Transfer RNA genes in mitochondrial DNA of grande (wild-type) yeast

We have used transfer RNA-DNA hybridization to show that seven tRNAs, i.e. tyrosyl, glutamyl, aspartyl, prolyl, lysyl, histidyl and seryl, hybridize with grande yeast mitochondrial DNA. These tRNA species are in addition to the seven which we previously showed to be gene products of mitochondrial DNA. Escherichia coli aminoacyl-synthetase preparations also were shown to catalyze specific acylation of yeast mitochondrial leucyl and tyrosyl-tRNA, but not of the isoaccepting tRNAs localized in the cell supernatant. Cytoplasmic tRNAs were found to be present in our purified mitochondrial preparations.     

Study of yeast mitochondrial tRNAs by two-dimensional polyacrylamide gel electrophoresis: characterization of isoaccepting species and search for imported cytoplasmic tRNAs.

By two-dimensional polyacrylamide gel electrophoresis, yeast mitochondrial tRNA is fractionated into 27 major species. All but 6 of them migrate distinctly from cytoplasmic tRNAs. Migration of mitochondrial DNA-coded mitochondrial tRNAs shows the occurence of only one cytoplasmic tRNA in mitochondria. Several mitochondrial tRNA spots are identified on the electrophoregrams, some of them show isoaccepting species (Val, Ser, Met, Leu). It is suggested that there are sufficient mitochondrial tRNA genes on yeast mitochondrial DNA to allow mitochondrial protein biosynthesis by the mitochondrial tRNAs alone. Guanosine + Cytidine content and rate base composition are reported for some individual species. Mitochondrial tRNAPhe lacks Ribothymidine.     

Combinatorial pathway analysis for improved L-tyrosine production in Escherichia coli: identification of enzymatic bottlenecks by systematic gene overexpression

Combinatorial overexpression of aromatic amino acid biosynthesis (AAAB) genes in the L-tyrosine producing Escherichia coli strains T1 and T2 was employed to search for AAAB reactions limiting L-tyrosine production. All AAAB genes except aroG and tyrA, which were substituted by their feedback resistant derivatives in the host strains, were cloned and overexpressed. A total of 72 different strains overexpressing various AAAB gene combinations were generated and from those strains with improved phenotype, enzymatic bottlenecks of the AAAB pathway could be inferred. The two major gene overexpression targets for increased L-tyrosine production in E. coli were ydiB and aroK, coding for a shikimate dehydrogenase and a shikimate kinase, respectively, and the combination of ydiB and aroK for overexpression resulted in the best L-tyrosine producing strains in this study, yielding 45% for strain T1 and 26% for strain T2, respectively, higher L-tyrosine titers. Interestingly, overexpression studies with combinations of more than one gene revealed that new gene targets could be identified when overexpessed together with other genes but not alone as single gene overexpression. For example, tyrB encoding the last enzyme of the AAAB pathway, an aromatic amino acid transaminase, improved L-tyrosine production significantly when co-overexpressed together with ydiB or aroK, but not when overexpressed alone. It is also noteworthy that E. coli T1, which generally yielded less L-tyrosine, was amenable to greater improvements than strain T2, i.e. E. coli T1 exhibited generally more space for phenotype improvement.     

Successful transformation of yeast mitochondria with RPM1: an approach for in vivo studies of mitochondrial RNase P RNA structure, function and biosynthesis.

Mitochondrial RNase P RNA (Rpm1r) is coded by the RPM1 gene of mitochondrial DNA in many yeasts. As an initial step to developing a genetic approach to the structure and biogenesis of yeast mitochondrial RNase P, biolistic transformation has been used to introduce wild type and altered RPM1 genes into strains containing no mitochondrial DNA. The introduced wild type gene does support RNase P activity demonstrating that pre-existing RNase P activity is not necessary for the biosynthesis of the enzyme. Mutations introduced into RPM1 in vitro result in reduced accumulation of mature tRNA and in an alteration of the processing of Rpm1r in vivo.     

Regulation of tyrosine biosynthesis in Escherichia coli K-12: isolation and characterization of operator mutants

Mutant strains of Escherichia coli have been isolated in which the synthesis of two of the enzymes involved in tyrosine biosynthesis, 3-deoxy-d-arabinoheptulosonic acid-7 phosphate synthetase (tyr) and chorismate mutase T-prephenate dehydrogenase, is partially constitutive. The mutations involved are closely linked to aroF and tyrA, the structural genes of these enzymes. The gene in which the mutations occur has been designated aroK, and the gene sequence is aroK, aroF, tyrA. In aroK(+)/aroK diploids, the aroK allele only affects the structural genes in the cis position. The mutant allele aroK is not recessive to aroK(+) and aroK/aroK(+) strains exhibit the aroK phenotype of resistance to 4-aminophenylalanine. It is proposed that aroK is an operator locus for an aroF tyrA operon.     

Nature of an inserted sequence in the mitochondrial gene coding for the 15S ribosomal RNA of yeast

The small ribosomal RNA, or 15S RNA, or yeast mitochondria is coded by a mitochondrial gene. In the central part of the gene, there is a guanine-cytosine (GC) rich sequence of 40 base-pairs, flanked by adenine-thymine sequences. The GC-rich sequence is (5') TAGTTCCGGGGCCCGGCCACGGAGCCGAACCCGAAAGGAG (3'). We have found that this sequence is absent in the 15S rRNA gene of some strains of yeast. When present, it is transcribed into the mature 15S rRNA to produce a longer variant of the RNA. Sequences identical or closely related to this GC-rich sequence are present in many regions of the mitochondrial genome of Saccharomyces cerevisiae. The 5' and 3' terminal structures of all these sequences are highly constant.     

Investigation of the basis for Ni tolerance conferred by the expression of TjZnt1 and TjZnt2 in yeast strains.

Introduction of ZIP family transporter gene homologues TjZnt1 and TjZnt2 (metal ion transporters) into yeast strains conferred increased Ni(II) tolerance in that species. The action of ZIP family transporter homologues, however, could not explain the Ni resistance of yeast strains transformed with TjZnt1 and TjZnt2. To elucidate the mechanism of Ni tolerance conferred by TjZnt1 and TjZnt2 in yeast strains, we made a series of investigations based upon three hypotheses, including (1) cellular Ni efflux, (2) exclusion of Ni due to competitive uptake of other metals, and (3) Ni binding to histidine-rich domains (chelation). The critical Ni tolerance level of TjZnt2 expressing yeast strains was 1.4mM, whereas, the TjZnt1 expressing yeast strains were tolerant of Ni concentrations as high as 2.0mM. The TjZnt1 expressing yeast strain had significantly lower Ni content and significantly higher Zn content than the control and TjZnt2 expressing yeast strain. Effects of the deletion of histidine-rich domain HRD1 or HRD2, or deletion of the region from HRD1 to HRD2, resulted in the same or slightly less Ni(II) tolerance in the TjZnt1 expressing yeast strain. These data indicate that Ni tolerance of the TjZnt2 expressing yeast strain is not correlated with binding to HRDs (Hypothesis 3). Ni tolerance of TjZnt1 expressing yeast strain was, however, partially correlated with Zn influx, which suppressed Ni influx, therefore Ni influx (Hypothesis 1) and competitive inhibition of Ni influx by other metals (Hypothesis 2), remain viable hypotheses which will be subject to further testing.     

The cloning and sequence analysis of the aspC and tyrB genes from Escherichia coli K12. Comparison of the primary structures of the aspartate aminotransferase and aromatic aminotransferase of E. coli with those of the pig aspartate aminotransferase isoenzymes.

In this paper we describe the cloning and sequence analysis of the tyrB and aspC genes from Escherichia coli K12, which encode the aromatic aminotransferase and aspartate aminotransferase respectively. The tyrB gene was isolated from a cosmid carrying the nearby dnaB gene, identified by its ability to complement a dnaB lesion. Deletion and linker insertion analysis located the tyrB gene to a 1.7-kilobase NruI-HindIII-digest fragment. Sequence analysis revealed a gene encoding a 43 000 Da polypeptide. The gene starts with a GTG codon and is closely followed by a structure resembling a rho independent terminator. The aspC gene was cloned by screening gene banks, prepared from a prototrophic E. coli K12 strain, for plasmids able to complement the aspC tyrB lesions in the aminotransferase-deficient strain HW225. Sub-cloning and deletion analysis located the aspC gene on a 1.8-kilobase HincII-StuI-digest fragment. Sequence analysis revealed the presence of a gene encoding a 43 000 Da protein, the sequence of which is identical with that previously obtained for the aspartate aminotransferase from E. coli B. Considerable overproduction of the two enzymes was demonstrated. We compared the deduced protein sequences with those of the pig mitochondrial and cytoplasmic aspartate aminotransferases. From the extensive homology observed we are able to propose that the two E. coli enzymes possess subunit structures, subunit interactions and coenzyme-binding and substrate-binding sites that are very similar both to each other and to those of the mammalian enzymes and therefore must also have very similar catalytic mechanisms. Comparison of the aspC and tyrB gene sequences reveals that they appear to have diverged as much as is possible within the constraints of functionality and codon usage.     

Characterization of a yeast mitochondrial locus necessary for tRNA biosynthesis. Deletion mapping and restriction mapping studies

Yeast mitochondrial DNA codes for a complete set of tRNAs. Although most components necessary for the biosynthesis of mitochondrial tRNA are coded by nuclear genes, there is one genetic locus on mitochondrial DNA necessary for the synthesis of mitochondrial tRNAs other than the mitochondrial tRNA genes themselves. Characterization of mutants by deletion mapping and restriction enzyme mapping studies has provided a precise location of this yeast mitochondrial tRNA synthesis locus. Deletion mutants retaining various segments of mitochondrial DNA were examined for their ability to synthesize tRNAs from the genes they retain. A subset of these strains was also tested for the ability to provide the tRNA synthesis function in complementation tests with deletion mutants unable to synthesize mature mitochondrial tRNAs. By correlating the tRNA synthetic ability with the presence or absence of certain wild-type restriction fragments, we have confined the locus to within 780 base pairs of DNA located between the tRNAMetf gene and tRNAPro gene, at 29 units on the wild-type map. Heretofore, no genetic function or gene product had been localized in this area of the yeast mitochondrial genome.     

Efficient splicing of two yeast mitochondrial introns controlled by a nuclear-encoded maturase.

bI4 maturase encoded by the fourth intron of the yeast mitochondrial cytochrome b gene, controls the splicing of both the fourth intron of the cytochrome b gene and the fourth intron of the gene encoding subunit I of cytochrome oxidase. It has been shown previously that a cytoplasmically translated hybrid protein composed of the pre-sequence of subunit 9 of Neurospora ATPase fused to a part of the bI4 maturase can be guided to mitochondria where it could compensate maturase deficiencies. This in vivo complementation of maturase mutants can be easily estimated by restoration of respiration. This work examines the efficiency of different bI4 maturase constructions to restore respiration in different yeast maturase-deficient strains. It is shown that the N-terminal end of the bI4 maturase plays a crucial role in the maturase activity. Moreover, the 12 N-terminal amino acids of the mitochondrial outer membrane protein constitute the most efficient mitochondrial targeting sequence in this system. Surprisingly enough, it was found that the cytoplasmically translated bI4 maturase containing the 254 C-terminal amino acid coded by the intron open reading frame can complement maturase mutations without any added mitochondrial-targeting sequence.     

Discoordinate expression of the yeast mitochondrial ribosomal protein MRP1

We have examined expression of the protein coded within the MRP 1 locus of Saccharomyces cerevisiae. Direct evidence is provided for the assignment of the MRP1 gene product as a protein component of the small subunit of mitochondrial ribosomes. Further studies examined the extent to which the expression of the MRP1 protein is coordinated with the expression of other mitochondrial ribosomal components coded in the nuclear and mitochondrial genomes. Extra copies of the MRP1 gene were introduced into yeast cells to perturb expression from MRP1 relative to other mitochondrial ribosomal components to determine whether forms of regulation function to limit the accumulation of either MRP1 mRNA or protein under these conditions. Increases in MRP1 gene dosage were accompanied by substantial increases in both MRP1 mRNA and protein, indicating that their accumulation was not linked to the level of expression of other mitochondrial ribosomal components. This conclusion was confirmed by additional studies that showed that the accumulation of the MRP1 protein was unaffected in cells that did not express mitochondrially-encoded rRNAs. These results contrast with previous studies on the expression of two other mitochondrial ribosomal proteins indicating that regulatory properties of mitochondrial ribosomal proteins are quite diverse.     

Expression of the gene encoding protein A in Staphylococcus aureus and coagulase-negative staphylococci

Two shuttle vectors containing the gene for protein A (spa) from Staphylococcus aureus have been constructed to study expression of the gene in various strains of S. aureus and in the coagulase-negative species Staphylococcus epidermidis, Staphylococcus capitis, and Staphylococcus xylosus. One plasmid, pSPA15, contains the complete structural gene for protein A, which binds to the cell wall in various Staphylococcus species. The other plasmid, pSPA16, codes for a truncated protein A lacking the C-terminal part called region X. The latter is exclusively extracellular in all Staphylococcus species tested, which confirms the importance of region X for cell wall binding. The expression of the plasmid-coded protein A in various strains of S. aureus is strongly correlated to the expression of the chromosomal spa gene. The coagulase-negative species expressing plasmid-encoded protein A produce 12 to 30% of the amount coded by the chromosomal spa gene in S. aureus strains Cowan I and A676.     

Import of proteins into mitochondria: a 70 kilodalton outer membrane protein with a large carboxy-terminal deletion is still transported to the outer membrane.

The yeast mitochondrial outer membrane contains a major 70-kd protein which is coded by a nuclear gene. Two forms of this gene were isolated from a yeast genomic clone bank: the intact gene, and a truncated gene which had lost a large part of its 3' end during the cloning procedure. Upon transformation into yeast, both the intact and the truncated gene are expressed; the truncated gene generates a shortened protein missing 203 amino acids from the carboxy-terminus. This truncated polypeptide reacts with a monoclonal antibody against the authentic 70-kd protein and is transported to the mitochondrial outer membrane. By integrative transformation, we have constructed a yeast mutant which lacks the 70-kd protein and is unable to adapt to growth on a nonfermentable carbon source at 37 degrees C. This phenotypic lesion can be corrected by transforming the mutant with the intact, but not the truncated gene. The carboxy-terminal sequence of 203 amino acids is thus necessary for the function of the protein, but not for its targeting to the mitochondrion.     

Assembly of the mitochondrial membrane system: two separate genes coding for threonyl-tRNA in the mitochondrial DNA of Saccharomyces cerevisiae.

1. Mitochondria of Saccharomyces cerevisiae contain two tRNA's that are acylated with threonine. The two isoaccepting species (tRNA1Thr and tRNA2Thr) can be separated by reversed-phase chromatography on RPC-5. 2. A cytoplasmic mutant has been isolated which lacks tRNA1Thr but has normal levels of tRNA2Thr. This mutation was previously shown to map between the oxi 1 and oxi 2 loci on mitochondrial DNA. 3. tRNA1Thr and tRNA2Thr hybridize to wild type mitochondrial but not nuclear DNA and are capable of partially competing with each other. Hybridization of each species to different segments of mitochondrial DNA isolated from p- clones indicate that there are two threonyl tRNA genes. One gene is located between oxi 1 and oxi 2 and codes for tRNA1Thr. The second gene codes for tRNA2Thr and is near the cap locus. 4. Binding assays to E. coli ribosomes indicate that tRNA2Thr recognizes the threonine triplet ACA and may also recognize the other three triplets but with a much lower efficiency. None of the four codons for threonine stimulate the binding of tRNA1Thr to the ribosomes.     

Genetically determined differences in concentrations of isoaccepting tRNAs in Escherichia coli.

Two examples of genetically determined altered concentrations of isoaccepting tRNAs are presented. The concentrations of isoaccepting tRNAsThr are selectively changed by a mutation causing a fourfold overproduction of the cognate aminoacyl-tRNA-synthetase, the threonyl-tRNA synthetase, whereas the distribution of isoaccepting tRNAs of four control tRNA-species in these E. coli mutants was not affected by that mutation. Secondly evidence is presented for a correlation between mutations in structural genes of aminoacid biosynthetic enzymes and alterations in concentrations of cognate isoaccepting tRNAs in two different E. coli strains, auxotrophic for threonine, isoleucine/valine and leucine, and arginine respectively.     

Candida ogatae sp. nov., an anamorphic member of the Kuraishia clade

Three methanol-assimilating yeast strains representing a hitherto undescribed species were isolated from rotten wood and freshwater samples collected in Hungary. Analysis of the D1/D2 large subunit rRNA gene sequences placed the strains in the Kuraishia clade; however, no ascospore formation was observed. These strains differ from Candida hungarica , the genetically most closely related recognized species, by four and five substitutions in D1/D2 and by >1% and 4% differences in the internal transcribed spacer and in the mitochondrial small subunit rRNA gene regions, respectively. Some phenotypic differences were also observed. Candida ogatae , a novel yeast species, is proposed to accommodate these isolates. The type culture is NCAIM Y.01845^T (CBS 10924, NRRL Y-48474).