Genome-wide validation of Magnaporthe grisea gene structures based on transcription evidence

Accurate cDNA data is useful to validate gene structures in a genome. We sequenced 35 189 expressed sequence tags (ESTs) obtained from the highly destructive rice blast fungus, Magnaporthe grisea. Our custom-made computational programs mapped these ESTs on the M. grisea genome sequence, and reconstructed gene structures as well as protein-coding regions. As a result, we predicted 4480 protein-coding sequences, which were more accurate than ab initio predictions. Moreover, cross-species comparisons suggested that our predicted proteins were nearly complete. The cDNA clones obtained in this study will be important for further experimental studies. Our genome annotation is available at http://www.mg.dna.affrc.go.jp/.     

Characterization of a novel chromodomain-containing gene from the silkworm, Bombyx mori

Heterochromatin protein 1 (HP1) is an evolutionarily conserved protein across different eukaryotic species, and is crucial in the establishment and maintenance of heterochromatin. HP1 proteins have two distinct functional domains, an N-terminal chromodomain (CD) and a C-terminal chromoshadow domain (CSD), which are required for the selective binding of HP1 proteins to modified histones. During our screen for HP1-like proteins in the Bombyx mori genome, we found a novel silkworm gene, Bombyx mori chromodomain protein 1 (BmCdp1), encoding a putative chromobox protein with only two CDs. The BmCdp1 family proteins are closely related to the HP1 proteins, and most of them belong to insect lineages. qRT-PCR analysis indicated that BmCdp1 mRNA was most abundantly expressed in early embryos, and relatively higher expression was observed in larval testes, hemocytes, and pupal ovaries. Western blot and immunostaining experiments showed that BmCdp1 was localized mainly in the nucleus of BmN4 cells. We searched BmCdp1-bound loci in the Bombyx genome by ChIP-seq analysis using Flag-tagged BmCdp1-expressing BmN4 cells. Combined with ChIP-qPCR experiments, we identified two reliable BmCdp1-bound loci in the genome. siRNA-mediated knockdown of BmCdp1 in BmN4 cells and early embryos did not affect the expression of the gene located close to the BmCdp1-bound locus.     

Establishment and characterization of an ovarian cell line of the silkworm, Bombyx mori

A cell line BmN-SWU1 was established from the ovarian tissues of 3-day-old fourth instar Bombyx mori larvae of the 21-872nlw variety by performing primary cultures in Grace's medium supplemented with 20% fetal bovine serum (FBS). The cell line primarily consisted of short spindle cells and round cells. The frequency of cells with chromosome number 2n = 56 was 80.5%; therefore, the cell line was considered to be a diploid cell line. The population-doubling time (PDT) at 45th passage line was 57.7 h. This cell line was susceptible to the B. mori nuclear polyhedrovirus (BmNPV), and the median tissue culture infective dose (TCID₅₀) at a cell density of 10⁵ cells/ml was 16.3 OBs/ml. The transient expression efficiency of the green fluorescent protein (GFP) gene in this cell line was 54.8%. We used the BmN-SWU1 cell line to select and establish a GFP transgenic cell line.     

Expression pattern of immunoglobulin superfamily members in the silkworm, Bombyx mori

Immunoglobulin superfamily (IgSF) proteins are involved in cell adhesion, cell communication and immune functions. In this study, 152 IgSF genes containing at least one immunoglobulin (Ig) domain were predicted in the Bombyx mori silkworm genome. Of these, 145 were distributed on 25 chromosomes with no genes on chromosomes 16, 18 and 26. Multiple sequence alignments and phylogenetic evolution analysis indicated that IgSFs evolved rapidly. Gene ontology (GO) annotation indicated that IgSF members functioned as cellular components and in molecular functions and biological processes. Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis suggested that IgSF proteins were involved in signal transduction, signaling molecules and interaction, and cell communication. Microarray-based expression data showed tissue expression for 136 genes in anterior silkgland, middle silkgland, posterior silkgland, testis, ovary, fat body, midgut, integument, hemocyte, malpighian tubule and head. Expression pattern of IgSF genes in the silkworm ovary and midgut was analyzed by RNA-Seq. Expression of 105 genes was detected in the ovary in strain Dazao. Expression in the midgut was detected for 74 genes in strain Lan5 and 75 genes in strain Ou17. Expression of 34 IgSF genes in the midgut relative to the actin A3 gene was significantly different between strains Lan5 and Ou17. Furthermore, 1 IgSF gene was upregulated and 1 IgSF gene was downregulated in strain Lan5, and 4 IgSF genes were upregulated and 2 IgSF genes were downregulated in strain Ou17 after silkworms were challenged with B. mori cypovirus (BmCPV), indicating potential involvement in the response to BmCPV-infection. These results provide an overview of IgSF family members in silkworms, and lay the foundation for further functional studies.     

Identification and mRNA expression profile of glutamate receptor-like gene in quinclorac-resistant and susceptible Echinochloa crus-galli

Animal ionotropic glutamate receptors (iGluRs) function as Ca^2 + ion channels during excitatory neurotransmission in nerve cells. Here, a glutamate receptor-like gene (GLR) was identified and characterized from a plant — Echinochloa crus-galli. The GLR gene was designated EcGLR1 with GenBank no: JX518597. It has a 2793 bp open reading frame predicted to encode a 101.7 kDa protein. Sequence alignment showed that EcGLR1 is a GLR homologue. Its expression in response to quinclorac treatment was assessed by real-time PCR in near-isogenic lines of quinclorac-resistant (R) and susceptible (S) biotypes of E. crus-galli. The expression of EcGLR1 in the seedling leaf and root at least increased 5 times in the S plants and 22 times in the R plants after exposure to quinclorac. In the adult plant leaves, roots and stems, its expression increased 11–14 times in the S plants and 23–25 times in the R plants after quinclorac stimulation. In the seed, its expression was 4 times less in the S plants than that in the R plants, but after treatment, the levels all increased by about 24 times in the two biotypes. EcGLR1 expression was 1–4 times greater in the R plants than in that in the S plants, and after treatment by quinclorac, the difference increased to a ratio of 4 to 9. Its expression was higher in all tissues tested of R biotypes than in that of S plants before or after quinclorac treatment. The results of this study provide basic information for the further research of function of the EcGLR1 in resistance to quinclorac in E. crus-galli.     

Molecular cloning,characterization and expression analysis of ATG1 in the silkworm, Bombyx mori

Atg1 is a Serine/Threonine protein kinase that plays a pivotal role in autophagy. A complete coding sequence of ATG1 is not available for the silkworm, Bombyx mori which is a good model for studying the autophagic process.     

Identification of a Bombyx mori gene encoding small heat shock protein BmHsp27.4 expressed in response to high-temperature stress

Elucidating the mechanisms underlying the response and resistance to high-temperature stress in the Lepidoptera is essential for understanding the effect of high-temperature on the regulation of gene expression. A tag (CATGAACGTGAAGAGATTCAG) matching the predicted gene BGIBMGA005823-TA in SilkDB identified the most significant response to high-temperature stress in a screen of the heat-treated digital gene expression library of Bombyx mori (B. mori) (Unpublished data). BLAST and RACE showed that the gene is located on chromosome 5 and has an open reading frame (ORF) of 741 bp. Phylogenetic analysis found that B. mori small heat shock protein 27.4 (BmHSP27.4) is in an evolutionary branch separate from other small heat shock proteins. Expression analysis showed that BmHsp27.4 is highly expressed in brain, eyes and fat bodies in B. mori. Its mRNA level was elevated at high-temperature and this increase was greater in females. The ORF without the signal peptide sequence was cloned into vector pET-28a(+), transformed and over-expressed in Escherichia coli Rosetta (DE3). Western blotting and immunofluorescence analysis with a polyclonal antibody, confirmed that the level of protein BmHSP27.4 increased at a high-temperature, in accordance with its increased mRNA level. In this study, BmHsp27.4 was identified as a novel B. mori gene with an important role in response to high-temperature stress.     

Fat body catalase activity as a biochemical index for the recognition of thermotolerant breeds of mulberry silkworm, Bombyx mori L.

The fifth instar larvae of the silkworm Bombyx mori L. were exposed to selected high temperatures (35 and 40 °C) in order to understand the changes in the level of catalase activity in the three tissues of fat body, midgut and haemolymph of the five selected bivoltine breeds and their 9 quantitative traits, namely larval weight, cocoon weight, shell weight, shell ratio, filament length, filament weight, denier, renditta and effective rearing rate (ERR), also the correlation between them under high temperature conditions were examined. Catalase activity resulting in fat body revealed a positive correlation between the control (28±1 °C) and 40±1 °C. The CSR₂ breed showed the most level of thermotolerance and catalase activity, compared with the CSR₄, JROP, NB₄D₂ and KA breeds. It was found that the level of catalase activity in fat body may be a reliable biochemical index to recognize thermotolerant breeds in order to develop resistant hybrids for tropical areas.     

Establishment and characterization of the Bombyx mandarina cell line

A new cell line, designated as NIAS-Boma-529b, was established from the larval fat bodies of Bombyx mandarina (B. mandarina), which is believed to be an ancestor of Bombyx mori (B. mori). This cell line has been cultured for approximately 150 passages during 2 years in an IPL-41 medium supplemented with 10% fetal bovine serum at a constant temperature of 26 °C. The morphology of this line includes adhesive round and spindle-shaped cells. Random-amplified polymorphic DNA analysis (RAPD) using 7 primers and a statistical analysis based on Nei’s genetic distance revealed that this cell line was closely related to B. mori-derived cell lines. An infection study also revealed that this cell line was susceptible to B. mori nucleopolyhedrovirus (BmNPV); however, it had no apparent susceptibility to Autographa californica NPV (AcNPV), which is closely related to BmNPV. Nevertheless, cells infected with AcNPV showed an extensive cytopathic effect (CPE), including a rough cell surface, rounding, nuclear expansion, and cell blebbing. These results suggest that this cell line can be useful to clarify the mechanism of host range determination of BmNPV and AcNPV.     

A homeotic mutation influences the wing vibration patterns during mating in males of the silkworm moth Bombyx mori

An abnormality in the wing vibration pattern in males of the E^Nc homeotic mutant of Bombyx mori was investigated. The wild-type (+/+) males show a switching of the rhythmic wing vibrations from a sequential pattern to an intermittent pattern during mating, whereas the E^Nc mutants show a sequential pattern both before and during mating. Wing motions in +/+ males became small during mating, but those in +/E^Nc males did not. Ablation of the head ganglia of +/+ and +/E^Nc males during mating caused no change in the motor patterns of wing vibrations. Ablation or cooling of the posterior abdomen in the +/+ males during mating caused sequential wing vibrations, suggesting that the change in wing vibrations is induced by signals from the posterior abdomen. The pterothoracic ganglion in the +/E^Nc males is separated into two ganglia, in contrast to the complete ganglionic fusion in the +/+ males. The neurons in the pterothoracic ganglion stained from abdominal nerve cords are homologus in +/+ and +/E^Nc males, but many of these in +/E^Nc males are elongated along the anteroposterior axis. These results suggest that the wing vibration pattern is restricted by genetic factors through reconstruction of the thoracic nervous system during metamorphosis.     

Isolation and characterization of a cDNA encoding a serine proteinase from the root-knot nematode Meloidogyne incognita

This report describes the first serine proteinase gene isolated from the sedentary nematode Meloidogyne incognita. Using degenerate primers, a 1372bp cDNA encoding a chymotrypsin-like serine proteinase (Mi-ser1) was amplified from total RNA of adult females by RT-PCR and 5' and 3' rapid amplification of cDNA ends. The deduced amino acid sequence of Mi-ser1 encoded a putative signal peptide and a prodomain of 22 and 33 amino acids, respectively, and a mature proteinase of 341 amino acids with a predicted molecular mass of 37,680Da. Sequence identity with the top serine proteinases matches from the databases ranged from 23 to 27%, including sequences from insects, mammals, and other nematodes. Southern blot analysis suggested that Mi-ser1 is encoded by a single or few gene copies. The pattern of developmental expression analyzed by Northern blot and RT-PCR indicated that Mi-ser1 was transcribed mainly in females. The domain architecture composed of a single chymotrypsin-like catalytic domain and the detection of a putative signal peptide suggested a digestive role for Mi-ser1.