Fusion of the termini of the murine cytomegalovirus genome after infection.

The genome of murine cytomegalovirus, extracted from extracellular virions, is a linear double-stranded DNA molecule ca. 240 kilobase pairs long. In our initial cloning of subgenomic fragments of the murine cytomegalovirus genome, we obtained a HindIII clone which contained fused HindIII-terminal fragments. By hybridizing this cloned DNA fragment to infected-cell DNA, we identified an intracellular restriction fragment which was the length of the sum of the two authentic termini. This fusion fragment was not present in virion DNA but could be detected as early as 2 h postinfection and reached its highest level shortly after the onset of DNA replication at 16 h postinfection. The prereplicative increase of fused ends was not inhibited by a level of phosphonoacetic acid which effectively shut off viral DNA synthesis, nor was the early conversion from free to fused ends prevented by inhibitors of protein or RNA synthesis. The results are consistent with the fused state of viral DNA being a replicative intermediate and precursor to DNA synthesis.     

High-affinity fragment complementation of a fibronectin type III domain and its application to stability enhancement

The tenth fibronectin type III (FN3) domain of human fibronectin (FNfn10), a prototype of the ubiquitous FN3 domain, is a small, monomeric beta-sandwich protein. In this study, we have bisected FNfn10 in each loop to generate a total of six fragment pairs. We found that fragment pairs bisected at multiple loops of FNfn10 show complementation in vivo as tested with a yeast two-hybrid system. The dissociation constant of these fragment pairs determined in vitro were as low as 3 nM, resulting in one of the tightest fragment complementation systems reported so far. Furthermore, we show that the affinity of fragment complementation is correlated with the stability of the uncut parent protein. Exploring this correlation, we screened a yeast two-hybrid library of one fragment and identified mutations that suppress the effect of a destabilizing mutation in the other fragment. One of the identified mutations significantly increased the stability of the uncut wild-type protein, proving that fragment complementation can be used as a novel strategy for the selection of proteins with enhanced stability.     

Cloning, sequence, and expression of the Drosophila cAMP-dependent protein kinase catalytic subunit gene

Genomic DNA containing the protein coding region for Drosophila cAMP-dependent protein kinase catalytic subunit has been cloned and sequenced. The probe used to detect and isolate the gene fragment was constructed from two partially complementary synthetic oligonucleotides and contains 60 base pairs that encode (using Drosophila codon preferences) amino acids 195-214 of the beef heart catalytic subunit. In reduced stringency hybridization conditions, the probe recognizes two target sites in fly genomic DNA with 85% homology. One of these sites is in the cAMP-dependent protein kinase catalytic subunit gene, which was isolated as a 3959-base pair HindIII fragment. This fragment contains all of the protein coding portion, 900 base pairs upstream of the initiator ATG, and 2000 base pairs downstream of the termination codon (TAG). The coding portion of the gene contains no introns and yields a protein of 352 amino acids. There is a 2-amino acid insertion near the N terminus of the fly protein relative to the beef and mouse enzymes. Of the remaining 350 amino acids, 273 are invariant in the three species. A probe derived from the coding sequence of the HindIII clone hybridizes strongly to a 5100-base poly(A)+ RNA and weakly to 4100- and 3400-base poly(A)+ RNAs expressed in adult flies. A 2100-base pair EcoRI genomic fragment containing the second site recognized by the 60-base pair probe has also been cloned. DNA sequence analysis demonstrates that this fragment is part of the cGMP-dependent protein kinase gene or a close homolog. The catalytic subunit gene and the cGMP-dependent protein kinase gene have been located in regions 30C and 21D, respectively, of chromosome 2.     

Probing the limits of the DNA breakage-reunion domain of the Escherichia coli DNA gyrase A protein.

In a previous report (Reece, R. J., and Maxwell, A. (1989) J. Biol. Chem. 264, 19648-19653) we showed that treatment of the Escherichia coli DNA gyrase A protein with trypsin generates two stable fragments. The N-terminal 64-kDa fragment supports DNA supercoiling, while the C-terminal 33-kDa fragment shows no enzymic activity. We proposed that the 64-kDa fragment represents the DNA breakage-reunion domain of the A protein. We have now engineered the gyrA gene such that the 64-kDa protein is generated as a gene product. The properties of this protein confirm the findings of the experiments with the 64-kDa tryptic fragment. We have also generated a series of deletions of the gyrA gene such that C-terminal and N-terminal truncated versions of the A protein are produced. The smallest of the N-terminal fragments found to be able to carry out the DNA breakage-reunion reaction is GyrA(1-523). The cleavage reaction mediated by this protein occurs with equal efficacy as that performed by the intact GyrA protein. Deletion of the N-terminal 6 amino acids from either the A protein or these deletion derivatives has no effect on enzymic activity, while deletion of the N-terminal 69 amino acids completely abolishes the DNA breakage-reunion reaction. Therefore the smallest GyrA protein we have found that will perform DNA breakage and reunion is GyrA(7-523). A model is proposed for the domain organization of the gyrase A protein.     

DNA regions essential for the function of a bacteriophage fd promoter.

The promoter for the major coat protein gene of bacteriophage fd contains a unique sequence. TATAAT, in the non-transcribed region corresponding to the Pribnow box. A R-Hha I cleavage site which destroys functions is located five pairs upstream from the TATAAT sequence (fifteen base pairs upstream from the RNA initiation site). The promoter was cleaved into two fragments by R-Hha I and each promoter fragment was joined to DNA fragments derived from other regions. Ligation of the TATAAT-containing fragment to any of the DNA fragments examined resulted in recovery of promoter function. The results suggest for this type of promoter that no unique sequence is necessary upstream from the R-Hha I cleavage site although a contiguous DNA chain must be present in this area.     

DNA bending near the replication origin of IncFII plasmid NR1.

The DNA replication origin of plasmid NR1 is located approximately 190 base pairs downstream from the 3' end of the repA1 gene, which encodes the essential initiation protein for replication of the plasmid. Restriction endonuclease fragments that contain the NR1 replication origin and its flanking sequences at circularly permuted positions were obtained by digesting oligomers of ori-containing DNA fragments with sets of enzymes that each cut only once in every ori fragment. Polyacrylamide gel electrophoresis of these permuted restriction fragments showed anomalous mobilities, indicating the presence of a DNA bending locus. Through analysis of the relative mobility plots of these permuted fragments, we found one or two possible DNA bending sites located in the intervening region between the repA1 gene and the replication origin of NR1. It seems possible that DNA bending in this region might help to orient the replication origin alongside the repA1 gene, which could contribute to the cis-acting character of the RepA1 initiation protein.     

The cloning, DNA sequence, and overexpression of the gene araE coding for arabinose-proton symport in Escherichia coli K12

A lambda placMu1 insertion was made into araE, the gene for arabinose-proton symport in Escherichia coli. A phage containing an araE'-'lacZ fusion was recovered from the lysogen and its restriction map compared with that of the 61-min region of the E. coli genome to establish the gene order thyA araE orf lysR lysA galR; araE was transcribed toward orf. A 4.8-kilobase SalI-EcoRI DNA fragment containing araE was subcloned from the phage lambda d(lysA+ galR+ araE+) into the plasmid vector pBR322. From this plasmid a 2.8-kilobase HincII-PvuII DNA fragment including araE was sequenced and also subcloned into the expression vector pAD284. The araE gene was 1416-base pairs long, encoding a hydrophobic protein of 472 amino acids with a calculated Mr of 51,683. The amino acid sequence was homologous with the xylose-proton symporter of E. coli and the glucose transporters from a human hepatoma HepG2 cell line, human erythrocytes, and rat brain. The overexpressed araE gene product was identified in Coomassie-stained sodium dodecyl sulfate-polyacrylamide gel electrophoresis gels of cell membranes as a protein of apparent Mr 35,000 +/- 1,150. Arabinose protected this protein against reaction with N-ethylmaleimide.     

DNA methylation: sequences flanking C-G pairs modulate the specificity of the human DNA methylase.

Synthetic single-stranded oligodeoxynucleotides of known sequence have been used as in vitro substrates for a partially purified HeLa cell DNA methylase. Although most oligonucleotides tested cannot be used by the HeLa DNA methylase in vitro, we have found a unique 27mer, containing 2 C-G pairs, that is an excellent substrate for the enzyme. Analysis of the methylation of the 27mer, its derivatives and other oligomer substrates reveal that the HeLa DNA methylase does not significantly methylate an oligomer which contains just one C-G pair. In addition, only one of the two C-G pairs in the 27mer is methylated and this methylation is abolished if the other C-G pair is converted to a C-A pair. Furthermore, the HeLa enzyme apparently cannot methylate C-G pairs located in compounds containing a high A + T content. The most efficient methylation occurs with multiple separated C-G pairs in a compound with a high G + C content (greater than 65%). The results suggest that clustering of C-G pairs in regions of the DNA high in G + C content may be the preferred site for DNA methylation in vivo.     

Fragmentation of chromatin by endogenous nucleases, accumulation of the subnucleosomal fragments with high electrophoretic mobility]

Digestion of chromatin by endogenous nucleases to nucleosomes (140-160 base pairs of DNA) is accompanied by the accumulation of subnucleosomal DNP particles with high electrophoretic mobility (20-40 base pairs of DNA). All histones associate with the 140-160 base pairs fragment. The production of subnucleosomal DNP particles does not correlate with the degradation of histone H1 and the appearance of nucleosomes lacking histone H1. Degradation of the protein in this fragment is accompanied by the appearance of free DNA. The data obtained are in agreement with the hypothesis on the origin of subnucleosomes from the nucleosomal locus preferentially associated with the non-histone proteins and on the autonomy of these loci and of the loci associated with histone H1 in the nucleosome.     

Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences.

amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems.     

Nucleotide sequence of a citrate utilization gene from Citrobacter amalonaticus.

The chromosomal DNA fragment (BamHI-BglII fragment of 2,972 base pairs) conferring citrate utilization in Citrobacter amalonaticus ATCC 25405 was cloned and sequenced. Two genes (citA and citB) identified in the Cit+ determinant were found in a BamHI-BglII fragment from C. amalonaticus. Southern DNA-DNA hybridization experiments and the construction of Cit- mutants of C. amalonaticus showed that C. amalonaticus has a single copy of the cit gene on the chromosome.     

Unique hairpin structures occurring at the replication origin of phage G4 DNA

Recently we reported that a DNA fragment, GCCAAAGC, forms an extraordinarily stable hairpin structure with two G-C pairs at the terminus and A-A-A stacked structure. The sequence is present at the replication origin of bacteriophage G4 ssDNA, and so on. Several kinds of possible hairpin structures, corresponding to the replication origin of phage G4, were synthesized and their secondary structures were examined. It was found that the fragments are able to form interconvertible hairpin structures depending on the length of the base-paired regions. The hairpin structure consisting of GCGAAAGC was not digested by the exonuclease activity of T4 DNA polymerase and it was stable enough to be only minimally bound by a single-stranded DNA binding protein.     

The DNA sequence of the gene (rnc) encoding ribonuclease III of Escherichia coli.

The DNA sequence of a 1,076 base pair BglI-BamHI fragment containing the entire rnc gene for ribonuclease III (RNase III) was determined. An open reading frame of 681 base pairs was found in this region which encodes a protein of 227 amino acid residues (calculated molecular weight = 25,218). When this open reading frame was cloned into a high expression vector, pIN-III, a protein of apparent molecular weight of 26,000 was produced upon induction of the cloned gene. This product accounted for up to 5% of the total cellular protein, and comigrated with purified RNase III. RNase III enzyme activity was induced in parallel with the production of the 26,000 molecular weight protein. A putative promoter was found 170 base pairs upstream from the initiation codon. In the long leader region a very stable stem-bulge-stem structure was found which closely resembles typical RNase III cleavage sites. This structure may be cleaved by RNase III to auto-regulate the expression of the rnc gene.     

On the formation of spontaneous deletions: the importance of short sequence homologies in the generation of large deletions

Using lacl-Z fusion strains of Escherichia coli we have devised systems that detect deletions of varying lengths. We examined deletions 700-1000 base pairs long, and genetically characterized over 250 spontaneous deletions. Of these, we analyzed 24 by direct DNA sequencing and 18 by inspection of restriction fragment patterns. Deletions of this size occur almost exclusively at short repeated sequences in both (recA+ and recA- strain backgrounds, but are detected 25-fold more frequently in a recA+ background. The frequency of deletion formation correlates with the extent of homology between the short repeated sequences, although other factors may be involved. The largest hotspot, which accounts for 60% of the deletions detected, involves the largest homology in the system (14 of 17 base pairs). Altering a single base pair within this homology reduces deletion incidence by an order of magnitude. We discuss possible mechanisms of deletion formation and consider its relationship to the excision of transposable elements.     

Functional assembly of the Na+/H+ antiporter of Helicobacter pylori from partial fragments in vivo

Functional assembly of the Helicobacter pylori Na+/H+ antiporter (HPNhaA) from partial fragments was studied. Expression plasmids encoding a series of complementary N- and C-terminal fragment pairs containing the transmembrane domains (TMs) were constructed by inserting a stop or a start codon into each of the loop regions of NhaA. HPNhaA fragments alone or complementary fragment pairs were expressed in DeltanhaA Escherichia coli, and fragment integration into the membrane and antiporter activity were measured. TM1-10, TM1-11, TM2-12, TM6-12, and TM10-12 were found in the membrane fraction, while the other fragments were not. While no single fragment displayed antiporter activity, simultaneous expression of fragments in certain pairs, such as TM1-2 + TM3-12, TM1-8 + TM9-12, or TM1-11 + TM12, reconstituted antiporter activity. With the exception of TM12, all of the fragments in the pairs were detected in the membrane. No single fragments expressed alone for these pairs were found in the membrane, except for TM1-11, suggesting that the interaction between the fragments in these pairs stabilized the fragments and enabled reconstitution of HPNhaA. We also found that the simultaneous expression of three complementary fragments (TM1-2 + TM3-8 + TM9-12) reconstituted HPNhaA activity. Other pairs that were found in the membrane (TM1-5 + TM6-12, TM1-10 + TM11-12, and TM1 + TM2-12) did not reconstitute antiporter activity, suggesting that they may not have the proper conformation. These results revealed that the ability to reconstitute antiporter activity depends on the split position in the loop regions and the interaction between complementary fragment pairs. We propose that formation of the active HPNhaA molecule is initiated by the interaction of short-lived intermediates and maintained by the increased stability of the intermediates within the resulting complex.