Localization of a base-paired interaction between small nuclear RNAs U4 and U6 in intact U4/U6 ribonucleoprotein particles by psoralen cross-linking

The small nuclear RNAs U4 and U6 display extensive sequence complementarity and co-exist in a single ribonucleoprotein particle. We have investigated intermolecular base-pairing between both RNAs by psoralen cross-linking, with emphasis on the native U4/U6 ribonucleoprotein complex. A mixture of small nuclear ribonucleoproteins U1 to U6 from HeLa cells, purified under non-denaturing conditions by immune affinity chromatography with antibodies specific for the trimethylguanosine cap of the small nuclear RNAs was treated with aminomethyltrioxsalen. A psoralen cross-linked U4/U6 RNA complex could be detected in denaturing polyacrylamide gels. Following digestion of the cross-linked U4/U6 RNA complex with ribonuclease T1, two-dimensional diagonal electrophoresis in denaturing polyacrylamide gels was used to isolate cross-linked fragments. These fragments were analysed by chemical sequencing methods and their positions identified within RNAs U4 and U6. Two overlapping fragments of U4 RNA, spanning positions 52 to 65, were cross-linked to one fragment of U6 RNA (positions 51 to 59). These fragments show complementarity over a contiguous stretch of eight nucleotides. From these results, we conclude that in the native U4/U6 ribonucleoprotein particle, both RNAs are base-paired via these complementary regions. The small nuclear RNAs U4 and U6 became cross-linked in the deproteinized U4/U6 RNA complex also, provided that small nuclear ribonucleoproteins were phenolized at 0 degree C. When the phenolization was performed at 65 degrees C, no cross-linking could be detected upon reincubation of the dissociated RNAs at lower temperature. These results indicate that proteins are not required to stabilize the mutual interactions between both RNAs, once they exist. They further suggest, however, that proteins may well be needed for exposing the complementary RNA regions for proper intermolecular base-pairing in the course of the assembly of the U4/U6 RNP complex from isolated RNAs. Our results are discussed also in terms of the different secondary structures that the small nuclear RNAs U4 and U6 may adopt in the U4/U6 ribonucleoprotein particle as opposed to the isolated RNAs.     

RNA induces conformational changes in the SF1/U2AF65 splicing factor complex

Spliceosomes assemble on pre-mRNA splice sites through a series of dynamic ribonucleoprotein complexes, yet the nature of the conformational changes remains unclear. Splicing factor 1 (SF1) and U2 auxiliary factor (U2AF⁶⁵) cooperatively recognize the 3′ splice site during the initial stages of pre-mRNA splicing. Here, we used small-angle X-ray scattering to compare the molecular dimensions and ab initio shape restorations of SF1 and U2AF⁶⁵ splicing factors, as well as the SF1/U2AF⁶⁵ complex in the absence and presence of AdML (adenovirus major late) splice site RNAs. The molecular dimensions of the SF1/U2AF⁶⁵/RNA complex substantially contracted by 15 Å in the maximum dimension, relative to the SF1/U2AF⁶⁵ complex in the absence of RNA ligand. In contrast, no detectable changes were observed for the isolated SF1 and U2AF⁶⁵ splicing factors or their individual complexes with RNA, although slight differences in the shapes of their molecular envelopes were apparent. We propose that the conformational changes that are induced by assembly of the SF1/U2AF⁶⁵/RNA complex serve to position the pre-mRNA splice site optimally for subsequent stages of splicing.     

A bioinformatics-based update on microRNAs and their targets in rainbow trout (Oncorhynchus mykiss)

MicroRNAs (miRNAs) participate in various vitally biological processes via controlling target genes activity and thousands of miRNAs have been identified in many species to date, including 18,698 known animal miRNA in miRBase. However, there are only limited studies reported in rainbow trout (Oncorhynchus mykiss) especially via the computational-based approaches. In present study, we systematically investigated the miRNAs in rainbow trout using a well-developed comparative genome-based homologue search. A total of 196 potential miRNAs, belonging to 124 miRNA families, were identified, most of which were firstly reported in rainbow trout. The length of miRNAs ranged from 17 to 24 nt with an average of 20 nt while the length of their precursors varied from 47 to 152 nt with an average of 85 nt. The identified miRNAs were not evenly distributed in each miRNA family, with only one member per family for a majority, and multiple members were also identified for several families. Nucleotide U was dominant in the pre-miRNAs with a percentage of 30.04%. The rainbow trout pre-miRNAs had relatively high negative minimal folding free energy (MFE) and adjusted MFE (AMFE). Not only the mature miRNAs but their precursor sequences are conserved among the living organisms. About 2466 O. mykiss genes were predicted as potential targets for 189 miRNAs. Gene Ontology (GO) analysis showed that nearly 2093, 2107, and 2081 target genes are involved in cellular component, molecular function, and biological processes respectively. KEGG pathway enrichment analysis illuminated that these miRNAs targets might regulate 105 metabolic pathways, including those of purine metabolism, nitrogen metabolism, and oxidative phosphorylation. This study has provided an update on rainbow trout miRNAs and their targets, which represents a foundation for future studies.     

Identification and characterization of complement factor H in Branchiostoma belcheri

Complement factor H (CFH) is an essential regulator of the complement system and plays very important roles in animal innate immunity. Although the complement system of amphioxus has been extensively studied, the expression in amphioxus and evolution of CFH gene remain unknown. In this study, we identified and characterized an amphioxus (Branchiostoma belcheri) CFH gene (designated as AmphiCFH). Our results showed that the full-length cDNA of AmphiCFH gene consists of 1295 bp nucleotides containing an 855 bp open reading frame (ORF) that was predicted to encode a 284 amino acid protein. The putative AmphiCFH protein possessed the characteristic of the CFH protein family, including typical CCP (complement control protein) domain. Real-time PCR analysis showed that the AmphiCFH was ubiquitously and differentially expressed in five investigated tissues (intestine, gills, notochord, muscles, and hepatic cecum). The expression level of the AmphiCFH gene was induced upon lipopolysaccharide stimulation, indicating that the AmphiCFH gene might be involved in innate immunity. In addition, phylogenetic analysis showed that the AmphiCFH gene was located between that of invertebrates and vertebrates, suggesting that the AmphiCFH gene is a member of the CFH gene family. In conclusion, our findings provided an insight into animal innate immunity and evolution of the CFH gene family.     

Identification of differentially expressed genes in hepatopancreas of oriental river prawn, Macrobrachium nipponense exposed to environmental hypoxia

Hypoxia represents a major physiological challenge for prawn culture, and the hepatopancreas plays an important role in these processes. Here, we applied high-throughput sequencing technology to detect the gene expression profile of the hepatopancreas in Macrobrachium nipponense in response to hypoxia for 3 h and hypoxia for 24 h. Gene expression profiling identified 1925 genes that were significantly up- or down-regulated by dissolved oxygen availability. Functional categorization of the differentially expressed genes revealed that oxygen transport, electron transport chain, reactive oxygen species generation/scavenging, and immune response were the differentially regulated processes occurring during environmental hypoxia. Finally, quantitative real-time polymerase chain reaction using six genes independently verified the tag-mapped results. Immunohistochemistry analysis revealed, for the first time, hemocyanin protein expression as significant hypoxia-specific signature in prawns, which opens the way for in depth molecular studies of hypoxia exposure. The analysis of changes in hepatic gene expression in oriental river prawn provides a preliminary basis for a better understanding of the molecular response to hypoxia exposures.     

Identification of a Bombyx mori gene encoding small heat shock protein BmHsp27.4 expressed in response to high-temperature stress

Elucidating the mechanisms underlying the response and resistance to high-temperature stress in the Lepidoptera is essential for understanding the effect of high-temperature on the regulation of gene expression. A tag (CATGAACGTGAAGAGATTCAG) matching the predicted gene BGIBMGA005823-TA in SilkDB identified the most significant response to high-temperature stress in a screen of the heat-treated digital gene expression library of Bombyx mori (B. mori) (Unpublished data). BLAST and RACE showed that the gene is located on chromosome 5 and has an open reading frame (ORF) of 741 bp. Phylogenetic analysis found that B. mori small heat shock protein 27.4 (BmHSP27.4) is in an evolutionary branch separate from other small heat shock proteins. Expression analysis showed that BmHsp27.4 is highly expressed in brain, eyes and fat bodies in B. mori. Its mRNA level was elevated at high-temperature and this increase was greater in females. The ORF without the signal peptide sequence was cloned into vector pET-28a(+), transformed and over-expressed in Escherichia coli Rosetta (DE3). Western blotting and immunofluorescence analysis with a polyclonal antibody, confirmed that the level of protein BmHSP27.4 increased at a high-temperature, in accordance with its increased mRNA level. In this study, BmHsp27.4 was identified as a novel B. mori gene with an important role in response to high-temperature stress.     

Pepsin-like aspartic protease (Sc-ASP155) cloning,molecular characterization and gene expression analysis in developmental stages of nematode Steinernema carpocapsae

Steinernema carpocapsae is an insect parasitic nematode associated with the bacterium Xenorhabdus nematophila. These symbiotic complexes are virulent against the insect host. Many protease genes were shown previously to be induced during parasitism, including one predicted to encode an aspartic protease, which was cloned and analyzed in this study. A cDNA encoding Sc-ASP155 was cloned based on the EST fragment. The full-length cDNA of Sc-ASP155 consists of 955 nucleotides with multiple domains, including a signal peptide (aa1–15), a pro-peptide region (aa16–45), and a typical catalytic aspartic domain (aa71–230). The putative 230 amino acid residues have a calculated molecular mass of 23,812 Da and a theoretical pI of 5.01. Sc-ASP155 blastp analysis showed 40–62% amino acid sequence identity to aspartic proteases from parasitic and free-living nematodes. Expression analysis showed that the sc-asp155 gene was up-regulated during the initial parasitic stage, especially in L3 gut and 6 h induced nematodes. Sequence comparison revealed that Sc-ASP155 was a member of an aspartic protease family and phylogenetic analysis indicated that Sc-ASP155 was clustered with Sc-ASP113. In situ hybridization showed that sc-asp155 was expressed in subventral cells. Additionally, we determined that sc-asp155 is a single-copy gene in S. carpocapsae. Homology modeling showed that Sc-ASP155 adopts a typical aspartic protease structure. The up-regulated Sc-ASP155 expression revealed that this protease could play a role in the parasitic process. In this study, we have cloned the gene and determined the expression of the pepsin-like aspartic protease Sc-ASP155 in S. carpocapsae.     

The evolution and functional divergence of the beta-carotene oxygenase gene family in teleost fish—Exemplified by Atlantic salmon

In mammals, two carotenoid cleaving oxygenases are known; beta-carotene 15,15′-monooxygenase (BCMO1) and beta-carotene 9′,10′-oxygenase (BCO2). BCMO1 is a key enzyme in vitamin A synthesis by symmetrically cleaving beta-carotene into 2 molecules of all-trans-retinal, while BCO2 is responsible for asymmetric cleavage of a broader range of carotenoids. Here, we show that the Atlantic salmon beta-carotene oxygenase (bco) gene family contains 5 members, three bco2 and two bcmo1 paralogs. Using public sequence databases, multiple bco genes were also found in several additional teleost species. Phylogenetic analysis indicates that bco2a and bco2b originate from the teleost fish specific genome duplication (FSGD or 3R), while the third and more distant paralog, bco2 like, might stem from a prior duplication event in the teleost lineage. The two bcmo1 paralogs (bcmo1 and bcmo1 like) appear to be the result of an ancient duplication event that took place before the divergence of ray-finned (Actinopterygii) and lobe-finned fish (Sarcopterygii), with subsequent nonfunctionalization and loss of one Sarcopterygii paralog. Gene expression analysis of the bcmo1 and bco2 paralogs in Atlantic salmon reveals regulatory divergence with tissue specific expression profiles, suggesting that the beta-carotene oxygenase subtypes have evolved functional divergences. We suggest that teleost fish have evolved and maintained an extended repertoire of beta-carotene oxygenases compared to the investigated Sarcopterygii species, and hypothesize that the main driver behind this functional divergence is the exposure to a diverse set of carotenoids in the aquatic environment.     

Partial venom gland transcriptome of a Drosophila parasitoid wasp, Leptopilina heterotoma, reveals novel and shared bioactive profiles with stinging Hymenoptera

Analysis of natural host-parasite relationships reveals the evolutionary forces that shape the delicate and unique specificity characteristic of such interactions. The accessory long gland-reservoir complex of the wasp Leptopilina heterotoma (Figitidae) produces venom with virus-like particles. Upon delivery, venom components delay host larval development and completely block host immune responses. The host range of this Drosophila endoparasitoid notably includes the highly-studied model organism, Drosophila melanogaster. Categorization of 827 unigenes, using similarity as an indicator of putative homology, reveals that approximately 25% are novel or classified as hypothetical proteins. Most of the remaining unigenes are related to processes involved in signaling, cell cycle, and cell physiology including detoxification, protein biogenesis, and hormone production. Analysis of L. heterotoma's predicted venom gland proteins demonstrates conservation among endo- and ectoparasitoids within the Apocrita (e.g., this wasp and the jewel wasp Nasonia vitripennis) and stinging aculeates (e.g., the honey bee and ants). Enzyme and KEGG pathway profiling predicts that kinases, esterases, and hydrolases may contribute to venom activity in this unique wasp. To our knowledge, this investigation is among the first functional genomic studies for a natural parasitic wasp of Drosophila. Our findings will help explain how L. heterotoma shuts down its hosts' immunity and shed light on the molecular basis of a natural arms race between these insects.