Characterization and identification of the integrin family in silkworm, Bombyx mori

As an important economic insect, Bombyx mori is also a useful model organism for lepidopteran insect. Integrins are evolutionarily conserved from sponges to humans, and play vital roles in many physiological and pathological processes. To explore their diverse functions of integrins in insect, eleven integrins including six α and five β subunits were cloned and characterized from silkworm. Our results showed that integrins from silkworm own more family members compared to other invertebrates. Among those α subunits, integrins α1, α2, and the other four subunits belong to PS1, PS2, and PS3 groups, respectively. The β subunits mainly gather in the insect βν group except the β1 subunit which belongs to the insect β group. Expression profiles demonstrated that the integrins exhibited distinct patterns, but were mainly expressed in hemocytes. α1 and β2 subunits are the predominant ones either in the embryogenesis or larva stages. Interestingly, integrins were significantly up-regulated after stimulated by 20-hydroxyecdysone (20-E) in vivo. These results indicate that integrins perform diverse functions in hemocytes of silkworm. Overall, our results provide a new insight into the functional and evolutionary features of integrins.     

BmICE-2 is a novel pro-apoptotic caspase involved in apoptosis in the silkworm, Bombyx mori

In this study we identified a potential pro-apoptotic caspase gene, Bombyx mori(B. mori)ICE-2 (BmICE-2) which encoded a polypeptide of 284 amino acid residues, including a ¹⁶⁹QACRG¹⁷³ sequence which surrounded the catalytic site and contained a p20 and a p10 domain. BmICE-2 expressed in Escherichia coli (E. coli) exhibited high proteolytic activity for the synthetic human initiator caspase-9 substrates Ac-LEHD-pNA, but little activity towards the effector caspase-3 substrates Ac-DEVD-pNA. When BmICE-2 was transiently expressed in BmN-SWU1 silkworm B. mori cells, we found that the high proteolytic activity for Ac-LEHD-pNA triggered caspase-3-like protease activity resulting in spontaneous cleavage and apoptosis in these cells. This effect was not replicated in Spodoptera frugiperda 9 cells. In addition, spontaneous cleavage of endogenous BmICE-2 in BmN-SWU1 cells could be induced by actinomycin D. These results suggest that BmICE-2 may be a novel pro-apoptotic gene with caspase-9 activity which is involved apoptotic processes in BmN-SWU1 silkworm B. mori cells.     

Establishment and characterization of an ovarian cell line of the silkworm, Bombyx mori

A cell line BmN-SWU1 was established from the ovarian tissues of 3-day-old fourth instar Bombyx mori larvae of the 21-872nlw variety by performing primary cultures in Grace's medium supplemented with 20% fetal bovine serum (FBS). The cell line primarily consisted of short spindle cells and round cells. The frequency of cells with chromosome number 2n = 56 was 80.5%; therefore, the cell line was considered to be a diploid cell line. The population-doubling time (PDT) at 45th passage line was 57.7 h. This cell line was susceptible to the B. mori nuclear polyhedrovirus (BmNPV), and the median tissue culture infective dose (TCID₅₀) at a cell density of 10⁵ cells/ml was 16.3 OBs/ml. The transient expression efficiency of the green fluorescent protein (GFP) gene in this cell line was 54.8%. We used the BmN-SWU1 cell line to select and establish a GFP transgenic cell line.     

Characterization of a novel chromodomain-containing gene from the silkworm, Bombyx mori

Heterochromatin protein 1 (HP1) is an evolutionarily conserved protein across different eukaryotic species, and is crucial in the establishment and maintenance of heterochromatin. HP1 proteins have two distinct functional domains, an N-terminal chromodomain (CD) and a C-terminal chromoshadow domain (CSD), which are required for the selective binding of HP1 proteins to modified histones. During our screen for HP1-like proteins in the Bombyx mori genome, we found a novel silkworm gene, Bombyx mori chromodomain protein 1 (BmCdp1), encoding a putative chromobox protein with only two CDs. The BmCdp1 family proteins are closely related to the HP1 proteins, and most of them belong to insect lineages. qRT-PCR analysis indicated that BmCdp1 mRNA was most abundantly expressed in early embryos, and relatively higher expression was observed in larval testes, hemocytes, and pupal ovaries. Western blot and immunostaining experiments showed that BmCdp1 was localized mainly in the nucleus of BmN4 cells. We searched BmCdp1-bound loci in the Bombyx genome by ChIP-seq analysis using Flag-tagged BmCdp1-expressing BmN4 cells. Combined with ChIP-qPCR experiments, we identified two reliable BmCdp1-bound loci in the genome. siRNA-mediated knockdown of BmCdp1 in BmN4 cells and early embryos did not affect the expression of the gene located close to the BmCdp1-bound locus.     

Expression analysis and tissue distribution of two 14-3-3 proteins in silkworm (Bombyx mori)

14-3-3 proteins, which have been identified in a wide variety of eukaryotes, are highly conserved acidic proteins. In this study, we identified two genes in silkworm that encode 14-3-3 proteins (Bm14-3-3ζ and Bm14-3-3ε). Category of two 14-3-3 proteins was identified according to phylogenetic analysis. Bm14-3-3ζ shared 90% identity with that in Drosophila, while Bm14-3-3ε shared 86% identity with that in Drosophila. According to Western blot and real time PCR analysis, the Bm14-3-3ζ expression levels are higher than Bm14-3-3ε in seven tissues and in four silkworm developmental stages examined. Bm14-3-3ζ was expressed during every stage of silkworm and in every tissue of the fifth instar larvae that was examined, but Bm14-3-3ε expression was not detected in eggs or heads of the fifth instar larvae. Both 14-3-3 proteins were highly expressed in silk glands. These results suggest that Bm14-3-3ζ expression is universal and continuous, while Bm14-3-3ε expression is tissue and stage-specific. Based on tissue expression patterns and the known functions of 14-3-3 proteins, it may be that both 14-3-3 proteins are involved in the regulation of gene expression in silkworm silk glands.     

Temporal organization of endocrine events underlying larval-pupal metamorphosis in the silkworm, Bombyx mori

The temporal organization of endocrine events underlying larval-pupal moult was examined. After the phagoperiod of 6–7 days, the last instar larvae of Bombyx mori purged the gut contents and then pupated 4–5 days thereafter. Juvenile hormone titer was considerably high on the first day of the fifth instar, but declined to an undetectable level on day 3. Release of prothoracicotropic hormone (PTTH) began after the decline in the junvile hormone titer and completed during the night of day 4. Prothoracic glands began to secrete ecdysone on day 5. Larvae could pupate on schedule if their brains were removed after the PTTH release. One time of PTTH release during the feeding stage could satisfy the requirement for pupation occuring on schedule. The phagoperiod could be shortened by allatectomy early in the fifth instar and prolonged by the injection of a certain dose of juvenile hormone analogue before the gated PTTH release, accounting for the role of juvenile hormone in the timing of PTTH release.     

A homeotic mutation influences the wing vibration patterns during mating in males of the silkworm moth Bombyx mori

An abnormality in the wing vibration pattern in males of the E^Nc homeotic mutant of Bombyx mori was investigated. The wild-type (+/+) males show a switching of the rhythmic wing vibrations from a sequential pattern to an intermittent pattern during mating, whereas the E^Nc mutants show a sequential pattern both before and during mating. Wing motions in +/+ males became small during mating, but those in +/E^Nc males did not. Ablation of the head ganglia of +/+ and +/E^Nc males during mating caused no change in the motor patterns of wing vibrations. Ablation or cooling of the posterior abdomen in the +/+ males during mating caused sequential wing vibrations, suggesting that the change in wing vibrations is induced by signals from the posterior abdomen. The pterothoracic ganglion in the +/E^Nc males is separated into two ganglia, in contrast to the complete ganglionic fusion in the +/+ males. The neurons in the pterothoracic ganglion stained from abdominal nerve cords are homologus in +/+ and +/E^Nc males, but many of these in +/E^Nc males are elongated along the anteroposterior axis. These results suggest that the wing vibration pattern is restricted by genetic factors through reconstruction of the thoracic nervous system during metamorphosis.     

Fat body catalase activity as a biochemical index for the recognition of thermotolerant breeds of mulberry silkworm, Bombyx mori L.

The fifth instar larvae of the silkworm Bombyx mori L. were exposed to selected high temperatures (35 and 40 °C) in order to understand the changes in the level of catalase activity in the three tissues of fat body, midgut and haemolymph of the five selected bivoltine breeds and their 9 quantitative traits, namely larval weight, cocoon weight, shell weight, shell ratio, filament length, filament weight, denier, renditta and effective rearing rate (ERR), also the correlation between them under high temperature conditions were examined. Catalase activity resulting in fat body revealed a positive correlation between the control (28±1 °C) and 40±1 °C. The CSR₂ breed showed the most level of thermotolerance and catalase activity, compared with the CSR₄, JROP, NB₄D₂ and KA breeds. It was found that the level of catalase activity in fat body may be a reliable biochemical index to recognize thermotolerant breeds in order to develop resistant hybrids for tropical areas.     

Molecular cloning,characterization and expression analysis of ATG1 in the silkworm, Bombyx mori

Atg1 is a Serine/Threonine protein kinase that plays a pivotal role in autophagy. A complete coding sequence of ATG1 is not available for the silkworm, Bombyx mori which is a good model for studying the autophagic process.     

Role of Bmbuffy in hydroxycamptothecine-induced apoptosis in BmN-SWU1 cells of the silkworm, Bombyx mori

Bcl-2 family proteins have been reported previously to play important roles in the mitochondrial apoptotic pathway. Particularly, Bmbuffy has been identified as a key homologue of Bcl-2 in silkworm; however, its exact function is unknown. In this study, we investigated the role of Bmbuffy in hydroxycamptothecine (HCPT)-induced apoptosis of BmN-SWU1 cells. By conducting confocal microscopy studies, we found that Bmbuffy is located on the outer membrane of mitochondria and endoplasmic reticulum (ER). Furthermore, we discovered that the hydrophobic transmembrane domain at the COOH terminus is a putative anchor for the subcellular localization of Bmbuffy. Overexpression of Bmbuffy inhibited cytochrome c release, activation of caspase-3 and cell apoptosis, while RNAi-mediated silencing of Bmbuffy promoted apoptosis. In the absence of a hydrophobic membrane anchor, we revealed that Bmbuffy is unable to block apoptosis. These results indicate that Bmbuffy acts as an anti-apoptotic protein, located on the mitochondrial outer membrane and is involved in the mitochondrial apoptotic pathway. Moreover, in HCPT-induced apoptosis, we showed that the translocation of endogenous Bmp53 from the nucleus to the mitochondria is a slow and progressive process, followed by cytochrome c release. This suggests that mitochondrial Bmp53 accumulation may contribute to membrane permeability. The co-localization of Bmp53 and Bmbuffy suggests the interaction of the two proteins, which was further confirmed by Co-IP assay. In addition, overexpression of Bmp53 increased cytochrome c release and the cell apoptotic rate, whereas Bmbuffy overexpression blocked these. All the data suggest that Bmbuffy functions as an anti-apoptotic protein and interacts with Bmp53 in HCPT-induced apoptosis of silkworm cells.     

Carbohydrate metabolism and restricted oxygen supply in the eggs of the silkworm, Bombyx mori

Increased oxygen supply to diapause eggs of the silkworm (O₂-incubation) effectively prevented diapause initiation and induced the same pattern of glycogen, polyol and lactate levels as was observed in normal non-diapause eggs. Sensitivity to oxygen decreased as embryonic development proceeded. After the termination of this sensitive period, accumulation of polyols and lactate followed.Experiments were carried out to test whether changes in the oxygen permeability of the egg membranes are involved in restricting the supply of this gas to eggs at the onset of diapause. Oxygen permeability of the chorion was measured with apparatus especially designed for this purpose. Although the chorion of the diapause egg was less permeable than that of the non-diapause egg, the oxygen permeability of the chorion does not change appreciably during the early developmental stages of the diapause eggs. The changes in rate of water loss through the egg membranes were measured during the early developmental stages of the embryos. The level of water loss decreased gradually as the formation of serosal cuticle proceeded. Moreover, it was observed that the water loss up to the time of formation of serosal cuticle was closely related to the oxygen permeability of the chorion.From these results, we suggest that the formation of the serosal cuticle may be an additional cause of the restricted oxygen supply at the onset of the diapause.     

Differentially expressed genes in the ovary of the sixth day of pupal “Ming” lethal egg mutant of silkworm, Bombyx mori

The “Ming” lethal egg mutant (l-e^m) is a vitelline membrane mutant in silkworm, Bombyx mori. The eggs laid by the l-e^m mutant lose water, ultimately causing death within an hour. Previous studies have shown that the deletion of BmEP80 is responsible for the l-e^m mutation in silkworm, B. mori. In the current study, digital gene expression (DGE) was performed to investigate the difference of gene expression in ovaries between wild type and l-e^m mutant on the sixth day of the pupal stage to obtain a global view of gene expression profiles using the ovaries of three l-e^m mutants and three wild types. The results showed a total of 3,463,495 and 3,607,936 clean tags in the wild type and the l-e^m mutant libraries, respectively. Compared with those of wild type, 239 differentially expressed genes were detected in the l-e^m mutant, wherein 181 genes are up-regulated and 58 genes are down-regulated in the mutant strain. The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis results showed that no pathway was significantly enriched and three pathways are tightly related to protein synthesis among the five leading pathways. Moreover, the expression profiles of eight important differentially expressed genes related to oogenesis changed. These results provide a comprehensive gene expression analysis of oogenesis and vitellogenesis in B. mori which facilitates understanding of both the specific molecular mechanism of the 1-e^m mutant and Lepidopteran oogenesis in general.     

Proteomic analysis of nucleopolyhedrovirus infection resistance in the silkworm, Bombyx mori (Lepidoptera: Bombycidae)

Silkworm hemolymph is an important defense tissue to resist bacteria and virus infections. To study the response of silkworm hemolymph in the resistance of Bombyx mori L. nucleopolyhedrovirus (BmNPV), we constructed a near-isogenic silkworm line with BmNPV resistance using highly resistant and highly susceptible parental strains. In this paper, two-dimensional gel electrophoresis (2-DE) and Matrix-Assisted Laser Desorption/Ionization (MALDI)-mass spectrometry were employed to investigate the differences of protein patterns in the hemolymph of the highly resistant, highly susceptible and near-isogenic silkworm strains after BmNPV was administrated to the larvae. A comparison between the proteomes of these three silkworm strains led us to identify two differentially expressed proteins, beta-N-acetylglucosaminidase 2 and aminoacylase. The expression levels of these proteins were higher in the BmNPV resistant strains.     

Identification of a Bombyx mori gene encoding small heat shock protein BmHsp27.4 expressed in response to high-temperature stress

Elucidating the mechanisms underlying the response and resistance to high-temperature stress in the Lepidoptera is essential for understanding the effect of high-temperature on the regulation of gene expression. A tag (CATGAACGTGAAGAGATTCAG) matching the predicted gene BGIBMGA005823-TA in SilkDB identified the most significant response to high-temperature stress in a screen of the heat-treated digital gene expression library of Bombyx mori (B. mori) (Unpublished data). BLAST and RACE showed that the gene is located on chromosome 5 and has an open reading frame (ORF) of 741 bp. Phylogenetic analysis found that B. mori small heat shock protein 27.4 (BmHSP27.4) is in an evolutionary branch separate from other small heat shock proteins. Expression analysis showed that BmHsp27.4 is highly expressed in brain, eyes and fat bodies in B. mori. Its mRNA level was elevated at high-temperature and this increase was greater in females. The ORF without the signal peptide sequence was cloned into vector pET-28a(+), transformed and over-expressed in Escherichia coli Rosetta (DE3). Western blotting and immunofluorescence analysis with a polyclonal antibody, confirmed that the level of protein BmHSP27.4 increased at a high-temperature, in accordance with its increased mRNA level. In this study, BmHsp27.4 was identified as a novel B. mori gene with an important role in response to high-temperature stress.