Identification of a Bombyx mori gene encoding small heat shock protein BmHsp27.4 expressed in response to high-temperature stress

Elucidating the mechanisms underlying the response and resistance to high-temperature stress in the Lepidoptera is essential for understanding the effect of high-temperature on the regulation of gene expression. A tag (CATGAACGTGAAGAGATTCAG) matching the predicted gene BGIBMGA005823-TA in SilkDB identified the most significant response to high-temperature stress in a screen of the heat-treated digital gene expression library of Bombyx mori (B. mori) (Unpublished data). BLAST and RACE showed that the gene is located on chromosome 5 and has an open reading frame (ORF) of 741 bp. Phylogenetic analysis found that B. mori small heat shock protein 27.4 (BmHSP27.4) is in an evolutionary branch separate from other small heat shock proteins. Expression analysis showed that BmHsp27.4 is highly expressed in brain, eyes and fat bodies in B. mori. Its mRNA level was elevated at high-temperature and this increase was greater in females. The ORF without the signal peptide sequence was cloned into vector pET-28a(+), transformed and over-expressed in Escherichia coli Rosetta (DE3). Western blotting and immunofluorescence analysis with a polyclonal antibody, confirmed that the level of protein BmHSP27.4 increased at a high-temperature, in accordance with its increased mRNA level. In this study, BmHsp27.4 was identified as a novel B. mori gene with an important role in response to high-temperature stress.     

Testicular gene expression in male mice divergent for fertility after heat stress

Fertility losses in male mice occur approximately 18-28 d after heat stress. The objective of this study was to identify gene expression differences in males highly versus lowly fertile after heat stress. Mature male mice were exposed to heat stress (35 ± 1 °C; n = 50) or thermoneutral (21 ± 1 °C; n = 10) conditions for 24 h (Day 0) and hemicastrated (Day 1) to collect tissue for gene expression analyses. Males were subjected to a mating test from Days 18 to 26 when variation in fertility was anticipated. A fertility index was used to rank heat-stressed males and identify those males resistant and susceptible to heat stress, respectively. Microarray analyses were conducted on testis tissues from control (n = 5), heat stress resistant (n = 5), and heat stress susceptible (n = 5) males, and 225 genes were observed to be differentially expressed (P < 0.05), including genes involved in chaperone (Canx, Hspcb1, and Tcp1) and catalytic (Fkpb6, Psma7, and Idh1) activity. Expression patterns of these genes were confirmed using real-time RT-PCR. Male progeny from selected sires were similarly divergent in fertility after heat stress. Testicular expression levels of Canx, Hspcb, and Tcp1 genes were determined in these progeny. Hspcb expression was moderately heritable (0.31 ± 0.25); however, expression patterns of Canx and Tcp1 were not heritable.     

Exploring the molecular mechanism of acute heat stress exposure in broiler chickens using gene expression profiling

The process of heat regulation is complex and its exact molecular mechanism is not fully understood. In this study, to investigate the global gene regulation response to acute heat exposure, gene microarrays were exploited to analyze the effects of heat stress on three tissues (brain, liver, leg muscle) of the yellow broiler chicken (Gallus gallus). We detected 166 differentially expressed genes (DEGs) in the brain, 219 in the leg muscle and 317 in the liver. Six of these genes were differentially expressed in all three tissues and were validated by qRT-PCR, and included heat shock protein genes (HSPH1, HSP25), apoptosis-related genes (RB1CC1, BAG3), a cell proliferation and differentiation-related gene (ID1) and the hunger and energy metabolism related gene (PDK). All these genes might be important factors in chickens suffering from heat stress. We constructed gene co-expression networks using the DEGs of the brain, leg muscle and liver and two, four and two gene co-expression modules were identified in these tissues, respectively. Functional enrichment of these gene modules revealed that various functional clusters were related to the effects of heat stress, including those for cytoskeleton, extracellular space, ion binding and energy metabolism. We concluded that these genes and functional clusters might be important factors in chickens under acute heat stress. Further in-depth research on the newly discovered heat-related genes and functional clusters is required to fully understand their molecular functions in thermoregulation.     

Transcriptional profiling of mouse liver in response to chronic heat stress

Mice were used to study the effects of chronic heat stress on hepatic gene expression. Twenty-five mice were allocated to either chronic heat stress (34 °C) or control (24 °C) conditions for a period of 2 weeks from 47 to 60 d of age. Nineteen genes differentially expressed in liver were identified using DNA microarrays. Genes involved in the anti-oxidant pathway and metabolism were up-regulated. Genes involved in generation of reactive oxygen radicals and mitochondrial expressed genes were down-regulated. Enzyme activity measurements confirmed the array results. Mice exposed to chronic heat stress showed signs of increased oxidative stress in liver cells.     

Effects of cis and trans regulatory variations on the expression divergence of heat shock response genes between yeast strains

Phenotypic variation among individuals in a population can be due to DNA sequence variation in protein coding regions or in regulatory elements. Recently, many studies have indicated that mutations in regulatory elements may be the major cause of phenotypic evolution. However, the mechanisms for evolutionary changes in gene expression are still not well understood. Here, we studied the relative roles of cis and trans regulatory changes in Saccharomyces cerevisiae cells to cope with heat stress. It has been found that the expression level of ~ 300 genes was induced at least two fold and that of ~ 500 genes was repressed at least two fold in response to heat shock. From the former set of genes, we randomly selected 65 genes that showed polymorphism(s) between the BY and RM strains for pyrosequencing analysis to explore the relative contributions of cis and trans regulatory variations to the expression divergence between BY and RM. Our data indicated that the expression divergence between BY and RM was mainly due to trans regulatory variations under either the normal condition or the heat stress condition. However, the relative contribution of trans regulatory variation was decreased from 76.9% to 61.5% after the heat shock stress. These results indicated that the cis regulatory variation may play an important role in the adaption to heat stress. In our data, 43.1% (28 genes) of the 65 genes showed the same trend of cis or trans variation effect after the heat shock stress, 35.4% (23 genes) showed an increased cis variation effect and 21.5% (14 genes) showed an increased trans variation effect after the heat shock stress. Thus, our data give insights into the relative roles of cis and trans variations in response to heat shock in yeast.