Female‐dependent transmission of paternal mtDNA is a shared feature of bivalve species with doubly uniparental inheritance (DUI) of mitochondrial DNA

Several species from a number of bivalve molluscan families are known to have a paternally transmitted mitochondrial genome, along with the standard maternally transmitted one. The main characteristic of the phenomenon, known as doubly uniparental inheritance (DUI), is the coupling of sex and mtDNA inheritance: males receive both genomes but transmit only the paternal to their progeny; females either do not have the paternal genome or, if they do, they do not transmit it to their progeny. In the families Mytilidae and Veneridae, both of which have DUI, a female individual is either female‐biased (it produces only, or nearly so, female progeny), male‐biased (it produces mainly male progeny) or non‐biased (it produces both genders in intermediate frequencies). Here we present evidence for a same pattern in the freshwater mussel, Unio delphinus (Unionidae). These results suggest that the maternal control of whether a fertilized egg will develop into a male or a female individual (and the associated feature of whether it will inherited or not inherit the paternal mtDNA) is a general characteristic of species with DUI.     

Chromosome 21 mosaicism. A review

Despite the great efforts contributed to studies on the trisomy 21 etiology, basic mechanisms of nondisjunction are still poorly understood. Even less is known about mosaic variant of trisonomy 21. In this paper, some problems of masaicism are considered: (1) estimation of the prevalence of mosaicism in patients affected with Down syndrome, (2) determination of population rate of parental mosaicism, (3) evaluation of the role of ovarian mosaicism in etiology of Down syndrome, (4) origin of the extra chromosome, (5) mechanisms of production of mosaic lines, (6) phenomenon of skewed sex ratio (female predominance, in fetuses particularly), (7) effect of maternal age.     

Sexually antagonistic evolution caused by male–male competition in the pistil

Although sexual selection and sexual conflict are important evolutionary forces in animals, their significance in plants is uncertain. In hermaphroditic organisms, such as many plants, sexual conflict may occur both between mating partners (interlocus conflict) and between male and female sex roles within an individual (intralocus conflict). We performed experimental evolution, involving lines that were crossed with either one or two pollen donors (monogamous or polyandrous lines), in the hermaphroditic plant (Collinsia heterophylla) where early fertilizations are associated with female fitness costs (reduced seed set). Artificial polyandry for four generations resulted in enhanced pollen performance and increased female fitness costs compared to the monogamous and source (starting material) lines. Female fitness was also reduced in the monogamous line, indicating a possible trade‐off between sex roles, resulting from early pollination. We performed a second experiment to investigate a potential harming effect of pollen performance on seed set. We found that high siring success of early arriving pollen competing with later‐arriving pollen was associated with high female fitness costs, consistent with an interlocus sexual conflict. Our study provides evidence for the importance of sexual selection in shaping evolution of plant reproductive strategies, but also pinpoints the complexity of sexual conflict in hermaphroditic species.     

Identification of sex‐specific molecular markers using restriction site‐associated DNA sequencing

A major barrier to evolutionary studies of sex determination and sex chromosomes has been a lack of information on the types of sex‐determining mechanisms that occur among different species. This is particularly problematic in groups where most species lack visually heteromorphic sex chromosomes, such as fish, amphibians and reptiles, because cytogenetic analyses will fail to identify the sex chromosomes in these species. We describe the use of restriction site‐associated DNA (RAD) sequencing, or RAD‐seq, to identify sex‐specific molecular markers and subsequently determine whether a species has male or female heterogamety. To test the accuracy of this technique, we examined the lizard Anolis carolinensis. We performed RAD‐seq on seven male and ten female A. carolinensis and found one male‐specific molecular marker. Anolis carolinensis has previously been shown to possess male heterogamety and the recently published A. carolinensis genome facilitated the characterization of the sex‐specific RAD‐seq marker. We validated the male specificity of the new marker using PCR on additional individuals and also found that it is conserved in some other Anolis species. We discuss the utility of using RAD‐seq to identify sex‐determining mechanisms in other species with cryptic or homomorphic sex chromosomes and the implications for the evolution of male heterogamety in Anolis.     

Complex sex determination in the stinging nettle Urtica dioica

The dioecious species Urtica dioica harbours wide variation in sex ratio of seeds. We conducted a series of crosses to analyse the genetic basis of sex determination in this species. Dutch populations of U. dioica contain low proportions of monoecious individuals beside male and female plants. Self-pollination of monoecious plants always yielded female, male and monoecious plants, generally in a ratio of one female to three male/monoecious individuals. This motivated us to write down a simple model in which gender is determined by one major sex-determination locus with four alleles. In the model males and monoecious plants have distinct genotypes but are both heterozygous at the sex-determination locus. We first made crosses among progeny obtained after self-pollination of monoecious plants. These crosses showed that the monoecious trait generally showed Mendelian inheritance and was passed on to the next generation via both pollen and seeds. Further crosses between monoecious plants and plants from dioecious system indicated that alleles from the dioecious system are often dominant. However, many exceptions to our genetic model are observed which suggest that dominance is incomplete and/or that more genes are involved in sex determination. We discuss to what extent sex determination genes explain the strongly biased seed sex ratios and argue that additional genes, for instance genes for female choice, must also be involved.     

Inheritance of progeny sex ratio in Urtica dioica

Seed samples collected from female Urtica dioica plants in the field showed considerable inter-family variation in the sex ratio (faction of males). To investigate the inheritance pattern of the sex ratio trait, crosses were performed between individual male and female plants from different sex ratio families. Our results suggest, at least for the families studied here, that maternal parents strongly contribute to the variation in the primary sex ratio. Furthermore, progeny sex ratios from reciprocal crosses were significantly different and resembled the sex ratios produced by their maternal parents. We discuss the possible mechanisms underlying maternal control.     

Mosaicism for FMR1 gene full mutation and intermediate allele in a female foetus: A postzygotic retraction event

Fragile X syndrome is caused by the expansion of an unstable CGG repeat in the 5′UTR of FMR1 gene. The occurrence of mosaicism is not uncommon, especially in male patients, whereas in females it is not so often reported. Here we report a female foetus that was subject to prenatal diagnosis, because of her mother being a premutation carrier. The foetus was identified as being a mosaic for an intermediate allele and a full mutation of FMR1 gene, in the presence of a normal allele. The mosaic status was confirmed in three different tissues of the foetus – amniotic fluid, skin biopsy and blood – the last two obtained after pregnancy termination. Karyotype analysis and X-chromosome STR markers analysis do not support the mosaicism as inheritance of both maternal alleles. Oligonucleotide array-CGH excluded an imbalance that could contain the primer binding site with a different repeat size. The obtained results give compelling evidence for a postzygotic expansion mechanism where the foetus mosaic pattern originated from expansion of the mother's premutation into a full mutation and consequent regression to an intermediate allele in a proportion of cells. These events occurred in early embryogenesis before the commitment of cells into the different tissues, as the three tested tissues of the foetus have the same mosaic pattern. The couple has a son with Fragile X mental retardation syndrome and choose to terminate this pregnancy after genetic counselling.     

Female-limited X-chromosome evolution effects on male pre- and post-copulatory success

Intralocus sexual conflict arises when the expression of shared alleles at a single locus generates opposite fitness effects in each sex (i.e. sexually antagonistic alleles), preventing each sex from reaching its sex-specific optimum. Despite its importance to reproductive success, the relative contribution of intralocus sexual conflict to male pre- and post-copulatory success is not well-understood. Here, we used a female-limited X-chromosome (FLX) evolution experiment in Drosophila melanogaster to limit the inheritance of the X-chromosome to the matriline, eliminating possible counter-selection in males and allowing the X-chromosome to accumulate female-benefit alleles. After more than 100 generations of FLX evolution, we studied the effect of the evolved X-chromosome on male attractiveness and sperm competitiveness. We found a non-significant increase in attractiveness and decrease in sperm offence ability in males expressing the evolved X-chromosomes, but a significant increase in their ability to avoid displacement by other males'' sperm. This is consistent with a trade-off between these traits, perhaps mediated by differences in body size, causing a small net reduction in overall male fitness in the FLX lines. These results indicate that the X-chromosome in D. melanogaster is subject to selection via intralocus sexual conflict in males.     

Condition dependence of male and female reproductive success: insights from a simultaneous hermaphrodite

Sexually selected traits are predicted to show condition dependence by capturing the genetic quality of its bearer. In separate‐sexed organisms, this will ultimately translate into condition dependence of reproductive success of the sex that experiences sexual selection, which is typically the male. Such condition dependence of reproductive success is predicted to be higher in males than females under conditions promoting intense sexual selection. For simultaneous hermaphrodites, however, sex allocation theory predicts that individuals in poor condition channel relatively more resources into the male sex function at the expense of the female function. Thus, male reproductive success is expected to be less condition dependent than female reproductive success. We subjected individuals of the simultaneously hermaphroditic snail Physa acuta to two feeding treatments to test for condition dependence of male and female reproductive success under varying levels of male–male competition. Condition dependence was found for female, but not for male, reproductive success, meaning that selection on condition is relatively stronger through the female sex function. This effect was consistent over both male–male competition treatments. Decomposition of male and female reproductive performance revealed that individuals in poor condition copulated more in their male role, indicating an increased male allocation to mate acquisition. These findings suggest that sex‐specific condition dependence of reproductive success is at least partially driven by condition‐dependent sex allocation. We discuss the implications of condition‐dependent sex allocation for the evolution of sexually selected traits in simultaneous hermaphrodites.     

The cytogenetic architecture of the aphid genome

In recent years aphids, with their well‐defined polyphenism, have become favoured as model organisms for the study of epigenetic processes. The availability of the pea aphid (Acyrthosiphon pisum) genome sequence has engendered much research aimed at elucidating the mechanisms by which the phenotypic plasticity of aphids is inherited and controlled. Yet so far this research effort has paid little attention to the cytogenetic processes that play a vital part in the organisation, expression and inheritance of the aphid genome. Aphids have holocentric chromosomes, which have very different properties from the chromosomes with localised centromeres that are found in most other organisms. Here we review the diverse forms of aphid chromosome behaviour that occur during sex determination and male and female meiosis, often in response to environmental changes and mediated by endocrine factors. Remarkable differences occur, even between related species, that could have significant effects on the inheritance of all or parts of the genome. In relation to this, we review the particular features of the distribution of heterochromatin, rDNA genes and other repetitive DNA in aphid chromosomes, and discuss the part that these may play in the epigenetic modification of chromatin structure and function.     

Anthropogenic impacts on Costa Rican bat parasitism are sex specific

While anthropogenic impacts on parasitism of wildlife are receiving growing attention, whether these impacts vary in a sex‐specific manner remains little explored. Differences between the sexes in the effect of parasites, linked to anthropogenic activity, could lead to uneven sex ratios and higher population endangerment. We sampled 1108 individual bats in 18 different sites across an agricultural mosaic landscape in southern Costa Rica to investigate the relationships between anthropogenic impacts (deforestation and reductions in host species richness) and bat fly ectoparasitism of 35 species of Neotropical bats. Although female and male bat assemblages were similar across the deforestation gradient, bat fly assemblages tracked their hosts closely only on female bats. We found that in female hosts, parasite abundance per bat decreased with increasing bat species richness, while in male hosts, parasite abundance increased. We hypothesize the differences in the parasite–disturbance relationship are due to differences in roosting behavior between the sexes. We report a sex‐specific parasite–disturbance relationship and argue that sex differences in anthropogenic impacts on wildlife parasitism could impact long‐term population health and survival.     

Male–male interactions and male mating success in the leafhopper Aphrodes makarovi

In mating systems based on substrate‐borne vibrations, sexual communication often involves a reciprocal exchange of species‐ and sex‐specific vibrational signals and male is searching for a stationary female. In the leafhopper Aphrodes makarovi, female reply is essential for successful location of the female and its variable duration directly affects male's costs associated with signalling and searching. We studied male and female behaviour in a trio situation (two males and one female), and our results show that male–male competition had important effects on male mating success. Females replied equally to advertisement calls emitted by the winning and losing males and mated with the first male that located them, regardless of his investment in calling effort. Males eavesdropped to male–female duet maintained by the rival, and the winners were better at exploiting female replies to the rival's advertisement calls by silently approaching the female. To interfere with the ongoing male–female duet, males also emitted masking signals overlapping the latter part of the female reply. More overlapped female replies were registered in response to the losers and masking signals most likely delay the rival in reaching the female. Our study shows that a comprehensive understanding of male mating success and female preferences in vibrational duetting systems requires also investigations in more complex settings that more realistically represent the situation in nature.     

fruitless splicing specifies male courtship behavior in Drosophila

All animals exhibit innate behaviors that are specified during their development. Drosophila melanogaster males (but not females) perform an elaborate and innate courtship ritual directed toward females (but not males). Male courtship requires products of the fruitless (fru) gene, which is spliced differently in males and females. We have generated alleles of fru that are constitutively spliced in either the male or the female mode. We show that male splicing is essential for male courtship behavior and sexual orientation. More importantly, male splicing is also sufficient to generate male behavior in otherwise normal females. These females direct their courtship toward other females (or males engineered to produce female pheromones). The splicing of a single neuronal gene thus specifies essentially all aspects of a complex innate behavior.     

Population structure leads to male‐biased population sex ratios under environmental sex determination

Spatial structure has been shown to favor female‐biased sex allocation, but current theory fails to explain male biases seen in many taxa, particularly those with environmental sex determination (ESD). We present a theory and accompanying individual‐based simulation model that demonstrates how population structure leads to male‐biased population sex ratios under ESD. Our simulations agree with earlier work showing that the high productivity of female‐producing habitats creates a net influx of sex‐determining alleles into male‐producing habitats, causing larger sex ratio biases, and lower productivity in male‐producing environments (Harts et al. 2014). In contrast to previous findings, we show that male‐biasing habitats disproportionately impact the global sex ratio, resulting in stable male‐biased population sex ratios under ESD. The failure to detect a male bias in earlier work can be attributed to small subpopulation sizes leading to local mate competition, a condition unlikely to be met in most ESD systems. Simulations revealed that consistent male biases are expected over a wide range of population structures, environmental conditions, and genetic architectures of sex determination, with male excesses as large as 30 percent under some conditions. Given the ubiquity of genetic structure in natural populations, we predict that modest, enduring male biased allocation should be common in ESD species, a pattern consistent with reviews of ESD sex ratios.     

Ultra deep sequencing detects a low rate of mosaic mutations in tuberous sclerosis complex

Tuberous sclerosis complex (TSC) is an autosomal dominant neurocutaneous syndrome caused by mutations in TSC1 and TSC2. However, 10–15% TSC patients have no mutation identified with conventional molecular diagnostic studies. We used the ultra-deep pyrosequencing technique of 454 Sequencing to search for mosaicism in 38 TSC patients who had no TSC1 or TSC2 mutation identified by conventional methods. Two TSC2 mutations were identified, each at 5.3% read frequency in different patients, consistent with mosaicism. Both mosaic mutations were confirmed by several methods. Five of 38 samples were found to have heterozygous non-mosaic mutations, which had been missed in earlier analyses. Several other possible low-frequency mosaic mutations were identified by deep sequencing, but were discarded as artifacts by secondary studies. The low frequency of detection of mosaic mutations, two (6%) of 33, suggests that the majority of TSC patients who have no mutation identified are not due to mosaicism, but rather other causes, which remain to be determined. These findings indicate the ability of deep sequencing, coupled with secondary confirmatory analyses, to detect low-frequency mosaic mutations.     

Genetic evidence for male‐biased dispersal in the Qinghai toad‐headed agamid Phrynocephalus vlangalii and its potential link to individual social interactions

Sex‐biased dispersal has profound impacts on a species' biology and several factors have been attributed to its evolution, including mating system, inbreeding avoidance, and social complexity. Sex‐biased dispersal and its potential link to individual social interactions were examined in the Qinghai toad‐headed agamid (Phrynocephalus vlangalii). We first determined the pattern of sex‐biased dispersal using population genetic methods. A total of 345 specimens from 32 sites in the Qaidam Basin were collected and genotyped for nine microsatellite DNA loci. Both individual‐based assignment tests and allele frequency‐based analyses were conducted. Females revealed much more genetic structure than males and all results were consistent with male‐biased dispersal. First‐generation migrants were also identified by genetic data. We then examined eight social interaction‐related morphological traits and explored their potential link to sex‐biased dispersal. Female residents had larger heads and longer tails than female migrants. The well‐developed signal system among females, coupled with viviparity, might make remaining on natal sites beneficial, and hence promote female philopatry. Dominant females with larger heads were more likely to stay. Contrary to females, male migrants had larger heads and belly patches than residents, suggesting that dispersal might confer selective advantages for males. Such advantages may include opportunities for multiple mating and escaping from crowded sites. Large belly patches and several other morphological traits may assist their success in obtaining mates during dispersal. Furthermore, a relatively high relatedness (R = 0.06) among females suggested that this species might have rudimentary social structure. Case studies in “less” social species may provide important evidence for a better understanding of sex‐biased dispersal.     

The Genetic Basis of Sex Ratio in Silene Alba (= S. Latifolia)

A survey of maternal families collected from natural populations showed that the sex ratio in Silene alba was slightly female biased. Sex ratio varied among populations and among families within a female biased population. Crosses among plants from the most female biased population and the most male biased population showed that the sex ratio polymorphism was inherited through or expressed in the male parent. Males from one family in particular exhibited a severe female bias, characterized by less than 20% male progeny. The inheritance of sex ratio was investigated using a reciprocal crossing design. Sex ratios from reciprocal crosses were significantly different, indicating either sex-linkage or cytoplasmic inheritance of sex ratio. The sex ratios produced by males generally resembled the sex ratios produced by their male parents, indicating that the sex ratio modifier was Y linked. The maternal parent also significantly influenced sex ratio through an interaction with the genotype of the paternal parent. Sex ratio, therefore, is apparently controlled by several loci. Although sex ratio bias in this species may be due to deleterious alleles on the Y chromosome, it is more likely to involve an interaction between loci that cause the female bias and a Y-linked locus that enhances the proportion of males in the progeny.     

A study of 45,X/46,XX mosaicism in Turner syndrome females: a novel primer pair for the (CAG)n repeat within the androgen receptor gene

This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome.     

Double aneuploidy in three Egyptian patients: Down-Turner and Down-Klinefelter syndromes

The co-occurrence of two numerical chromosomal abnormalities in same individual (double aneuploidy) is relatively rare and its clinical presentations are variable depending on the predominating aneuploidy or a combination effect of both. Furthermore, double aneuploidy involving both autosomal and sex chromosomes is seldom described. In this study, we present three patients with double aneuploidy involving chromosome 21 and sex chromosomes. They all had the classical non disjunction trisomy 21; that was associated with monosomy X in two of them and double X in the other. Clinically, they had most of the phenotypic features of Down syndrome as well as variable features characteristic of Turner or Klinefelter syndrome. Cytogenetic studies and fluorescence in situ hybridization (FISH) analysis were carried out for all patients and their parents. The first patient was a male, mosaic with 2 cell lines (45,X/47,XY,+21) by regular banding techniques and had an affected sib with Down syndrome (47,XY,+21). The second was a female, mosaic (46,X,+21/47,XX,+21) where monosomy X was detected only by FISH in 15 percentages of cells, nevertheless, stigmata of Turner syndrome was more obvious in this patient. The third patient had non mosaic double trisomy; Down-Klinefelter (48,XXY,+21) presented with Down syndrome phenotype. Parental karyotypes and FISH studies for these patients were normal with no evidence of mosaicism. In this report, we review the variable clinical presentations among the few reported cases with the same aneuploidy in relation to ours. Also, the proposed mechanisms of double aneuploidy and the occurrence of non-disjunction in more than one family member are discussed. This study emphasizes the importance of molecular cytogenetics studies for more than one tissue in cases with atypical features of characteristic chromosomal aberration syndromes. To our knowledge, this is the first report of double aneuploidy, Down-Turner and Down-Klinefelter syndromes in Egyptian patients.     

GENETIC DRIFT IN ANTAGONISTIC GENES LEADS TO DIVERGENCE IN SEX‐SPECIFIC FITNESS BETWEEN EXPERIMENTAL POPULATIONS OF DROSOPHILA MELANOGASTER

Males and females differ in their reproductive roles and as a consequence are often under diverging selection pressures on shared phenotypic traits. Theory predicts that divergent selection can favor the invasion of sexually antagonistic alleles, which increase the fitness of one sex at the detriment of the other. Sexual antagonism can be subsequently resolved through the evolution of sex‐specific gene expression, allowing the sexes to diverge phenotypically. Although sexual dimorphism is very common, recent evidence also shows that antagonistic genetic variation continues to segregate in populations of many organisms. Here we present empirical data on the interaction between sexual antagonism and genetic drift in populations that have independently evolved under standardized conditions. We demonstrate that small experimental populations of Drosophila melanogaster have diverged in male and female fitness, with some populations showing high male, but low female fitness while other populations show the reverse pattern. The between‐population patterns are consistent with the differentiation in reproductive fitness being driven by genetic drift in sexually antagonistic alleles. We discuss the implications of our results with respect to the maintenance of antagonistic variation in subdivided populations and consider the wider implications of drift in fitness‐related genes.