell, since the possibility of recombination in Agrobacterium was excluded in control experiments. In subsequent experiments was investigated the potential use of Agrobacterium for gene targeting in plants. A transgenic tobacco line with a T-DNA insertion carrying a defective NPTII gene with a 3' deletion was transformed via Agrobacterium with a T-DNA containing a defective NPTII repair gene. Several kanamycin resistant plant lines were obtained with an intact NPTII gene integrated in their genome. In one of these lines the defective NPTII gene at the target locus had been properly restored. Our results show that in plants recombination can occur between a chromosomal locus and a homologous T-DNA introduced via A. tumefaciens. This opens the possibility of using the Agrobacterium transformation system for site directed mutagenesis of the plant genome.     

Integration of T-DNA binary vector 'backbone' sequences into the tobacco genome: evidence for multiple complex patterns of integration

During the process of crown gall tumorigenesis, Agrobacterium tumefaciens transfers part of the tumor-inducing (Ti) plasmid, the T-DNA, to a plant cell where it eventually becomes stably integrated into the plant genome. Directly repeated DNA sequences, called T-DNA borders, define the left and the right ends of the T-DNA. The T-DNA can be physically separated from the remainder of the Ti-plasmid, creating a 'binary vector' system; this system is frequently used to generate transgenic plants. Scientists initially thought that only those sequences located between T-DNA left and right borders transferred to the plant. More recently, however, several reports have appeared describing the integration of the non-T-DNA binary vector 'backbone' sequences into the genome of transgenic plants. In order to investigate this phenomenon, we constructed T-DNA binary vectors containing a nos-nptll gene within the T-DNA and a mas2'-gusA (β-glucuronidase) gene outside the T-DNA borders. We regenerated kanamycin-resistant transgenic tobacco plants and analyzed these plants for the expression of the vector-localized gusA gene and for the presence of binary vector backbone sequences. Approximately one-fifth of the plants expressed detectable GUS activity. PCR analysis indicated that approximately 75% of the plants contained the gusA gene. Southern blot analysis indicated that the vector backbone sequences could integrate into the tobacco genome linked either to the left or to the right T-DNA border. The vector backbone sequences could also integrate into the plant genome independently of (unlinked to) the T-DNA. Although we could readily detect T-strands containing the T-DNA within the bacterium, we could not detect T-strands containing only the vector backbone sequences or these vector sequences linked to the T-DNA.     

Agrobacterium tumefaciens transfers extremely long T-DNAs by a unidirectional mechanism.

During crown gall tumorigenesis, part of the Agrobacterium tumefaciens tumor-inducing (Ti) plasmid, the T-DNA, integrates into plant DNA. Direct repeats define the left and right ends of the T-DNA, but tumorigenesis requires only the right-hand repeat. Virulence (vir) genes act in trans to mobilize the T-DNA into plant cells. Transfer of T-DNA begins when the VirD endonuclease cleaves within the right-hand border repeat. Although the T-DNA right-border repeat promotes T-DNA transmission best in its normal orientation, an inverted right border exhibits reduced but significant activity. Two models may account for this diminished tumorigenesis. The right border may function bidirectionally, with strong activity only in its wild-type orientation, or it may promote T-DNA transfer in a unidirectional manner such that, with an inverted right border, transfer proceeds around the entire Ti plasmid before reaching the T-DNA. To determine whether a substantial portion of the Ti plasmid is transferred to plant cells, as predicted by the unidirectional-transfer hypothesis, we examined T-DNAs in tumors induced by strains containing a Ti plasmid with a right border inverted with respect to the T-DNA oncogenes. These tumors contained extremely long T-DNAs corresponding to most or all of the Ti plasmid. To test whether the right border can function bidirectionally, we inserted T-DNAs with either a properly oriented or an inverted right border into a specific site in the A. tumefaciens chromosome. A border situated to transfer the oncogenes first directed T-DNA transfer even from the bacterial chromosome, whereas a border in the opposite (inverted) orientation did not transfer the oncogenes to plant cells. Our results indicate that the right-border repeat functions in a unidirectional manner.     

Transfer of the Ti plasmid from Agrobacterium tumefaciens into Escherichia coli cells

We have screened strains of Agrobacterium tumefaciens for spontaneous mutants showing constitutive transfer of the nopaline Ti plasmid pTiC58 during conjugation. The Ti plasmid derivatives obtained could be transferred not only to A. tumefaciens but also to E. coli cells. The Ti plasmid cannot survive as a freely replicating plasmid in E. coli, but it can occasionally integrate into the E. coli chromosome. However, insertion in tandem of plasmids carrying fd replication origins (pfd plasmids) into the T-DNA provides an indicator for all transfer events into E. coli cells, providing fd gene 2 protein is present in these cells. This viral protein causes the excision of one copy of the pfd plasmid and allows its propagation in the host cell. By using this specially designed Ti plasmid, which was also made constitutive in transfer functions, we found plasmid exchange among A. tumefaciens strains and between A. tumefaciens and E. coli cells to be equally efficient. A Ti plasmid with repressed transfer functions was transferred to E. coli with a rate similar to the low frequency at which it was transferred to A. tumefaciens. The expression of transfer functions of plasmid RP4 either in A. tumefaciens or in E. coli did not increase the transfer of the Ti plasmid into E. coli cells, nor did the addition of acetosyringone, an inducer of T-DNA transfer to plant cells. The results show that A. tumefaciens can transfer the Ti plasmid to E. coli with the same efficiency as within its own species. Conjugational transmission of extrachromosomal DNA like the narrow-host-range Ti plasmid may often not only occur among partners allowing propagation of the plasmid, but also on a 'try-all' basis including hosts which do not replicate the transferred DNA.     

DNA rearrangement associated with the integration of T-DNA in tobacco: an example for multiple duplications of DNA around the integration target

Transferred DNA (T-DNA) of the tumor-inducing (Ti) plasmid is transferred from Agrobacterium tumefaciens to plant cells and is stably integrated into the plant nuclear genome. By the inverse polymerase chain reaction DNA fragments were amplified that contained the T-DNA/plant DNA junctions from the total DNA of a transgenic tobacco plant that had a single copy of the T-DNA in a repetitive region of its genome. A DNA fragment containing the target site was amplified from the total DNA of non-transformed tobacco by the polymerase chain reaction using high-stringency conditions. Comparison of the nucleotide sequence of the target site with those of the T-DNA/plant DNA junctions revealed that various duplications of short stretches of nucleotide sequences around the target and in the incoming T-DNA had accompanied the integration of the T-DNA. A deletion of 16 bp at the target site was also found and the target site was similar, in terms of nucleotide sequence, to regions around the breakpoints of the T-DNA. This finding provides a clear example of the occurrence of complex rearrangements during the integration of T-DNA.     

T-DNA from Agrobacterium tumefaciens as an efficient tool for gene targeting in Kluyveromyces lactis

The soil bacterium Agrobacterium tumefaciens can transfer a part of its tumour-inducing (Ti) plasmid, the T-DNA, to plant cells. The virulence (vir) genes, also located on the Ti plasmid, encode proteins involved in the transport of T-DNA into the plant cell. Once in the plant nucleus, T-DNA is able to integrate into the plant genome by an illegitimate recombination mechanism. The host range of A. tumefaciens is not restricted to plant species. A. tumefaciens is also able to transfer T-DNA to the yeast Saccharomyces cerevisiae. In this paper we demonstrate transfer of T-DNA from A. tumefaciens to the yeast Kluyveromyces lactis. Furthermore, we found that T-DNA serves as an ideal substrate for gene targeting in K. lactis. We have studied the efficiency of gene targeting at the K. lactis TRP1 locus using either direct DNA transfer (electroporation) or T-DNA transfer from Agrobacterium. We found that gene targeting using T-DNA was at least ten times more efficient than using linear double-stranded DNA introduced by electroporation. Therefore, the outcome of gene targeting experiments in some organisms may depend strongly upon the DNA substrate used. Received: 11 May 1998 / Accepted: 16 October 1998     

The virD operon of Agrobacterium tumefaciens encodes a site-specific endonuclease

Tumor formation by Agrobacterium tumefaciens involves the transfer and integration of a defined segment (T-DNA) of tumor-inducing (Ti) plasmid DNA into the plant nuclear genome. A set of plasmid genes outside the T-DNA, the vir genes, are thought to mediate the transfer process. We report here that the virD operon encodes a site-specific endonuclease that cleaves at a unique site within each of the 24 bp direct repeats that flank the T-DNA. The endonuclease function was further localized to the 5' end of this operon by demonstrating that cleavage does not occur in virD mutant strains of Agrobacterium and that the 5' end of the virD operon is sufficient to direct cleavage in E. coli. Analysis of nucleotide sequence and protein data indicate that two proteins of 16.2 and 47.4 kd are involved.     

Bacterial Conjugation Protein MobA Mediates Integration of Complex DNA Structures into Plant Cells

Agrobacterium tumefaciens transfers T-DNA to plant cells, where it integrates into the genome, a property that is ensured by bacterial proteins VirD2 and VirE2. Under natural conditions, the protein MobA mobilizes its encoding plasmid, RSF1010, between different bacteria. A detailed analysis of MobA-mediated DNA mobilization by Agrobacterium to plants was performed. We compared the ability of MobA to transfer DNA and integrate it into the plant genome to that of pilot protein VirD2. MobA was found to be about 100-fold less efficient than VirD2 in conducting the DNA from the pTi plasmid to the plant cell nucleus. However, interestingly, DNAs transferred by the two proteins were integrated into the plant cell genome with similar efficiencies. In contrast, most of the integrated DNA copies transferred from a MobA-containing strain were truncated at the 5' end. Isolation and analysis of the most conserved 5' ends revealed patterns which resulted from the illegitimate integration of one transferred DNA within another. These complex integration patterns indicate a specific deficiency in MobA. The data conform to a model according to which efficiency of T-DNA integration is determined by plant enzymes and integrity is determined by bacterial proteins.     

Development of DNA-mediated transformation systems for plants

The genetic engineering of plants by DNA-mediated gene transfer requires that efficient transformation systems be developed. Considerable progress has been made in manipulating the Ti plasmid of Agrobacterium tumefaciens as a vehicle for delivery of foreign genes into protoplasts of dicotyle-donous plants. Part of the Ti plasmid, the T-DNA, can be incorporated into the genome of the host cell; the T-DNA can carry a foreign DNA sequence which co-integrates with it; under normal conditions, the tumorigenic-causing portion of the T-DNA can be inactivated so that transformed protoplasts can be regenerated and T-DNA with an inserted foreign gene can be stably maintained during regeneration, meiosis and gamete formation. A foreign gene has yet to be expressed in regenerated plants although a T-DNA gene for opine synthesis can function in regenerates. Developing a more ubiquitous transformation system for monocotyledons is further from fruition. Based on transformation systems for simple eukaryotic organisms, it is reasonable to expect that a DNA vector which is capable of amplifying a novel plant gene and which contains both a drug resistance marker to facilitate the selection of transformed plant protoplasts and a species-specific autonomously replicating sequence to ensure the stable maintenance of the input gene in the recipient cell can be constructed.     

Activity of T-DNA borders in plant cell transformation by mini-T plasmids.

By using a binary vector system, we examined the requirements for border sequences in T-DNA transformation of plant genomes. Mini-T plasmids consisting of small replicons with different extents of pTiT37 T-DNA were tested for plant tumor-inducing ability in Agrobacterium tumefaciens strain LBA4404 containing helper plasmid pAL4404 (which encodes virulence genes needed for T-DNA transfer). Assays of these bacteria on carrot disks, Kalanchoë leaves, and SR1 Nicotiana tabacum plantlets showed that mini-T plasmid containing full length T-DNA including left and right borders was highly virulent, as were mini-T plasmids containing all onc (oncogenicity) genes and only the right border. In contrast, mini-T plasmids containing all onc genes and only the left border induced tumors only rarely, and a mini-T plasmid containing all onc genes but no T-DNA borders was completely avirulent. Southern hybridization analyses of tumor DNA showed that T-DNA border sequences delimited the extent of the two-border mini-T plasmid transferred and integrated into the plant genome. When only one T-DNA border was present, it formed one end of the transferred DNA, and the other end mapped in the vector sequences. The implications of these results for the mechanism of T-DNA transfer and integration are discussed.     

The promoter proximal region in the virD locus of Agrobacterium tumefaciens is necessary for the plant-inducible circularization of T-DNA

Summary The formation of crown gall tumours involves the transfer of the T-DNA region of the Ti plasmid from Agrobacterium to plant cells and its subsequent integration into plant chromosomes. When agrobacteria are incubated with plant protoplasts or exudates of plants, the T-DNA region is circularized by recombination or cleavage and rejoining between the 25 bp terminal repeats; the formation of circular T-DNAs is thought to be one step in T-DNA transfer (Koukolikova-Nicola et al. 1985; Machida et al. 1986). We previously showed that the virulence region of the Ti plasmid is required for T-DNA circularization. In the present paper, we examined the circularization event in agrobacteria harbouring octopine Ti plasmids with mutations in various loci of the virulence region. The results clearly demonstrate that the gene(s) encoded in the virD locus are necessary for T-DNA circularization. In particular, the gene(s) present in the region proximal to the virD promoter are essential. We propose that roduct(s) of this gene have recombinase or endonuclease activity which specifically recognizes the 25 bp terminal repeats of T-DNA.     

Gene targeting in plants using theAgrobacterium vector system

In the past decade several methods have been developed for the introduction of foreign DNA into plant cells to obtain transgenic plants. In some of these methods, purified DNA is directly introduced into protoplasts that for some species can be regenerated into mature plants. The more commonly used protocols, however, employ the natural capacity ofAgrobacterium tumefaciens to transfer a defined peice of DNa, called T-DNA, to the nucleus of plant cells that are more easy to regenerate than protoplasts. In plant cells, like in animal cells, foreign DNA (including T-DNA) is readily inserted into the genome via illegitimates recombination. In contrast, targeted integration via homologous recombination, referred to as ‘gene targeting’, can only be obtained at relatively low frequencies. Nevertheless, gene targeting has become a standard strategy for reverse genetics studies in animals. In plants, the occurrence of gene targeting was only reported recently. This review focuses on the use of theAgrobacterium vector system to achieve gene targeting in plants. Recent experimental data concerning gene targeting in plants are presented and the overall suitability ofAgrobacterium T-DNA transfer for this purpose is assessed in light of contemporary views on the mechanism of T-DNA transfer.