Muscle glycogen resynthesis during recovery from cycle exercise: no effect of additional protein ingestion.

In the present study, we have investigated the effect of carbohydrate and protein hydrolysate ingestion on muscle glycogen resynthesis during 4 h of recovery from intense cycle exercise. Five volunteers were studied during recovery while they ingested, immediately after exercise, a 600-ml bolus and then every 15 min a 150-ml bolus containing 1) 1.67 g. kg body wt(-1). l(-1) of sucrose and 0.5 g. kg body wt(-1). l(-1) of a whey protein hydrolysate (CHO/protein), 2) 1.67 g. kg body wt(-1). l(-1) of sucrose (CHO), and 3) water. CHO/protein and CHO ingestion caused an increased arterial glucose concentration compared with water ingestion during 4 h of recovery. With CHO ingestion, glucose concentration was 1-1.5 mmol/l higher during the first hour of recovery compared with CHO/protein ingestion. Leg glucose uptake was initially 0.7 mmol/min with water ingestion and decreased gradually with no measurable glucose uptake observed at 3 h of recovery. Leg glucose uptake was rather constant at 0.9 mmol/min with CHO/protein and CHO ingestion, and insulin levels were stable at 70, 45, and 5 mU/l for CHO/protein, CHO, and water ingestion, respectively. Glycogen resynthesis rates were 52 +/- 7, 48 +/- 5, and 18 +/- 6 for the first 1.5 h of recovery and decreased to 30 +/- 6, 36 +/- 3, and 8 +/- 6 mmol. kg dry muscle(-1). h(-1) between 1.5 and 4 h for CHO/protein, CHO, and water ingestion, respectively. No differences could be observed between CHO/protein and CHO ingestion ingestion. It is concluded that coingestion of carbohydrate and protein, compared with ingestion of carbohydrate alone, did not increase leg glucose uptake or glycogen resynthesis rate further when carbohydrate was ingested in sufficient amounts every 15 min to induce an optimal rate of glycogen resynthesis.     

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

Influence of light physical activity on cardiac responses during recovery from exercise in humans

To examine the influence of light exercise on cardiac responses during recovery from exercise, we measured heart rate (HR), stroke volume (SV), and cardiac output (Q˙ _c) in five healthy untrained male subjects in an upright position before, during, and after 10-min steady-state cycle exercise at an exercise intensity of 170 W, corresponding to a mean of 68 (SD 4)% of maximal oxygen uptake. The recovery phase was evaluated separately for three different conditions: 10 min of complete rest (passive recovery), 7 min of pedalling at 20-W exercise intensity followed by 3 min of rest (partially active recovery), and 7 min of pedalling at 40-W exercise intensity followed by 3 min of rest (partially active recovery), on an upright cycle ergometer. The time courses of decreases in HR in the two active recovery phases at different exercise intensities were almost identical to those in the passive recovery phase. However, the subsequent HR reductions during the rest after active recovery at 20 W and at 40 W were mean 7.5 (SD 4.4) and mean 10.0 (SD 3.1) beats · min⁻¹, respectively, both of which were significantly larger (P<0.05 and P<0.005) than the corresponding reduction [1.4 (SD 2.5) beats · min⁻¹] for passive recovery. The SV values at the two exercise intensities during the active recovery periods were maintained at levels similar to that during 170-W steady-state exercise. In contrast, the SV during passive recovery decreased gradually to a level significantly below the initial baseline level at rest before exercise (P<0.05). The resultant time courses of CO values during active recovery were significantly higher (each P<0.05) than that during passive recovery. It was concluded from these findings that light post-exercise physical activity plays an important role in facilitating the venous return from the muscles and in restoring the elevated HR to the pre-exercise resting level. Accepted: 17 September 1997     

Disruption of mitochondrial homeostasis in organic acidurias: insights from human and animal studies

Organic acidurias or organic acidemias constitute a group of inherited disorders caused by deficient activity of specific enzymes of amino acids, carbohydrates or lipids catabolism, leading to large accumulation and excretion of one or more carboxylic (organic) acids. Affected patients usually present neurologic symptoms and abnormalities, sometimes accompanied by cardiac and skeletal muscle alterations, whose pathogenesis is poorly known. However, in recent years growing evidence has emerged indicating that mitochondrial dysfunction is directly or indirectly involved in the pathology of various organic acidemias. Mitochondrial impairment in some of these diseases are generally due to mutations in nuclear genes of the tricarboxylic acid cycle or oxidative phosphorylation, while in others it seems to result from toxic influences of the endogenous organic acids to the mitochondrion. In this minireview, we will briefly summarize the present knowledge obtained from human and animal studies showing that disruption of mitochondrial homeostasis may represent a relevant pathomechanism of tissue damage in selective organic acidemias. The discussion will focus on mitochondrial alterations found in patients affected by organic acidemias and by the deleterious effects of the accumulating organic acids on mitochondrial pathways that are crucial for ATP formation and transfer. The elucidation of the mechanisms of toxicity of these acidic compounds offers new perspectives for potential novel adjuvant therapeutic strategies in selected disorders of this group.     

Glycogen synthase in the rat tapeworm, Hymenolepis diminuta--I. Enzyme activity during development and with crowding.

1. Activity of glycogen synthase (E.C. 2.4.1.11) in Hymenolepis diminuta (Cestoda: Cyclophyllidea) was investigated as a function of development and with crowding. 2. Synthase activity was low in the anterior and posterior ends of the worms and highest in the pregravid proglottids in the mid-portion of the strobila. 3. The enzyme activity increased during development of the cestode at least up to 15 days postinfection, but the increase in activity apparently was not due to conversion of the inactive to the active form. 4. Mature oncospheres also contained glycogen synthase, but the activity was lower than in strobilar tissues. 5. Synthase I activities and the proportion of total activity in the I form were generally higher in worms from high density (100 worm) infections than in those from low density (10 worm) infections.     

Vasopressin and A1 noradrenaline turnover during food or water deprivation in the rat

In the present study, we have examined in Wistar rats the effects of food or water deprivation of 3 days on the hypophyso-adrenal axis, vasopressinergic system and activity of A1 noradrenergic brain stem cell group, which is involved in the control of the hypothalamic neuro-endocrine activity. Levels of adrenocorticotropic hormone (ACTH) and vasopressin (AVP) were determined by radio-immunoassay, and corticosterone level was determined by fluorimetric method. Plasma levels of ACTH and corticosterone were greatly increased in both groups of rats. In water-deprived rats, plasma AVP (13.83 +/- 1.63 vs. 3.03 +/- 0.23 pg/ml) and osmolality levels were significantly elevated with a marked decrease of AVP hypophysis content (272 +/- 65 vs. 1098 +/- 75 ng/mg protein), but not in food-deprived rats in which osmolality did not change and AVP remained stocked (2082 +/- 216 ng/mg protein) in the hypophysis without release in the plasma (1.11 +/- 0.23 pg/ml). These observations indicated that both food-deprivation and water-deprivation stimulated the pituitary adrenal axis thereby suggesting a stress state. AVP production is stimulated both by fluid and food restriction but is secreted with differential effects: during food restriction AVP secretion is limited to supporting the hypothalamic pituitary-adrenal system.     

The role of microglia at synapses in the healthy CNS: novel insights from recent imaging studies

In the healthy brain, quiescent microglia continuously remodel their shape by extending and retracting highly motile processes. Despite a seemingly random sampling of their environment, microglial processes specifically interact with subsets of synaptic structures, as shown by recent imaging studies leading to proposed reciprocal interactions between microglia and synapses under non-pathological conditions. These studies revealed that various modalities of microglial dynamic behavior including their interactions with synaptic elements are regulated by manipulations of neurotransmission, neuronal activity and sensory experience. Conversely, these observations implied an unexpected role for quiescent microglia in the elimination of synaptic structures by specialized mechanisms that include the phagocytosis of axon terminals and dendritic spines. In light of these recent discoveries, microglia are now emerging as important effectors of neuronal circuit reorganization.     

Promoting effect and recovery activity from physical stress of the fruit of Morus alba

We examined the effects of the fruit of M. alba extracts on the changes of the monoamine oxidase (MAO) activities during and after the physical exercise in rat. Each activity was measured by used serotonin(5-HT) and benzylamine as substrate. Lactate dehydrogenase(LDH) activity and the concentrations of lactate in blood which were clinical indexes of physical exercise were also determined to compare with the relation of MAO activities. Those activities during and after the physical exercise have different tendency in each other enzyme. MAO-A activity was sharply decreased with stress by physical activities compared to the normal group, whereas MAO-B activity was increased for 60 minutes after exercise. All of these indexes were recovered to normal state by oral administration of extract of M. alba. These results of this study suggested M. alba may modulate the MAO activities during exercise and promote the capability of physical activities and show anti-stress effect. In general, MAO inhibitors have been used drugs for the purpose of treatment Parkinson's disease, dementia, depression. These results can apply to produce the health and functional foods that have modulating effects for these diseases.     

Increased activity in human visual cortex during directed attention in the absence of visual stimulation

When subjects direct attention to a particular location in a visual scene, responses in the visual cortex to stimuli presented at that location are enhanced, and the suppressive influences of nearby distractors are reduced. What is the top-down signal that modulates the response to an attended versus an unattended stimulus? Here, we demonstrate increased activity related to attention in the absence of visual stimulation in extrastriate cortex when subjects covertly directed attention to a peripheral location expecting the onset of visual stimuli. Frontal and parietal areas showed a stronger signal increase during this expectation than did visual areas. The increased activity in visual cortex in the absence of visual stimulation may reflect a top-down bias of neural signals in favor of the attended location, which derives from a fronto-parietal network.     

Effects of menstrual cycle and physical training on heat loss responses during dynamic exercise at moderate intensity in a temperate environment

We evaluated the effects of the menstrual cycle and physical training on heat loss (sweating and cutaneous vasodilation) responses during moderate exercise in a temperate environment. Ten untrained (group U) and seven endurance-trained (group T) women (maximal O2 uptake of 36.7+/-1.1 vs. 49.4+/-1.7 ml.kg-1.min-1, respectively; P<0.05) performed a cycling exercise at 50% maximal O2 uptake for 30 min during both the midfollicular and midluteal menstrual phase in a temperate environment (ambient temperature of 25 degrees C, relative humidity of 45%). In group U, plasma levels of estrone, estradiol, and progesterone at rest and esophageal temperature (Tes) during exercise were significantly higher during the midluteal than during the midfollicular phase (P<0.05). Sweating rate and cutaneous blood flow (measured via laser-Doppler flowmetry) on the chest, back, forearm, and thigh were lower during the midluteal than during the midfollicular phase during exercise. Tes threshold for heat loss responses was significantly higher and sensitivity of the heat loss responses was significantly lower in the midluteal than in the midfollicular phase, regardless of body site. These effects of the menstrual cycle in group U were not observed in group T. The sweating rate and cutaneous blood flow were significantly higher in group T than in group U, regardless of menstrual phase or body site. Tes threshold for heat loss responses was significantly lower and sensitivity of heat loss responses was significantly greater in group T than in group U in the midluteal phase; however, sensitivity of the sweating response was significantly greater in the midfollicular phase. These results suggest that heat loss responses in group U were inhibited in the midluteal phase compared with in the midfollicular phase. Menstrual cycle had no remarkable effects in group T. Physical training improved heat loss responses, which was more marked in the midluteal than in the midfollicular phase.     

Prostaglandins in human semen during fish oil ingestion: evidence for in vivo cyclooxygenase inhibition and appearance of novel trienoic compounds

Marine oils may offer cardiovascular benefits, but inhibition of prostaglandin E and prostaglandin F synthesis by fish oil has been found in animal studies, and such effects could alter physiological responses in man to a clinically significant degree. Since greater amounts of E and F-type prostaglandins are made in human seminal vesicles than in the rest of the body combined, the influence of n-3 supplements upon semen prostaglandins was assessed in 10 subjects before and after one month of taking 50 ml menhaden oil daily. Prostaglandins E1, E2 and their 19-hydroxy derivatives were measured by HPLC-UV as PGB's, and prostaglandin E3, 19-OH PGE3, and analogous PGF's by gas chromatography/mass spectrometry. Fish oil ingestion reduced concentrations of one- and two series prostaglandins (mean reduction in PGE's = 37%, in PGF's = 20%, p less than 0.05), while more than doubling the low amounts of PGE3 and PGF3 alpha, and their previously undescribed 19-hydroxy derivatives. Semen phospholipids were enriched in eicosapentaenoic acid after dietary fish oil, but sperm counts and motility were not altered during the study. Since dietary fish oil reduces prostaglandin concentration in semen, clinical trials of n-3 fatty acids should also evaluate other possible results of in vivo cyclooxygenase inhibition.