Mitogenic and adjuvant activities of polysaccharides from the cellular slime mold,Dictyostelium discoideum NC-4

Cell surface and extracellular polysaccharide fractions obtained from Dictyostelium discoideum NC-4 cultured in bacteria-free medium showed strong B-cell mitogenic activities. Upon periodate treatment of the extracellular polysaccharide fraction this activity completely disappeared. The extracellular polysaccharide fraction could also enhance the antibody response in vitro against sheep red blood cells.     

Cytokinin oxidase activity in the cellular slime mold, Dictyostelium discoideum

The cytokinin N6-(delta 2-isopentenyl)adenine (i6Ade) is produced during the development of the cellular slime mold, Dictyostelium discoideum, and functions in this organism as the immediate precursor of the spore germination inhibitor, discadenine. The metabolism of i6Ade in axenic cultures of D. discoideum Ax-3 amoebae has been investigated in the present study. An enzyme activity that specifically catalyzes the degradation of i6Ade has been detected in Ax-3 amoebae. This enzyme is similar to the cytokinin oxidases present in higher plant systems and cleaves the N6-side chain of i6Ade to form adenine. Discadenine synthase activity was also detected in axenically cultured Ax-3 amoebae. The cytokinin oxidase activity detected in Dictyostelium decreased during aggregation and development of Ax-3 amoebae and in starving Ax-3 amoebae maintained under either fast-shake (230 rpm) or slow-shake (70 rpm) conditions. In the latter case, the fall in enzyme activity was accelerated by treatment with cyclic AMP. In contrast to these results, discadenine synthase activity in Ax-3 amoebae rose sharply during the culmination phase of development, exhibited little change in starving Ax-3 amoebae maintained under fast-shake conditions, and fell under slow-shake conditions unless the amoebae were treated with cyclic AMP. Possible functions of the Dictyostelium cytokinin oxidase and the significance of the i6Ade metabolism observed in vegetative Dictyostelium amoebae are discussed.     

'Ghosts' formation and their isolation from the cellular slime mold Dictyostelium discoideum.

Conditions for isolating ghosts from the cellular slime mold Dictyostelium discoideum are described. The cells were washed with a 20 mM KCl, 2.5 mM MgCl₂ solution and homogenized vigorously in 15 mM lactate buffer, pH 4.8, using a tight-fitting Dounce homogenizer. The resultant spherical ghosts were purified by the dextran-polyethylene glycol aqueous two-phase system described by Brunette &; Till [1], The proportion of ghosts which are finally purified by 3rd partition in the aqueous two-phase system is 5.6% of those present in the homogenate. As shown by phase-contrast and scanning electron microscopy, the plasma membrane fractions are almost completely uncontaminated by other identifiable subcellular components. On the basis of enzyme assays the ghosts isolated showed a 9- to 11-fold enrichment of alkaline phosphatase relative to the homogenate. They are free of succinic dehydrogenase, glucose 6-phosphatase but do contain some acid phosphatase and N-acetylglucosaminidase activity. Further purification using a sucrose-density gradient removes the residual lysosomal enzyme activities.     

Nuclear ribonucleoprotein particles in the cellular slime mold Dictyostelium discoideum

The nuclear ribonucleoprotein (RNP) particles containing rapidly labeled RNA were isolated from interphase cells of the cellular slime mold Dictyostelium discoideum and characterized. The size of the isolated RNP particles was small (10S to 50S) in comparison with that of nuclear RNP particles found in higher eukaryotes. These small RNP particles do not seem to be artifacts due to degradation during the preparation of nuclear extracts. The rapidly labeled RNA of the nuclear RNP particles was heterogeneous in size and a considerable amount contained polyadenylic acid sequences. Synthesis of RNA in the nuclear RNP particles was resistant to a relatively high concentration of actinomycin D. The protein component of the RNP particle consists of at least four proteins with molecular weights of 80,000, 66,000, 60,000, and 42,000. Thus it is suggested that almost all of the nuclear RNP particles containing rapidly labeled RNA in interphase cells are RNP complexes consisting of Heterogeneous nuclear RNA and several protein species.     

Characterization of pyrimidine metabolism in the cellular slime mold, Dictyostelium discoideum

The arginine-independent, de novo biosynthetic pathway of pyrimidines in Dictyostelium discoideum is initiated by a class II carbamoyl-phosphate synthetase (EC 6.3.5.5) specific for pyrimidine biosynthesis which utilized L-glutamine as its N donor and was partially inhibited by both UTP and CTP. The second step in the de novo pathway was provided by an unregulated aspartate transcarbamoylase (EC 2.1.3.2) which primarily appeared as a multimeric enzyme of 105 kilodaltons. The next enzyme, dihydroorotase (EC 3.5.2.3), was approximately 90-100 kilodaltons. Although the early enzymatic activities of the pyrimidine pathway appeared to reside in independent protein complexes, various unstable molecular species were observed. These structural variants may represent proteolytic fragments of a multienzyme complex. In addition to de novo synthesis, the amoeba demonstrated the capacity for salvage utilization of uracil, uridine, and cytidine. Upon starvation on a solid substratum, axenically grown amoebas began a concerted developmental program accompanied by a restructuring of nucleotide metabolism. The absolute levels of the ribonucleotide pools droppedby 98% within 30 h; however, both the adenylate energy charge and the GTP/ATP ratios were maintained for 50 h after the initiation of development. The maintenance of these metabolic energy parameters required the tight cell-cell contact necessary for development, and the capacity for pyrimidine metabolism was maintained throughout developmental morphogenesis.     

Cyclic AMP inhibits dedifferentiation in the cellular slime mold Dictyostelium discoideum

When aggregating amoebas of the cellular slime mold Dictyostelium discoideum are disaggregated and morphogenesis is reinitiated, the amoebas will reaggregate in less than $\text{1}\text{10}\text{th}$ the original time. When aggregating amoebas are disaggregated and resuspended either in full nutrient medium or in buffered salts solution containing dextrose, they retain this developmentally acquired capacity to rapidly reaggregate for approximately 1 hr and then lose it completely in a synchronous and discrete step which we have referred to as the “erasure event.” In this report, it is demonstrated that micromolar concentrations of cAMP completely block this transition from the developmental to vegetative state, and that other cyclic nucleotides also inhibit it, but they do so at 20-fold higher concentrations. Neither the hydrolysis products of cAMP nor the vegetative chemoattractant folic acid inhibit dedifferentiation at concentrations as high as 10^?3M, demonstrating a specificity for cyclic nucleotides and cAMP in particular. The addition of cAMP at any time during the lag period preceding the erasure event inhibits it and addition immediately after the erasure event reverses it. Since cAMP may inhibit the transition from the developmental to vegetative state intracellularly or extracellularly, we have also examined the intracellular concentration of cAMP and the levels of cAMP binding sites on the cell surface during the erasure process. Evidence is presented that the majority of cAMP binding sites on the cell surface are not necessary for the inhibition of erasure by cAMP. The results of these latter studies are discussed in terms of alternative models for the involvement of cAMP in the transition from the developing to vegetative state.     

The isolation of nuclei and basic nucleoproteins from the cellular slime mold Dictyostelium discoideum.

A method is described for the isolation of nuclei from an axenic strain of Dictyostelium discoideum using a sorbitol/Ficoll solution and low concentration of Triton X-100. Basic proteins have been extracted from the nuclei and on polyacrylamide gel electrophoresis yield a consistent pattern in which five major groups or bands predominate. Four of these five fractions comigrate with calf thymus histones and one fraction seems to be unique to D. discoideum. The slowest moving of the five fractions is soluble in 0.5 M perchloric acid and comigrates with calf thymus histone F1. After recovery from the perchloric acid solution by precipitation with acetone this fraction yielded one major band on electrophoresis.     

Reducing reagent-induced activation of guanylate cyclase in the cellular slime mold, Dictyostelium discoideum.

Binding of folic acid (an intrinsic agonist) to the cell surface receptors evokes transmembrane signals for activation and adaptation of guanylate cyclase in Dictyostelium discoideum. The activation signal activates this enzyme and then the adaptation signal terminates the activation. As a result, these two signals cooperatively induce a transient activation of guanylate cyclase. We investigated transmembrane signal transduction for guanylate cyclase using 2,3-dimercapto-1-propanol (BAL, a thiol-reducing reagent) since BAL induces or modifies the transmembrane signal(s). We found that BAL induced prolonged or continuous activation of guanylate cyclase. Thus, the mode of the activation is drastically different (transient versus continuous) between folic acid and BAL. We also found that the BAL-induced continuous activation was not observed when the cells were stimulated with BAL + folic acid, while folic acid + BAL transiently induced more cGMP accumulation than folic acid alone. We lastly showed that K252a, a protein kinase inhibitor, enhanced both the folic acid-induced and the BAL-induced activation of guanylate cyclase. Our results suggest that BAL induces or mimics the activation signal for guanylate cyclase. The lack of termination in the BAL-induced activation suggests that BAL does not induce the adaptation signal or that the adaptation does not inhibit the BAL-induced activation. The former possibility is more likely since folic acid suppresses the BAL-induced continuous activation. The effect of K252a suggests that protein phosphorylation plays a role in suppression of guanylate cyclase.     

Reducing reagent-induced activation of adenylate cyclase in the cellular slime mold, Dictyostelium discoideum.

Binding of an intrinsic agonist (cAMP) to specific receptors on the cell surface induces transmembrane signals for activation and desensitization (adaptation and down regulation) of adenylate cyclase in the cellular slime mold, Dictyostelium discoideum. It is generally believed that dithiothreitol (DTT) induces the activation through interaction between the receptor and gradually accumulated cAMP, since DTT is known to inhibit cAMP-phosphodiesterase which degrades cAMP. In the present paper, we investigated the mechanism of activation of adenylate cyclase by the thiol-reducing agents, DTT and 2,3-dimercapto-1-propanol (BAL). We found that BAL activated adenylate cyclase transiently even under conditions where the intrinsic agonist supersaturated the cAMP-receptors and competitively inhibited phosphodiesterase. This result is inconsistent with the generally accepted notion. We conclude that BAL has an independent effect from those of the intrinsic agonist (cAMP) and phosphodiesterase in activation of adenylate cyclase. Since BAL could induce activation just after the activation induced by a supersaturating concentration of the intrinsic agonist had ceased, the independent effect of BAL is not a simple enhancement of the cAMP-induced activation. Our result also suggests that the cAMP-induced adaptation (but not down regulation) suppresses the BAL-induced activation while BAL itself does not induce adaptation to cAMP or BAL. We propose that the thiol-reducing reagent induces or modifies the transmembrane activation signal for adenylate cyclase.     

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).