Recombinogenic flap ligation pathway for intrinsic repair of topoisomerase IB-induced double-strand breaks

Topoisomerase IB catalyzes recombinogenic DNA strand transfer reactions in vitro and in vivo. Here we characterize a new pathway of topoisomerase-mediated DNA ligation in vitro (flap ligation) in which vaccinia virus topoisomerase bound to a blunt-end DNA joins the covalently held strand to a 5' resected end of a duplex DNA containing a 3' tail. The joining reaction occurs with high efficiency when the sequence of the 3' tail is complementary to that of the scissile strand immediately 5' of the cleavage site. A 6-nucleotide segment of complementarity suffices for efficient flap ligation. Invasion of the flap into the duplex apparently occurs while topoisomerase remains bound to DNA, thereby implying a conformational flexibility of the topoisomerase clamp around the DNA target site. The 3' flap acceptor DNA mimics a processed end in the double-strand-break-repair recombination pathway. Our findings suggest that topoisomerase-induced breaks may be rectified by flap ligation, with ensuing genomic deletions or translocations.     

DNA strand transfer reactions catalyzed by vaccinia topoisomerase I.

Vaccinia virus DNA topoisomerase I forms a 3'-phosphoryl intermediate with duplex DNAs containing the conserved binding/cleavage motif 5'CCCTT decreases. Covalently bound enzyme is capable of transferring the incised DNA strand to a heterologous DNA acceptor containing a 5'OH terminus. Both intramolecular and intermolecular religation reactions are catalyzed. Intramolecular strand transfer occurs to the noncleaved strand of the DNA duplex and results in formation of a hairpin loop. Intermolecular religation to an exogenous DNA strand is favored over hairpin formation and requires the potential for base pairing between the acceptor and the noncleaved strand of the donor complex. As few as 4 potential base pairs are sufficient to support intermolecular transfer. These results in vitro are consistent with the proposal that vaccinia topoisomerase can catalyze sequence-specific strand transfer during genetic recombination in vivo (Shuman, S. (1991) Proc. Natl. Acad. Sci. U.S.A. 88, 10104-10108.).     

Interactions between eukaryotic DNA topoisomerase I and a specific binding sequence

The interaction between eukaryotic DNA topoisomerase I and a high affinity binding sequence was investigated. Quantitative footprint analysis demonstrated that the substrate preference results from strong specific binding of topoisomerase I to the sequence. The specificity was conferred by a tight noncovalent association between the enzyme and its target DNA, whereas the transient formation of a covalently bound enzyme.nicked DNA intermediate contributed insignificantly to the overall affinity. Topoisomerase I protected both strands over a 20-base pair region in which the cleavage site was centrally located. DNA modification interference analysis revealed a 16-base pair interference region on the scissile strand. Essential bases were confined to the 5' side of the cleavage site. The 6-base pair interference region observed on the complementary strand did not contain essential bases.     

Mechanism of strand passage by Escherichia coli topoisomerase I. The role of the required nick in catenation and knotting of duplex DNA

We studied the interaction between topoisomerase I and a nicked DNA substrate to determine how the nick permits Escherichia coli topoisomerase I to catenate and knot duplex DNA rings. The presence of just a single nick in a 6600-base pair DNA increased the amount of DNA bound to topoisomerase I by 6-fold. The enzyme acts at the nick, as shown by linearization of nicked circles and covalent attachment of an enzyme molecule opposite the nick. DNA breaks are also introduced by the enzyme at sites not opposite to a nick, but three orders of magnitude less efficiently. The break induced by the enzyme is within several base pairs of the nick and on the complementary strand, but the exact site cut is dictated by DNA sequence requirements. Because these sequence requirements are identical to those for cutting of single-stranded DNA, we conclude that the enzyme stabilizes a denatured region at the nick. Breaks in single-stranded DNA occur 98% of the time when a C residue is four bases to the 5' side unless G is adjacent and 5' to the break. For a DNA circle nicked at a unique location, the efficiency of DNA breakage opposite the nick correlates with the rate of catenation. We present a unified model for the relaxation, catenation, and knotting reactions of topoisomerase I in which the enzyme induces a break in a single-stranded region, but bridges that break with covalent and noncovalent interactions and allows passage of one duplex or single-stranded DNA segment.     

Minimal DNA duplex requirements for topoisomerase I-mediated cleavage in vitro

The minimal DNA duplex requirements for topoisomerase I-mediated cleavage at a specific binding sequence were determined by analyzing the interaction of the enzyme with sets of DNA substrates varying successively by single nucleotides at the 5'- or 3' end of either strand. Topoisomerase I cleavage experiments showed a minimal region of nine nucleotides on the scissile strand and five nucleotides on the noncleaved strand. On the scissile strand, seven of the nine nucleotides were situated upstream to the cleavage site, while all five nucleotides required on the non-cleaved strand were located to this side. The results suggested that topoisomerase I bound tightly to this region, stabilizing the DNA duplex extensively. On minimal substrates which were partially single-stranded downstream to the cleavage site, cleavage was suicidal, that is, the enzyme was able to cleave the substrates, but unable to perform the final religation.     

Site-specific DNA cleavage by vaccinia virus DNA topoisomerase I. Role of nucleotide sequence and DNA secondary structure.

Cleavage of linear duplex DNA by purified vaccinia virus DNA topoisomerase I occurs at a conserved sequence element (5'-C/T)CCTT decreases) in the incised DNA strand. Oligonucleotides spanning the high affinity cleavage site CCCTT at nucleotide 2457 in pUC19 DNA are cleaved efficiently in vitro, but only when hybridized to a complementary DNA molecule. As few as 6 nucleotides proximal to the cleavage site and 6 nucleotides downstream of the site are sufficient to support exclusive cleavage at the high affinity site (position +1). Single nucleotide substitutions within the consensus pentamer have deleterious effects on the equilibria of the topoisomerase binding and DNA cleavage reactions. The effects of base mismatch within the pentamer are more dramatic than are the effects of mutations that preserve base complementarity. Competition experiments indicate that topoisomerase binds preferentially to DNA sites containing the wild-type pentamer element. Single-stranded DNA containing the sequence CCCTT in the cleaved stand is a more effective competitor than is single-stranded DNA containing the complementary sequence in the noncleaved strand.     

Incomplete reversion of double stranded DNA cleavage mediated by Drosophila topoisomerase II: formation of single stranded DNA cleavage complex in the presence of an anti-tumor drug VM26.

Anti-tumor drug VM26 greatly stimulates topoisomerase II mediated DNA cleavage by stabilizing the cleavable complex. Addition of a strong detergent such as SDS to the cleavable complex induces the double stranded DNA cleavage. We demonstrate here that heat treatment can reverse the double stranded DNA cleavage; however, topoisomerase II remains bound to DNA even in the presence of SDS. This reversed complex has been shown to contain single strand DNA breaks with topoisomerase II covalently linked to the nicked DNA. Chelation of Mg++ by EDTA and the addition of salt to a high concentration also reverse the double strand DNA cleavage, and like heat reversion, topoisomerase II remains bound to DNA through single strand DNA break. The reversion complex can be analyzed and isolated by CsCl density gradient centrifugation. We have detected multiple discrete bands from such a gradient, corresponding to protein/DNA complexes with 1, 2, 3, ..... topoisomerase II molecules bound per DNA molecule. Analysis of topoisomerase II/DNA complexes isolated from the CsCl gradient indicates that there are single stranded DNA breaks associated with the CsCl stable complexes. Therefore, topoisomerase II/DNA complex formed in the presence of VM26 cannot be completely reversed to yield free DNA and enzyme. We discuss the possible significance of this finding to the mechanism of action of VM26 in the topoisomerase II reactions.     

Specific DNA cleavage and binding by vaccinia virus DNA topoisomerase I

Cleavage of a defined linear duplex DNA by vaccinia virus DNA topoisomerase I was found to occur nonrandomly and infrequently. Approximately 12 sites of strand scission were detected within the 5372 nucleotides of pUC19 DNA. These sites could be classified as having higher or lower affinity for topoisomerase based on the following criteria. Higher affinity sites were cleaved at low enzyme concentration, were less sensitive to competition, and were most refractory to religation promoted by salt, divalent cations, and elevated temperature. Cleavage at lower affinity sites required higher enzyme concentration and was more sensitive to competition and induced religation. Cleavage site selection correlated with a pentameric sequence motif (C/T)CCTT immediately preceding the site of strand scission. Noncovalent DNA binding by topoisomerase predominated over covalent adduct formation, as revealed by nitrocellulose filter-binding studies. The noncovalent binding affinity of vaccinia topoisomerase for particular subsegments of pUC19 DNA correlated with the strength and/or the number of DNA cleavage sites contained therein. Thus, cleavage site selection is likely to be dictated by specific noncovalent DNA-protein interactions. This was supported by the demonstration that a mutant vaccinia topoisomerase (containing a Tyr----Phe substitution at the active site) that was catalytically inert and did not form the covalent intermediate, nevertheless bound DNA with similar affinity and site selectivity as the wild-type enzyme. Noncovalent binding is therefore independent of competence in transesterification. It is construed that the vaccinia topoisomerase is considerably more stringent in its cleavage and binding specificity for duplex DNA than are the cellular type I enzymes.     

Base mutation analysis of topoisomerase II-idarubicin-DNA ternary complex formation. Evidence for enzyme subunit cooperativity in DNA cleavage.

Antitumor drugs, such as anthracyclines, interfere with mammalian DNA topoisomerase II by forming a ternary complex, DNA-drug-enzyme, in which DNA strands are cleaved and covalently linked to the enzyme. In this work, a synthetic 36-bp DNA oligomer derived from SV40 and mutated variants were used to determine the effects of base mutations on DNA cleavage levels produced by murine topoisomerase II with and without idarubicin. Although site competition could affect cleavage levels, mutation effects were rather similar among several cleavage sites. The major sequence determinants of topoisomerase II DNA cleavage without drugs are up to five base pairs apart from the strand cut, suggesting that DNA protein contacts involving these bases are particularly critical for DNA site recognition. Cleavage sites with adenines at positions -1 were detected without idarubicin only under conditions favouring enzyme binding to DNA, showing that these sites are low affinity sites for topoisomerase II DNA cleavage and/or binding. Moreover, the results indicated that the sequence 5'-(A)TA/(A)-3' (the slash indicates the cleaved bond, parenthesis indicate conditioned preference) from -3 to +1 positions constitutes the complete base sequence preferred by anthracyclines. An important finding was that mutations that improve the fit to the above consensus on one strand can also increase cleavage on the opposite strand, suggesting that a drug molecule may effectively interact with one enzyme subunit only and trap the whole dimeric enzyme. These findings documented that DNA recognition by topoisomerase II may occur at one or the other strand, and not necessarily at both of them, and that the two subunits can act cooperatively to cleave a double helix.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

A novel bipartite mode of binding of M. smegmatis topoisomerase I to its recognition sequence

We have investigated interaction of Mycobacterium smegmatis topoisomerase I at its specific recognition sequence. DNase I footprinting demonstrates a large region of protection on both the scissile and non-scissile strands of DNA. Methylation protection and interference analyses reveal base-specific contacts within the recognition sequence. Missing contact analyses reveal additional interactions with the residues in both single and double-stranded DNA, and hence underline the role for the functional groups associated with those bases. These interactions are supplemented by phosphate contacts in the scissile strand. Conformation specific probes reveal protein-induced structural distortion of the DNA helix at the T-A-T-A sequence 11 bp upstream to the recognition sequence. Based on these footprinting analyses that define parameters of topoisomerase I-DNA interactions, a model of topoisomerase I binding to its substrate is presented. Within the large protected region of 30 bp, the enzyme makes direct contact at two locations in the scissile strand, one around the cleavage site and the other 8-12 bases upstream. Thus the enzyme makes asymmetric recognition of DNA and could carry out DNA relaxation by either of the two proposed mechanisms: enzyme bridged and restricted rotation.     

Intrinsic intermolecular DNA ligation activity of eukaryotic topoisomerase II. Potential roles in recombination.

Drosophila melanogaster topoisomerase II is capable of joining phi X174 (+) strand DNA that it has cleaved to duplex oligonucleotide acceptor molecules by an intermolecular ligation reaction (Gale, K. C. and Osheroff, N. (1990) Biochemistry 29, 9538-9545). In order to investigate potential mechanisms for topoisomerase II-mediated DNA recombination, this intrinsic enzyme activity was further characterized. Intermolecular DNA ligation proceeded in a time-dependent fashion and was concentration-dependent with respect to oligonucleotide. The covalent linkage between phi X174 (+) strand DNA and acceptor molecules was confirmed by Southern analysis and alkaline gel electrophoresis. Topoisomerase II-mediated intermolecular DNA ligation required the oligonucleotide to contain a 3'-OH terminus. Moreover, the reaction was dependent on the presence of a divalent cation, was inhibited by salt, and was not affected by the presence of ATP. The enzyme was capable of ligating phi X174 (+) strand DNA to double-stranded oligonucleotides that contained 5'-overhang, 3'-overhand, or blunt ends. Single-stranded, nicked, or gapped oligonucleotides also could be used as acceptor molecules. These results demonstrate that the type II enzyme has an intrinsic ability to mediate illegitimate DNA recombination in vitro and suggests possible roles for topoisomerase II in nucleic acid recombination in vivo.     

Features of two hepatitis B virus (HBV) DNA integrations suggest mechanisms of HBV integration.

Two integrated hepatitis B virus (HBV) DNA molecules were cloned from two primary hepatocellular carcinomas each containing only a single integration. One integration (C3) contained a single linear segment of HBV DNA, and the other integration (C4) contained a large inverted duplication of viral DNA at the site of a chromosome translocation (O. Hino, T.B. Shows, and C.E. Rogler, Proc. Natl. Acad. Sci. USA 83:8338-8342, 1986). Sequence analysis of the virus-cell junctions of C3 placed the left virus-cell junction at nucleotide 1824, which is at the 5' end of the directly repeated DR1 sequence and is 6 base pairs from the 3' end of the long (L) negative strand. The right virus-cell junction was at nucleotide 1762 in a region of viral DNA (within the cohesive overlap) which shared 5-base-pair homology with cellular DNA. Sequence analysis of the normal cellular DNA across the integration site showed that 11 base pairs of cellular DNA were deleted at the site of integration. On the basis of this analysis, we suggest a mechanism for integration of the viral DNA molecule which involves strand invasion of the 3' end of the L negative strand of an open circular or linear HBV DNA molecule (at the DR1 sequence) and base pairing of the opposite end of the molecule with cellular DNA, accompanied by the deletion of 11 base pairs of cellular DNA during the double recombination event. Sequencing across the inverted duplication of HBV DNA in clone C4 located one side of the inversion at nucleotide 1820, which is 2 base pairs from the 3' end of the L negative strand. Both this sequence and the left virus-cell junction of C3 are within the 9-nucleotide terminally redundant region of the HBV L negative strand DNA. We suggest that the terminal redundancy is a preferred topoisomerase I nicking region because of both its base sequence and forked structure. Such nicking would lead to integration and rearrangement of HBV molecules within the terminal redundancy, as we have observed in both our clones.     

Telomeric DNA damage by topoisomerase I. A possible mechanism for cell killing by camptothecin

Topoisomerase I adjusts torsional stress in the genome by breaking and resealing one strand of the helix through a transient covalent coupling between enzyme and DNA. Camptothecin, a specific topoisomerase I poison, traps this covalent intermediate, thereby damaging the genome. Here we examined the activity of topoisomerase I at telomeric repeats to determine whether telomere structures are targets for DNA damage. We show that topoisomerase I is catalytically active in cleaving the G-rich telomeric strand in vitro in the presence of camptothecin but not in cleaving the C-rich strand. The topoisomerase I cleavage site is 5'-TT (downward arrow) AGGG-3' (cleavage site marked by the downward arrow). We also show that endogenous topoisomerase I can access telomeric DNA in vivo and form camptothecin-dependent covalent complexes. Therefore, each telomeric repeat represents a potential topoisomerase I cleavage site in vivo. Because telomere structures are comprised of a large number of repeats, telomeres in fact represent a high concentration of nested topoisomerase I sites. Therefore, more telomeric DNA damage by camptothecin could occur in cells with longer telomeres when cells possess equivalent levels of topoisomerase I. The evidence presented here suggests that DNA damage at telomeric repeats by topoisomerase I is a prominent feature of cell killing by camptothecin and triggers camptothecin-induced apoptosis.     

An insight into the active site of a type I DNA topoisomerase from the kinetoplastid protozoan Leishmania donovani

DNA topoisomerases are ubiquitous enzymes that govern the topological interconversions of DNA thereby playing a key role in many aspects of nucleic acid metabolism. Recently determined crystal structures of topoisomerase fragments, representing nearly all the known subclasses, have been solved. The type IB enzymes are structurally distinct from other known topoisomerases but are similar to a class of enzymes referred to as tyrosine recombinases. A putative topoisomerase I open reading frame from the kinetoplastid Leishmania donovani was reported which shared a substantial degree of homology with type IB topoisomerases but having a variable C-terminus. Here we present a molecular model of the above parasite gene product, using the human topoisomerase I crystal structure in complex with a 22 bp oligonucleotide as a template. Our studies indicate that the overall structure of the parasite protein is similar to the human enzyme; however, major differences occur in the C-terminal loop, which harbors a serine in place of the usual catalytic tyrosine. Most other structural themes common to type IB topoisomerases, including secondary structural folds, hinged clamps that open and close to bind DNA, nucleophilic attack on the scissile DNA strand and formation of a ternary complex with the topoisomerase I inhibitor camptothecin could be visualized in our homology model. The validity of serine acting as the nucleophile in the case of the parasite protein model was corroborated with our biochemical mapping of the active site with topoisomerase I enzyme purified from L.donovani promastigotes.     

Zinc (II) coordination in Escherichia coli DNA topoisomerase I is required for cleavable complex formation with DNA.

Escherichia coli DNA topoisomerase I catalyzes relaxation of negatively supercoiled DNA. The reaction proceeds through a covalent intermediate, the cleavable complex, in which the DNA is cleaved and the enzyme is linked to the DNA via a phosphotyrosine linkage. Each molecule of E. coli DNA topoisomerase I has been shown to have three tightly bound zinc(II) ions required for relaxation activity (Tse-Dinh, Y.-C., and Beran-Steed, R.K. (1988) J. Biol. Chem. 263, 15857-15859). It is shown here that Cd(II) could replace Zn(II) in reconstitution of active enzyme from apoprotein. The role of metal was analyzed by studying the partial reactions. The apoenzyme was deficient in sodium dodecyl sulfate-induced cleavage of supercoiled PM2 phage DNA. Formation of covalent complex with linear single-stranded DNA was also reduced in the absence of metal. However, the cleavage of small oligonucleotide was not affected, and the apoenzyme could religate the covalently bound oligonucleotide to another DNA molecule. Assay of noncovalent complex formation by retention of 5'-labeled DNA on filters showed that the apoenzyme was not inhibited in noncovalent binding to DNA. It is proposed that zinc(II) coordination in E. coli DNA topoisomerase I is required for the transition of the noncovalent complex with DNA to the cleavable state.     

Site-specific interaction of vaccinia virus topoisomerase I with duplex DNA. Minimal DNA substrate for strand cleavage in vitro.

Purified vaccinia virus DNA topoisomerase I forms a cleavable complex with duplex DNA at a conserved sequence element 5'(C/T)CCTTdecreases in the incised DNA strand. DNase I footprint studies show that vaccinia topoisomerase protects the region around the site of covalent adduct formation from nuclease digestion. On the cleaved DNA strand, the protected region extends from +13 to -13 (+1 being the site of cleavage). On the noncleaved strand, the protected region extends from +13 to -9. Similar nuclease protection is observed for a mutant topoisomerase (containing a Tyr ---- Phe substitution at the active site amino acid 274) that is catalytically inert and does not form the covalent intermediate. Thus, vaccinia topoisomerase is a specific DNA binding protein independent of its competence in transesterification. By studying the cleavage of a series of 12-mer DNA duplexes in which the position of the CCCTTdecreases motif within the substrate is systematically phased, the "minimal" substrate for cleavage has been defined; cleavage requires six nucleotides upstream of the cleavage site and two nucleotides downstream of the site. An analysis of the cleavage of oligomer substrates mutated singly in the CCCTT sequence reveals a hierarchy of mutational effects based on position within the pentamer motif and the nature of the sequence alteration.     

Real-time observation of strand exchange reaction with high spatiotemporal resolution

RecA binds to single-stranded (ss) DNA to form?a helical filament that catalyzes strand exchange with a homologous double-stranded (ds) DNA. The study of strand exchange in ensemble assays is limited by the diffusion limited homology search process, which masks the subsequent strand exchange reaction. We developed a single-molecule fluorescence assay with a few base-pair and millisecond resolution that can separate initial docking from the subsequent propagation of joint molecule formation. Our data suggest that propagation occurs in 3?bp increments with destabilization of the incoming dsDNA and concomitant pairing with the reference ssDNA. Unexpectedly, we discovered the formation of?a dynamic complex between RecA and the displaced DNA that remains bound transiently after joint molecule formation. This finding could have important implications for the irreversibility of strand exchange. Our model for strand exchange links structural models of RecA to its catalytic function.     

DNA strand transfer reactions catalyzed by vaccinia topoisomerase: hydrolysis and glycerololysis of the covalent protein-DNA intermediate.

Vaccinia topoisomerase forms a covalent protein-DNA intermediate at sites containing the sequence 5'-CCCTT. The T nucleotide is linked via a 3'-phosphodiester bond to Tyr-274 of the enzyme. Here, we report that the enzyme catalyzes hydrolysis of the covalent intermediate, resulting in formation of a 3'-phosphate-terminated DNA cleavage product. The hydrolysis reaction is pH-dependent (optimum pH = 9.5) and is slower, by a factor of 10(-5), than the rate of topoisomerase-catalyzed strand transfer to a 5'-OH terminated DNA acceptor strand. Mutants of vaccinia topoisomerase containing serine or threonine in lieu of the active site Tyr-274 form no detectable covalent intermediate and catalyze no detectable DNA hydrolysis. This suggests that hydrolysis occurs subsequent to formation of the covalent protein-DNA adduct and not via direct attack by water on DNA. Vaccinia topoisomerase also catalyzes glycerololysis of the covalent intermediate. The rate of glycerololysis is proportional to glycerol concentration and is optimal at pH 9.5.