The complete sequence of a unique RNA species synthesized by a DI particle of VSV.

The 2S RNA synthesized in vitro by the RNA polymerase of a defective interfering (DI) particle of vesicular stomatitis virus was labeled at its 3' terminus with 32P-cytidine 3', 5' bisphosphate and RNA ligase. Analysis of the labeled RNA showed that it was a family of RNAs of different length but all sharing the same 5' terminal sequence. The largest labeled RNA was purified by gel electrophoresis, and the sequence of 41 of its 46 nucleotides was determined by rapid RNA sequencing methods. The assignment of the remaining 5 nucleotides was made on the basis of an analysis of one of the smaller RNAs and published data. A new approach in RNA sequencing based on the identification of 3' terminal nucleotides of rna fragments originally present in the DI product or generated during the ligation reaction confirmed most of the sequence. The complete sequence of this 46 nucleotide long plus-sense RNA is: ppACGAAGACCACAAAACCAGAUAAAAAA UAAAAACCACAAGAGGGUC-OH. This RNA anneals to the RNA of the DI particle from which it was synthesized, indicating that its synthesis is template-specified. At least the first 17 and possibly all of the nucleotides are also complementary to sequences at the 3' end of two other VSV DI particles which were derived independently and whose genomes differ significantly in length. These data suggest a common 3' terminal sequence among all VSV DI particles which contain part of the Lgene region of the parental genome.     

Terminal sequences of vesicular stomatitis virus RNA are both complementary and conserved.

The nucleotide sequences at the 5' and 3' termini of RNA isolated from the New Jersey serotype of vesicular stomatitis virus [vsV(NJ)] and two of its defective interfering (DI) particles have been determined. The sequence differs from that previously demonstrated for the RNA from the Indiana serotype of VSV at only 1 of the first 17 positions from the 3' terminus and at only 2 of the first 17 positions from the 5' terminus. The 5'-terminal sequence of VSV(NJ) RNA is the complement of the 3'-terminal sequence, and duplexes which are 20 bases long and contain the 3' and 5' termini have been isolated from this RNA. The RNAs isolated from DI particles of VSV(NJ) have the same base sequences as do the RNAs from the parental virus. These results are in sharp contrast to those obtained with the Indiana serotype of VSV and its DI particles, in which the 3'-terminal sequences differ in 3 positions within the first 17. However, with both serotypes, the 3'-terminal sequence of the DI RNA is the complement of the 5'-terminal sequence of the RNA from the infectious virus. These findings suggest that the 3' and 5' RNA termini are highly conserved in both serotypes and that the 3' terminus of DI RNA is ultimately derived by copying the 5' end of the VSV genome, as recently proposed (D. Kolakofsky, M. Leppert, and L. Kort, in B. W. J. Mahy and R. D. Barry, ed., Negative-Strand Virus and the Host Cell, 1977; M. Leppert, L. Kort, and D. Kolakofsky, Cell 12:539-552, 1977; A. S. Huang, Bacteriol. Rev. 41:811-8218 1977).     

In vitro RNA transcription by the New Jersey serotype of vesicular stomatitis virus. II. Characterization of the leader RNA.

The New Jersey serotype of vesicular stomatitis virus (VSV) was able to synthesize a small RNA (leader RNA) approximately 70 bases in length similar to the leader RNA synthesized in vitro by the genetically distinct Indiana serotype of VSV. Also, the New Jersey leader RNA contained the same 5'-terminal sequence, ppA-C-G, as the Indiana leader RNA and had a very similar base composition, with 42% AMP, 16% CMP, 18.6% GMP, and 23.4% UMP. The 3'-terminal sequence of the VSV New Jersey genome RNA was detemined and found to contain the sequence- Py-G-UOH, again the same as that of the Indiana serotype of VSV. Evidence that the New Jersey leader RNA is transcribed from the 3' end of the genome RNA was obtained from the fact that it can protect the 3'-terminal base of [3H]borohydride-labeled New Jersey genome RNA from RNase digestion. Although the New Jersey and Indiana leader RNAs were similar in many respects, they were unable to form RNase-resistant hybrids when annealed to heterologous genome RNA.     

Relative importance of 7-methylguanosine in ribosome binding and translation of vesicular stomatitis virus mRNA in wheat germ and reticulocyte cell-free systems.

Vesicular stomatitis virus mRNAs with these four types of 5'-termini, (a) m7G5'ppp5'(m)Am, (b) ppp5'(m)Am, (c) m7G5'-ppp5' Am, and (d) G5'ppp5'A, were prepared and their translation and ribosome binding analyzed in wheat germ and reticulocyte cell-free protein synthesis systems. The relative efficiencies of translation of individual vesicular stomatitis virus (VSV) mRNAs having type 2 termini ranged from 23 to 29% of the control (type 1) RNA in the reticulocyte system and 6 to 7% of control RNA in the wheat germ system. A similar difference between the two systems was seen in ribosome-binding experiments in which type 2 RNA formed an 80 S initiation complex with high efficiency (70% of control type 1 RNA) in the reticulocyte system, but with low efficiency (17% of control RNA) in the wheat germ system. Similar differences in the importance of m7G in translation in the two systems were seen when VSV mRNAs synthesized in vitro with type 3 and type 4 termini were analyzed. However, the analysis of type 4 RNA (which was synthesized in vitro in the presence of S-adenosylhomocysteine) was complicated by the presence of abnormally large poly(A) at its 3'-end. Another series of experiments showed that compounds such as 5'pm7G and m7G5'ppp5'Np are potent and specific inhibitors of translation of all types of VSV mRNAs in the wheat germ system (greater than 98% inhibition) but cause less than 20% inhibition of translation in the reticulocyte system. Taken together, all of the results indicate that a 5'-terminal m7G is far more important in translation of VSV mRNAs in the heterologous plant cell-free system than in the reticulocyte lysate system.     

Isolation and characterization of polyadenylate-containing RNA from Bacillus brevis.

A substantial fraction (30--40%) of pulse-labeled RNA from exponentially growing cells of Bacillus brevis contains polyadenylate sequences, as measured by adsorption to oligo(dT)-cellulose. The weight-average length of poly(A) tracts obtained after digestion with pancreatic and T1 ribonucleases is 60 nucleotide residues. Susceptibility to degradation by snake venom phosphodiesterase after ribonuclease degradation indicates that the poly(A) sequences are located near the 3' ends of the RNA chains, but that in 40% of the material at least one internal pyrimidine nucleotide residue intervenes between the poly(A) tract and the 3'-hydroxyl terminus. These pyrimidine nucleotides consist of 65% cytidylate and 35% uridylate residues. In the remaining RNA chains, the poly(A) sequence is directly at the 3'-terminus, but the possibility cannot be excluded that a small fraction of this material may contain a 3'-hydroxyl terminal guanylate residue. The weight-average sedimentation coefficient of poly(A)-containing RNA is 12.5 S, corresponding to a polynucleotide chain length of 800--900 residues. This is in a size range expected for messenger RNA, a possibility which is also supported by the observation that pulse-labeled RNA has a considerably higher poly(A) content than long-term labeled RNA.     

The nucleotide sequence at the 5'' end of foot and mouth disease virus RNA.

Foot and mouth disease virus RNA has been treated with RNase H in the presence of oligo (dG) specifically to digest the poly(C) tract which lies near the 5' end of the molecule (10). The short (S) fragment containing the 5' end of the RNA was separated from the remainder of the RNA (L fragment) by gel electrophoresis. RNA ligase mediated labelling of the 3' end of S fragment showed that the RNase H digestion gave rise to molecules that differed only in the number of cytidylic acid residues remaining at their 3' ends and did not leave the unique 3' end necessary for fast sequence analysis. As the 5' end of S fragment prepared form virus RNA is blocked by VPg, S fragment was prepared from virus specific messenger RNA which does not contain this protein. This RNA was labelled at the 5' end using polynucleotide kinase and the sequence of 70 nucleotides at the 5' end determined by partial enzyme digestion sequencing on polyacrylamide gels. Some of this sequence was confirmed from an analysis of the oligonucleotides derived by RNase T1 digestion of S fragment. The sequence obtained indicates that there is a stable hairpin loop at the 5' terminus of the RNA before an initiation codon 33 nucleotides from the 5' end. In addition, the RNase T1 analysis suggests that there are short repeated sequences in S fragment and that an eleven nucleotide inverted complementary repeat of a sequence near the 3' end of the RNA is present at the junction of S fragment and the poly(C) tract.     

A four-nucleotide translation enhancer in the 3'-terminal consensus sequence of the nonpolyadenylated mRNAs of rotavirus

The 5' cap and poly(A) tail of eukaryotic mRNAs work synergistically to enhance translation through a process that requires interaction of the cap-associated eukaryotic initiation factor, eIF-4G, and the poly(A)-binding protein, PABP. Because the mRNAs of rotavirus, and other members of the Reoviridae, contain caps but lack poly(A) tails, their translation may be enhanced through a unique mechanism. To identify translation-enhancement elements in the viral mRNAs that stimulate translation in vivo, chimeric RNAs were prepared that contained an open reading frame for luciferase and the 5' and 3' untranslated regions (UTRs) of a rotavirus mRNA or of a nonviral mRNA. Transfection of the chimeric RNAs into rotavirus-infected cells showed that the viral 3' UTR contained a translation-enhancement element that promoted gene expression. The element did not enhance gene expression in uninfected cells and did not affect the stability of the RNAs. Mutagenesis showed that the conserved sequence GACC located at the 3' end of rotavirus mRNAs operated as an enhancement element. The 3'-GACC element stimulated protein expression independently of the sequence of the 5' UTR, although efficient expression required the RNA to contain a cap. The results indicate that the expression of viral proteins in rotavirus-infected cells is specifically up-regulated by the activity of a novel 4-nt 3' translation enhancer (TE) common to the 11 nonpolyadenylated mRNAs of the virus. The 4-nt sequence of the rotavirus 3' TE represents by far the shortest of any of the sequence enhancers known to stimulate translation.     

The nucleotide sequence of the 5'' terminus of vesicular stomatitis virus RNA.

We have determined the nucleotide sequence for the first 50 nucleotides at the 5' terminus of vesicular stomatitis virus (VSV) genome RNA. This sequence is identical to that of the in vitro RNA polymerase product synthesized by defective interfering (DI) particles of VSV. These results confirm previous conclusions rengarding DI and standard viral terminal sequences based on hybridization studies and earlier sequencing of the DI polymerase product RNA.     

Methylated and blocked 5' termini in vesicular stomatitis virus in vivo mRNAs.

Methyl groups derived from 3H-methyl methionine were incorporated into vesicular stomatitis virus (VSV) MRNAs isolated from infected cells. Sequential degradation of the 12-18S viral mRNA species with ribonuclease T2, penicillium nuclease, and alkaline phosphatase yielded a single 3H-labeled dinucleotide. A similar resistant 32P-labeled fragment was obtained by digesting VSV mRNA uniformly labeled with 32P. This methylated and blocked oligomer was further cleaved with nucleotide pyrophosphatase, yielding two methylated 5' nucleotides. We postulate that the 5' terminal structure of the vivo 12-18S VSV mRNA contains 7-methylguanosine linked by a 5'-5' pyrophosphate bond to a methylated derivative of adenosine. In contrast to the mRNAs (+ strand), the VSV genome RNA ( MINUS STRAND) IS NOT BLOCKED.     

On the nature of 5' termini in nuclear pre-mRNA of Ehrlich carcinoma cells.

5' terminal nucleosides of nuclear pre-mRNA of Ehrlich ascites carcinoma cells were analyzed by a combination of different chromatographic methods and phosphatase treatment. The heavy nuclear pre-mRNA contains mainly unblocked triphosphorylated nucleosides at the 5' end, although some capped 5' ends could also be found. In this respect, it differs from cytoplasmic poly(A)+ mRNA which contains blocked 5' termini and no triphosphorylated ends. The 5' terminal nucleotides in pre-mRNA are pppGp and pppAp (in a ratio of 3:2). The determination of pppNp content in poly (A)+, poly(U)+, and poly (A)-(U)- fragments of RNA has been used as an approach to establish the topography of pre-mRNA. We also established that the technique for isolation of triphosphorylated 5' terminal fragments of RNA based on hydroxyapatite chromatography (Bajszár, Samarina, and Georgiev, 1974) is still valid in the presence of blocked oligonucleotides. The latter do not interfere with fragments containing free triphosphate groups. Using this technique, we showed that a small but significant portion of triphosphorylated 5' end fragments of 100 nucleotides in length contain oligo(U) sequences reacting with poly(A)-Sepharose.     

Do eukaryotic mRNA 5' noncoding sequences base-pair with the 18 S ribosomal RNA 3' terminus?

Protein synthesis initiation on prokaryotic mRNAs involves base-pairing of a site preceding the initiation codon with the 3' terminal sequence of 16 S rRNA. It has been suggested that a similar situation may prevail in eukaryotic mRNAs. This suggestion is not based on experiments, but on observation of complementarities between mRNA 5' noncoding sequences and a conserved sequence near the 18 S rRNA 3' terminus. The hypothesis can be evaluated by comparing the number of potential binding sites found in the 5' noncoding sequences with the number of such sites expected to occur by chance. A method for computing this number is presented. The 5' noncoding sequences contain more binding sites than expected for a random RNA chain, but the same is true for 3' noncoding sequences. The effect can be traced to a clustering of purines and pyrimidines, common to noncoding sequences. In conclusion, a close inspection of the available mRNA sequences does not reveal any indication of a specific base-pairing ability between their 5' noncoding segments and the 18 S rRNA 3' terminus.