A method for the medium-term storage of plant tissue samples at room temperature and successive cycles of DNA extraction

Based on the protocol originally described by Stein et al. (2001), we have developed a method that allows for medium-term conservation at room temperature of wheat (Triticum aestivum) tissue samples to use for DNA extraction. DNA quality was suitable for analysis by PCR and Southern hybridization, even after 2 months of storage at room temperature. This method allows successive DNA re-extractions from a previously extracted sample and maximization of the DNA yield that can be recovered from precious samples. This method has applications for conservation of leaf samples and management of DNA extraction. Our method can help improve data recovery in many plant molecular genetics research projects.     

Hydrolysis with lead perchlorate: A new method used to estimate RNA in sugarcane tissues

The precipitation and hydrolysis of RNA by lead perchlorate has been studied and the results have been applied to estimate RNA in three widely different tissues from Saccharum species (sugarcane). This new method makes it possible to estimate RNA in highly lignified tissue for which existing methods using cold perchloric acid or warm alkali are unsuitable. As far as comparisons are possible, lead perchlorate gives the same results as extraction with acid and alkali, except that values are slightly lower in rapidly dividing tissue. Acid-soluble materials are removed by a single extraction with 0.01 m Pb(ClO₄)₂ at pH 2, where RNA and DNA are quantitatively precipitated but not hydrolyzed. Specific hydrolysis of RNA is then carried out at neutral pH with a solution containing 3 m Pb(ClO₄)₂ and 2.5 n NaOH, and the products are extracted at pH 2. DNA and most interfering materials remain insoluble. RNA in the extract is measured by uv absorption versus a combined tissue/reagent blank. The entire procedure can be carried out at room temperature. DNA in the tissue can be estimated as usual (1–3).     

DNA isolation by a rapid method from human blood samples: Effects of MgCl2, EDTA,storage time,and temperature on DNA yield and quality

The isolation of DNA from whole blood by a modified rapid method (RM) was tested using various detergents and buffer conditions. Extraction of DNA with either NP-40 or Triton X-100 gave a high yield of undegraded DNA in less than an hour. The concentration of magnesium ion in the buffers was critical to obtaining intact, high molecular weight (HMW) DNA. Greater than 10 mM MgCl₂ led to degradation. Addition of EDTA to the buffer inhibits this degradation. Preparation of DNA from blood stored at room temperature or incubated at 37°C for 24 hr resulted in the same amount and quality of DNA as from samples frozen at −70°C. DNA from blood samples that had undergone more than four freeze-thaw cycles was found to be partially degraded. The modified RM can be applied to extract DNA from as little as 10 μl of blood (340 ng of DNA) and from dried blood samples. DNA samples remained intact and undegraded for longer times when DNA was dissolved in higher concentrations of EDTA. This work was supported by grants from the Indiana Department of Mental Health and PHS RO1 AG10297.     

A comparison of methods for extracting DNA from Coxiella burnetii as measured by a duplex qPCR assay

Aims: To determine the optimal DNA extraction method for the detection of Coxiella burnetii including the small‐cell variant (SCV) by real‐time PCR (qPCR) in clinical samples. Methods and Results: A duplex qPCR detecting two Coxiella burnetii gene targets (com1 and IS1111a genes) was developed. Each target in this PCR had a sensitivity of one copy number per reaction. DNA extraction methods were compared on spiked negative samples and included a silica column kit, a chloroform separation prior to a silica column method and a chloroform/phenol separation and DNA precipitation method. Conclusions: The silica column extraction method was more efficient at recovering C. burnetii DNA, from large‐cell and small‐cell variants, than a chloroform or chloroform/phenol method. The silica column method was useful on spiked human samples including serum, buffy coat and bone marrow samples. Significance and impact of study: This study demonstrated that a simple column kit method is efficient to use for the detection of C. burnetii in clinical samples including the SCV.     

Molecular Typing of Cyst‐Forming Nematodes Globodera pallida and G. rostochiensis,Using Real‐Time PCR and Evaluation of Five Methods for Template Preparation

Globodera pallida and G. rostochiensis are two cyst‐forming nematodes known to infest potato crops, causing severe economic losses worldwide. In this study, a real‐time TaqMan PCR assay was developed and optimized for the simultaneous detection of G. pallida and G. rostochiensis. The assay's analytical and diagnostic sensitivity and specificity were evaluated using reference isolates. Four different DNA extraction methods and one rapid crude template‐preparation procedure were compared in terms of extraction purity, efficiency for PCR applications, utility and cost. Extraction methods A and B included two commercially available kits that utilize silica columns and magnetic beads, respectively. Method C was based on DNA isolation using Chelex resin, and method D was a standard chemistry in‐house protocol. Procedure E included the direct use of crude mixture composed of disrupted cysts in Tris–EDTA buffer. The multiplex TaqMan PCR assay successfully discriminated the two nematode species from all reference cyst samples and its recorded diagnostic sensitivity (Dse) and specificity (Dsp) was 100%. On the contrary, in conventional (Co) PCR tests, the overall Dsp and Dse were lower and estimated at 94 and 87% for G. pallida, and 97 and 88% for G. rostochiensis, respectively. Spectrophotometric results showed that DNA extraction methods A, B and C yielded the purest DNA and gave the lowest mean C_t values as well as the most consistent results in Co PCR. Alternative crude preparation method E resulted in statistically similar and C_t values consistent with those obtained with methods A to C when tested by TaqMan PCR. The developed assay, using crude template‐preparation E, allows the simple, accurate and cost‐effective testing of a large number of cyst samples and can be applied in surveys and certification schemes.     

A simple and efficient method for DNA extraction from grapevine cultivars andVitis species

A quick, simple, and reliable method for the extraction of DNA from grapevine species, hybrids, andAmpelopsis brevipedunculata (Vitaceae) has been developed. This method, based on that of Doyle and Doyle (1990), is a CTBA-based extraction procedure modified by the use of NaCl to remove polysaccharides and PVP to eliminate polyphenols during DNA purification. The method has also been used successfully for extraction of total DNA from other fruit species such as apple (Malus domestica), apricot (Prunus armeniaca), cherry (Prunus avium), peach (Prunus persica), plum (Prunus domestica), and raspberry (Rubus idaeus). DNA yield from this procedure is high (up to 1 mg/g of leaf tissue). DNA is completely digestible with restriction endonucleases and amplifiable in the polymerase chain reaction (PCR), indicating freedom from common contaminating compounds.     

Label-free and homogeneous DNA hybridization detection using gold nanoparticles-based chemiluiminescence system

We find that the catalytic activity of gold nanoparticles (GNPs) on luminol-H₂O₂ chemiluminescence (CL) system is greatly enhanced after it is aggregated by 0.5 M NaCl. We use this observation to design a CL detection of DNA hybridization. It is based on that the single- and double-stranded oligonucleotides have different propensities to adsorb on GNPs in colloidal solution, and the hybridization occurred between the probe DNA and target DNA can result in aggregation of the GNPs, producing strong CL emission. In the assay, no covalent functionalization of the GNPs, the probe, or the target DNA is required. The assay, including hybridization and detection, occurs in homogenous solution. The detection limit of target DNA (3σ) was estimated to be as low as 1.1 fM. The sensitivity was increased more than 6 orders of magnitude over that of GNPs-based colorimetric method. The present CL method for DNA hybridization detection offers the advantages of being simple, cheap, rapid and sensitive.     

Genomic DNA extraction from<Emphasis Type="Italic">Victoria amazonica</Emphasis>

DNA extraction is difficult in many plants because of metabolites that interfere with DNA isolation procedures and subsequent applications such as DNA restriction, amplification, and cloning. We developed the first reliable and efficient method for isolatingVictoria amazonica genomic DNA that is free from polysaccharides and polyphenols. This protocol uses 1.5 M NaCl, 2% polyvinylpyrrolidone (PVP) (Mr 1000), 5% mercaptoethanol, 0.12% sodium sulfite, and an incubation at 65°C for 4 h. The purity of isolated genomic DNA was confirmed by means of high-performance liquid chromatography (HPLC) profile and spectrophotometric analyses (A_260/230 ratio of 1.836, A_260/280 of 1.842). DNA was obtained in the amount of 387 μg per gram of leaf material, and it proved amenable to restriction digestion.     

Rapid isolation of fungal genomic DNA suitable for long distance PCR

A quick and reliable method for screening fungal transformants for specific genetic modifications is essential for many molecular applications. We have compared the applicability of a few rapid DNA extraction methods for Myrothecium and Aspergillus and tested the resulting DNA as to its suitability for PCR. For Myrothecium gramineum, the highest DNA concentration was obtained with the procedure described by N. Vanittanakom et al. (J Clin Microbiol 2002, 40: 1739–1742). For A. nidulans, concentrations higher than 100 ng/μl were reached with the glass bead, the LiCl, the boiling, the liquid N₂ and the protoplast-based method. Samples of M. gramineum resulting from the boiling and the liquid N₂ procedure were suitable for the amplification of fragments up to 2.3 kb. The direct use of mycelium from M. gramineum in the PCR tube can be employed for the reproducible amplification of fragments up to 1 kb. Amplification of fragments up to 4.3 kb requires the use of the Elongase Mix on samples extracted with the liquid N₂ procedure.     

Simple and efficient genomic DNA extraction protocol for molecular characterisation of Phytophthora colocasiae causing taro leaf blight

Genomic DNA extraction protocol with relatively high quantity and purity is prerequisite for the successful molecular identification and characterisation of plant pathogens. Conventional DNA extraction methods are often time-consuming and yield only very poor quantity of genomic DNA for samples with higher mycelial age. In our laboratory, we have aimed at establishing an efficient DNA isolation procedure, exclusively for the oomycete pathogen Phytophthora colocasiae causing serious leaf blight disease in taro. For this a phenol free protocol was adopted, which involves SDS/Proteinase K-based inactivation of protein contaminants, extraction of nucleic acids using chloroform: isoamyl alcohol and later precipitation of genomic DNA using isopropanol and sodium acetate. The purity of the isolated DNA was analysed by A_260/280 and A_260/230 spectrophotometric readings and confirmed by restriction digestion with restriction enzyme Eco RI. In this study, a comparative assessment was done with CTAB method and the commercial genomic DNA purification kit (Thermo Fisher Scientific, Fermentas, EU). The extracted DNA was found to be suitable for further downstream applications like ITS amplification of the rDNA ITS region and PCR amplification with species-specific primers.     

Reusable nanocopy machine particles for the replication of DNA

As one of the most important components copying DNA molecules in the PCR system, Taq DNA polymerase has a high processivity, however, lower persistence when compared to other polymerases. Studies for the enhancement of stability of Taq DNA polymerase is of great importance. The present study describes the integration of PCR application of cross‐linked Taq DNA polymerase enzyme in a nanochamber using a ruthenium based MATyr‐Ru‐(bipyr)₂)‐MATyr monomer hapten prepared by photosensitive microemulsion polymerization technique. The conjugation and cross‐linking have achieved using our previously invented Aminoacid (monomer) Decorated and Light Underpining Conjugation Approach (ANADOLUCA) method. Microemulsion polymerization media has prepared by dispersing PVA in deionized water. The nano enzyme could be easily prepared at room temperature, in daylight and under nitrogen atmosphere using ruthenium based photosensitive cross‐linking agents. The nano copy machine particles (nano Taq DNA polymerase) are very stable against more acidic or more basic conditions, high temperatures and could be reusable in PCR analysis for many times without any deformation in their structures. © 2014 American Institute of Chemical Engineers Biotechnol. Prog., 31:119–123, 2015     

GENOMIC DNA ISOLATION FROM GREEN AND BROWN ALGAE (CAULERPALES AND FUCALES) FOR MICROSATELLITE LIBRARY CONSTRUCTION1

A method for isolating high‐quality DNA is presented for the green algae Caulerpa sp. (C. racemosa, C. prolifera, and C. taxifolia) and the brown alga Sargassum muticum. These are introduced, and invasive species in Europe, except for the native C. prolifera. Previous methods of extraction, using cetyl trimethyl ammonium bromide or various commercial kits, were used to isolate genomic DNA but either no DNA or DNA of very low quality was obtained. Genomic libraries were attempted with Caulerpa sp. on three occasions and either the restriction enzyme, the Taq polymerase, or the T4 ligase was inhibited, probably by the large amount of polysaccharides in these algae. The method presented here consists of the rapid isolation of stable nuclei, followed by DNA extraction. Yields of 6–10 μ g genomic DNA from 1 g fresh blades were obtained. After genomic DNA was isolated from fresh material, the quality was checked by agarose gel. Quantification of DNA concentration was performed using UV spectrophotometric measurement of the A ₂₆₀/ A ₂₈₀ ratio. The DNA was suitable for PCR, cloning, and hybridization. The DNA isolated using this method allowed successful construction of microsatellite libraries for Caulerpa species and S. muticum . The technique is inexpensive and appropriate for the isolation of multiple samples of DNA from a small amount of fresh material.     

A method of extraction of DNA from birch

A method of DNA extraction is given which is suitable for use with birch (Betula spp.) material collected from natural populations. Such material is frequently old and insect-damaged, and contains high levels of polyphenols. The method relies on repeated extraction of the material with a high molarity urea phosphate buffer, and yields DNA suitable for RFLP analysis.     

Electrochemical synthesis of gold nanostructure modified electrode and its development in electrochemical DNA biosensor

In this article, gold nanostructure modified electrodes were achieved by a simple one-step electrodeposition method. The morphologies of modified electrodes could be easily controlled by changing the pH of HAuCl₄ solution. The novel nanoflower-like particles with the nanoplates as the building blocks could be interestingly obtained at pH 5.0. The gold nanoflower modified electrodes were then used for the fabrication of electrochemical DNA biosensor. The DNA biosensor fabrication process was characterized by cyclic voltammetry and electrochemical impedance spectroscopy with the use of ferricyanide as an electrochemical redox indicator. The DNA immobilization and hybridization on gold nanoflower modified electrode was studied with the use of [Ru(NH₃)₆]³⁺ as a hybridization indicator. The electrochemical DNA biosensor shows a good selectivity and sensitivity toward the detection of target DNA. A detection limit of 1 pM toward target DNA could be obtained.     

On the hydration of DNA. I. Preferential hydration and stability of DNA in concentrated trifluoroacetate solution

The hydration of DNA is an important factor in the stability of its secondary structure. Methods for measuring the hydration of DNA in solution and the results of various techniques are compared and discussed critically. The buoyant density of native and denatured T-7 bacteriophage DNA in potassium trifluoroacetate (KTFA) solution has been measured as a function of temperature between 5 and 50°C. The buoyant density of native DNA increased linearly with temperature, with a dependence of (2.3 ± 0.5) × 10^?4 g/cc-°C. DNA which has been heat denatured and quenched at 0°C in the salt solution shows a similar dependence of buoyant density on temperature at temperatures far below the T_m, and above the T_m. However, there is an inflection region in the buoyant density versus T curve over a wide range of temperatures below the T_m. Optical density versus temperature studies showed that this is due to the. inhibition by KTFA of recovery of secondary structure on quenching. If the partial specific volume is assumed to be the same for native and denatured DNA, the loss of water of hydration on denaturation is calculated to be about 20% in KTFA at a water activity of 0.7 at 25°C. By treating the denaturation of DNA as a phase transition, an equation has immmi derived relating the destabilizing effect of trifluoroacetate to the loss of hydration on denaturation. The hydration of native DNA is abnormally high in the presence of this anion, and the loss of hydration on denaturation is greater than in CsCl. In addition, trifluoroacetate appears to decrease the ΔHof denaturation.     

Anisotropic elastic bending models of DNA

Simplified elastic rod models of DNA were developed in which the rigidity of DNA is sequence dependent and asymmetrical, i.e. the bending is facilitated towards the major groove. By subjecting the models to bending load in various directions perpendicular to the longitudinal axis of DNA, the bending deformation and the average conformation of the models can be estimated using finite element methods. Intrinsically curved sequence motifs [(aaaattttgc)_n, (tctctaaaaaatatataaaaa)_n] are found to be curved by this modelling procedure whereas the average conformation of homopolymers and straight motifs [(a)_n, (atctaatctaacacaacaca)_n] show negligible or no curvature. This suggests that sequence dependent asymmetric rigidity of DNA can provide an explanation in itself for intrinsic DNA curvature. The average rigidity of various DNA sequences was calculated and a good correlation was found with such quantities as the free energy change upon the binding of the Cro repressor, the base stacking energy and the thermal fluctuations at room temperature.     

Evolutionary sequence divergence within repeated DNA families of higher plant genomes

The higher proportion of repeated DNA sequences in the garden pea (Pisum sativum) than in the mung bean (Vigna radiata), as well as other differences between these legume genomes, are consistent with a higher rate of sequence amplification in the former. This hypothesis leads to a prediction that repeated sequence families inPisum are mostly heterogeneous, as defined by Bendich and Anderson (1977), whileVigna families are homogeneous. An assay developed by these authors to distinguish between the two types of families, by comparison of reassociation rates at different temperatures, was utilized. The results forVigna defied the predictions of the assay for either homogeneous or hetereogeneous model. Evaluation of the kinetic data in light of the great diversity of repeated family copy numbers in both genomes enabled an interpretation of the results as consistent with hetereogenous families inPisum and homogeneous families inVigna. These tentative conclusions were supported by the results of a thermal denaturation (melting) assay described in the accompanying paper.Abbreviations used C_ot the product of molar concentration of DNA nucleotides and time of incubation (mol s/L) - EC_ot equivalent - C_ot the value after correction to standard reassociation conditions (120 mM sodium phosphate buffer, 60°C) - (Et)₄NCl tetraethylammonium chloride - T_m the temperature at which half of the nucleotides in solution are unpaired This paper is Carnegie Institution of Washington Department of Plant Biology Publication No. 708 and is based on a portion of a dissertation submitted by R.S.P. in partial fulfillment of the Ph.D. requirements at Stanford University     

A validated high-performance liquid chromatographic assay for the simultaneous determination of denaverine and its N-monodemethyl metabolite in human plasma

An isocratic reversed-phase high-performance liquid chromatographic method for the simultaneous determination of denaverine and its N-monodemethyl metabolite (MD 6) in human plasma is described. The assay involves the extraction with an n-heptane–2-propanol mixture (9:1, v/v) followed by back extraction into 12.5% (w/w) phosphoric acid. The analytes of interest and the internal standard were separated on a Superspher RP8 column using a mobile phase of acetonitrile–0.12 M NH₄H₂PO₄–tetrahydrofuran (24:17.2:1, v/v), adjusted to pH 3 with 85% (w/w) phosphoric acid. Ultraviolet detection was used at an operational wavelength of 220 nm. The retention times of MD 6, denaverine and the internal standard were 5.1, 6.3 and 10.2 min, respectively. The assay was validated according to international requirements and was found to be specific, accurate and precise with a linear range of 2.5–150 ng/ml for denaverine and MD 6. Extraction recoveries for denaverine and MD 6 ranged from 44 to 49% and from 42 to 47%, respectively. The stability of denaverine and MD 6 in plasma was demonstrated after 24 h storage at room temperature, after three freeze–thaw cycles and after 7 months frozen storage below −20°C. The stability of processed samples in the autosampler at room temperature was confirmed after 24 h storage. The analytical method has been applied to analyses of plasma samples from a pharmacokinetic study in man.     

An optimized method for the extraction of ancient eukaryote DNA from marine sediments

Marine sedimentary ancient DNA (sedaDNA) provides a powerful means to reconstruct marine palaeo‐communities across the food web. However, currently there are few optimized sedaDNA extraction protocols available to maximize the yield of small DNA fragments typical of ancient DNA (aDNA) across a broad diversity of eukaryotes. We compared seven combinations of sedaDNA extraction treatments and sequencing library preparations using marine sediments collected at a water depth of 104 m off Maria Island, Tasmania, in 2018. These seven methods contrasted frozen versus refrigerated sediment, bead‐beating induced cell lysis versus ethylenediaminetetraacetic acid (EDTA) incubation, DNA binding in silica spin columns versus in silica‐solution, diluted versus undiluted DNA in shotgun library preparations to test potential inhibition issues during amplification steps, and size‐selection of low molecular‐weight (LMW) DNA to increase the extraction efficiency of sedaDNA. Maximum efficiency was obtained from frozen sediments subjected to a combination of EDTA incubation and bead‐beating, DNA binding in silica‐solution, and undiluted DNA in shotgun libraries, across 45 marine eukaryotic taxa. We present an optimized extraction protocol integrating these steps, with an optional post‐library LMW size‐selection step to retain DNA fragments of ≤500 base pairs. We also describe a stringent bioinformatic filtering approach for metagenomic data and provide a comprehensive list of contaminants as a reference for future sedaDNA studies. The new extraction and data‐processing protocol should improve quantitative paleo‐monitoring of eukaryotes from marine sediments, as well as other studies relying on the detection of highly fragmented and degraded eukaryote DNA in sediments.     

In vitro Transcription of Kinetoplast and Nuclear DNA in Kinetoplastida*†

SYNOPSIS. DNA-dependent RNA polymerases have been solubilized from homogenates of Crithidia fasciculata using gentle extraction procedures. RNA polymerase I and II are separated on DEAE cellulose at 0.07M (NH₄)₂SO₄ and 0.13M (NH₄)₂SO₄ respectively. RNA polymerase II is inhibited 80% by α-amanitin (25 μg/ml). Both RNA polymerases require DNA as a template, ribonucleoside triphosphates and Mn²⁺. The synthesis of RNA as a product is inhibited by DNase. RNase, pronase and actinomycin D. Purified kinetoplast and nuclear DNA can serve as templates for the RNA polymerases. Denatured DNA templates are preferred. The synthesis of RNA continues for at least an hour and is inhibited by trypanocidal drugs including suramin. antrycide, acriflavine, ethidium bromide and berenil. Complementary RNA synthesized in vitro from C. fasciculata kinetoplast DNA hybridizes with C. fasciculata kinetoplast DNA but not with C. fasciculata nuclear DNA or Blastocrithidia culicis kinetoplast DNA, Escherichia coli, T4 or calf thymus DNAs. The complementary RNA synthesized in vitro from C.fasciculata kinetoplast DNA sediments at 4–5S.