A common 40 amino acid motif in eukaryotic RNases H1 and caulimovirus ORF VI proteins binds to duplex RNAs.

Eukaryotic RNases H from Saccharomyces cerevisiae , Schizosaccharomyces pombe and Crithidia fasciculata , unlike the related Escherichia coli RNase HI, contain a non-RNase H domain with a common motif. Previously we showed that S.cerevisiae RNase H1 binds to duplex RNAs (either RNA-DNA hybrids or double-stranded RNA) through a region related to the double-stranded RNA binding motif. A very similar amino acid sequence is present in caulimovirus ORF VI proteins. The hallmark of the RNase H/caulimovirus nucleic acid binding motif is a stretch of 40 amino acids with 11 highly conserved residues, seven of which are aromatic. Point mutations, insertions and deletions indicated that integrity of the motif is important for binding. However, additional amino acids are required because a minimal peptide containing the motif was disordered in solution and failed to bind to duplex RNAs, whereas a longer protein bound well. Schizosaccharomyces pombe RNase H1 also bound to duplex RNAs, as did proteins in which the S.cerevisiae RNase H1 binding motif was replaced by either the C.fasciculata or by the cauliflower mosaic virus ORF VI sequence. The similarity between the RNase H and the caulimovirus domain suggest a common interaction with duplex RNAs of these two different groups of proteins.     

Novobiocin affinity purification of a mitochondrial type II topoisomerase from the trypanosomatid Crithidia fasciculata

A mitochondrial type II DNA topoisomerase (topoIImt) has been purified to near homogeneity from the trypanosomatid Crithidia fasciculata. A rapid purification procedure has been developed based on the affinity of the enzyme for novobiocin, a competitive inhibitor of the ATP-binding moiety of type II topoisomerases. The purified enzyme is capable of ATP-dependent catenation and decatenation of kinetoplast DNA networks as well as catalyzing the relaxation of supercoiled DNA. topoIImt exists as a dimer of a 132-kDa polypeptide. Immunoblots of whole cell lysates show a single predominant band that comigrates with the 132-kDa polypeptide, indicating that the 264-kDa homodimer represents the intact form of the enzyme. Localization of the enzyme within the single mitochondrion of C. fasciculata (Melendy, T., Sheline, C., and Ray, D. S. (1988) Cell, in press) suggests an important role for topoIImt in kinetoplast DNA replication.     

Localization of a type II DNA topoisomerase to two sites at the periphery of the kinetoplast DNA of Crithidia fasciculata

A type II DNA topoisomerase (topollmt), purified to near homogeneity from the trypanosomatid C. fasciculata has been shown to be localized to the single mitochondrion of these kinetoplastid protozoa. Immunoblots show at least a 10-fold higher level of topollmt (per milligram of protein) in preparations of partially purified mitochondria as compared with those from whole cells. Analyses of type I and type II topoisomerase activities in both mitochondrial and whole cell extracts show a 4- to 5-fold higher specific activity of topollmt in mitochondrial extracts while a nuclear type I topoisomerase has a 4- to 5-fold lower specific activity in the same extract. Immunolocalizations using anti-topollmt antibodies show the enzyme to be present in close association with the mitochondrial DNA networks (kinetoplast DNA or kDNA). This association appears at two distinct locations on opposite sides of the kDNA network.     

Unusual pattern of ribonucleic acid components in the ribosome of Crithidia fasciculata, a trypanosomatid protozoan.

In a previous study from this laboratory, presumptive ribosomal ribonucleic acid (RNA) species were identified in the total cellular RNA directly extracted from intact cells of the trypanosomatid protozoan Crithidia fasciculata (M. W. Gray, Can. J. Biochem. 57:914-926, 1979). The results suggested that the C. fasciculata ribosome might be unusual in containing three novel, low-molecular-weight ribosomal RNA components, designated e, f, and g (apparent chain lengths 240, 195, and 135 nucleotides, respectively), in addition to analogs of eucaryotic 5S (species h) and 5.8S (species i) ribosomal RNAs. In the present study, all of the presumptive ribosomal RNAs were indeed found to be associated with purified C. fasciculata ribosomes, and their localization was investigated in subunits produced under different conditions of ribosome dissociation. When ribosomes were dissociated in a high-potassium (880 mM K+, 12.5 mM Mg2+) medium, species e to i were all found in the large ribosomal subunit, which also contained an additional, transfer RNA-sized component (species j). However, when subunits were prepared in a low-magnesium (60 mM K+, 0.1 mM Mg2+) medium, two of the novel species (e and g) did not remain with the large subunit, but were released, apparently as free RNAs. Control experiments have eliminated the possibility that the small RNAs are generated by quantitative and highly specific (albeit artifactual) ribonuclease cleavage of large ribosomal RNAs during isolation. In terms of RNA composition and dissociation properties, therefore, the ribosome of C. fasciculata is the most "atypical" eucaryotic ribosome yet described. These observations raise interesting questions about the function and evolutionary origin of C. fasciculata ribosomes and about the organization and expression of ribosomal RNA genes in this organism.     

Trypanosoma brucei has two distinct mitochondrial DNA polymerase beta enzymes

In higher eukaryotes, DNA polymerase (pol) beta resides in the nucleus and participates primarily in DNA repair. The DNA polymerase beta from the trypanosomatid Crithidia fasciculata, however, was the first mitochondrial enzyme of this type described. Upon searching the nearly completed genome data base of the related parasite Trypanosoma brucei, we discovered genes for two pol beta-like proteins. One is approximately 70% identical to the C. fasciculata pol beta and is likely the homolog of this enzyme. The other, although approximately 30% identical within the polymerase region, has unusual structural features including a short C-terminal tail and a long N-terminal extension rich in prolines, alanines, and lysines. Both proteins, when expressed recombinantly, are active as DNA polymerases and deoxyribose phosphate lyases, but their polymerase activity optima differ with respect to pH and KCl and MgCl2 concentrations. Remarkably, green fluorescent protein fusion proteins and immunofluorescence demonstrate that both are mitochondrial, but their locations with respect to the mitochondrial DNA (kinetoplast DNA network) in this organism are strikingly different.     

A candidate U1 small nuclear RNA for trypanosomatid protozoa.

In trypanosomatid protozoa, all mRNAs obtain identical 5'-ends by trans-splicing of the 5'-terminal 39 nucleotides of a small spliced leader RNA to appropriate acceptor sites in pre-mRNA. Although this process involves spliceosomal small nuclear (sn) RNAs, it is thought that trypanosomatids do not contain a homolog of the cis-spliceosomal U1 snRNA. We show here that a trypanosomatid protozoon, Crithidia fasciculata, contains a novel small RNA that displays several features characteristic of a U1 snRNA, including (i) a methylguanosine cap and additional 5'-terminal modifications, (ii) a potential binding site for common core proteins that are present in other trans-spliceosomal ribonucleoproteins, (iii) a U1-like 5'-terminal sequence, and (iv) a U1-like stem/loop I structure. Because trypanosomatid pre-mRNAs do not appear to contain cis-spliced introns, we argue that this previously unrecognized RNA species is a good candidate to be a trans-spliceosomal U1 snRNA.     

Unique mitochondrial genome structure in diplonemids, the sister group of kinetoplastids

Kinetoplastid flagellates are characterized by uniquely massed mitochondrial DNAs (mtDNAs), the kinetoplasts. Kinetoplastids of the trypanosomatid group possess two types of mtDNA molecules: maxicircles bearing protein and mitoribosomal genes and minicircles specifying guide RNAs, which mediate uridine insertion/deletion RNA editing. These circles are interlocked with one another to form dense networks. Whether these peculiar mtDNA features are restricted to kinetoplastids or prevail throughout Euglenozoa (euglenids, diplonemids, and kinetoplastids) is unknown. Here, we describe the mitochondrial genome and the mitochondrial ultrastructure of Diplonema papillatum, a member of the diplonemid flagellates, the sister group of kinetoplastids. Fluorescence and electron microscopy show a single mitochondrion per cell with an ultrastructure atypical for Euglenozoa. In addition, DNA is evenly distributed throughout the organelle rather than compacted. Molecular and electron microscopy studies distinguish numerous 6- and 7-kbp-sized mitochondrial chromosomes of monomeric circular topology and relaxed conformation in vivo. Remarkably, the cox1 gene (and probably other mitochondrial genes) is fragmented, with separate gene pieces encoded on different chromosomes. Generation of the contiguous cox1 mRNA requires trans-splicing, the precise mechanism of which remains to be determined. Taken together, the mitochondrial gene/genome structure of Diplonema is not only different from that of kinetoplastids but unique among eukaryotes as a whole.     

Were class C iron-containing superoxide dismutases of trypanosomatid parasites initially imported into a complex plastid? A hypothesis based on analyses of their N-terminal targeting signals

Trypanosomatid parasites possess 2 distinct iron-containing superoxide dismutases (Fe-SODs) designated SODA and SODC, both of which are targeted to their mitochondria. In contrast to SODAs that carry typical mitochondrial transit peptides, SODCs have highly unusual mitochondrial targeting signals. Our analyses clearly show that these pre-sequences are bipartite possessing a signal peptide-like domain followed by a transit peptide-like domain. Consequently, they resemble N-terminal extensions of proteins targeted to multi-membrane plastids, suggesting that trypanosomatids once contained a eukaryotic alga-derived plastid. Further support for this hypothesis comes from striking similarities in length, hydropathy profile, and amino acid composition of SODC pre-sequences to those of Euglena and dinoflagellate plastid proteins. To account for these data, we propose that the Trypanosomatidae initially possessed a gene encoding a mitochondrial Fe-SOD with a classical mitochondrial transit peptide. Before or after plastid acquisition, a gene duplication event gave rise to SODA and SODC. In a subsequent evolutionary step a signal peptide was linked to SODC, enabling its import into the plastid. When the trypanosomatid plastid subsequently was lost, natural selection favoured adaptation of the SODC N-terminal signal as a mitochondrial transit peptide and re-targeting to the mitochondrion.     

Contacts between mammalian mitochondrial translational initiation factor 3 and ribosomal proteins in the small subunit

Mammalian mitochondrial translational initiation factor 3 (IF3(mt)) binds to the small subunit of the ribosome displacing the large subunit during the initiation of protein biosynthesis. About half of the proteins in mitochondrial ribosomes have homologs in bacteria while the remainder are unique to the mitochondrion. To obtain information on the ribosomal proteins located near the IF3(mt) binding site, cross-linking studies were carried out followed by identification of the cross-linked proteins by mass spectrometry. IF3(mt) cross-links to mammalian mitochondrial homologs of the bacterial ribosomal proteins S5, S9, S10, and S18-2 and to unique mitochondrial ribosomal proteins MRPS29, MRPS32, MRPS36 and PTCD3 (Pet309) which has now been identified as a small subunit ribosomal protein. IF3(mt) has extensions on both the N- and C-termini compared to the bacterial factors. Cross-linking of a truncated derivative lacking these extensions gives the same hits as the full length IF3(mt) except that no cross-links were observed to MRPS36. IF3 consists of two domains separated by a flexible linker. Cross-linking of the isolated N- and C-domains was observed to a range of ribosomal proteins particularly with the C-domain carrying the linker which showed significant cross-linking to several ribosomal proteins not found in prokaryotes.     

The 3-hydroxyacyl-ACP dehydratase of mitochondrial fatty acid synthesis in Trypanosoma brucei

The trypanosomatid parasite Trypanosoma brucei synthesizes fatty acids in the mitochondrion using the type II fatty acid synthesis (FAS) machinery. When mitochondrial FAS was characterized in T. brucei, all of the enzymatic components were identified based on their homology to yeast mitochondrial FAS enzymes, except for 3-hydroxyacyl-ACP dehydratase. Here we describe the characterization of T. brucei mitochondrial 3-hydroxyacyl-ACP dehydratase (TbHTD2), which was identified by its similarity to the human mitochondrial dehydratase. TbHTD2 can rescue the respiratory deficient phenotype of the yeast knock-out strain and restore the lipoic acid content, is localized in the mitochondrion and exhibits hydratase 2 activity.     

Trypanosoma cruzi: high ribosomal resistance to trichosanthin inactivation

Trypanosoma cruzi is the parasite causing Chagas Disease. Several results already published suggest that T. cruzi ribosomes have remarkable differences with their mammalian counterparts. In the present work, we showed that trypanosomatid (T. cruzi and Crithidia fasciculata) ribosomes are highly resistant to inactivation by trichosanthin (TCS), which is active against mammalian ribosomes. Differential resistance is an intrinsic feature of the ribosomal particles, as demonstrated by using assays where the only variable was the ribosomes source. Because we have recently described that TCS interacts with the acidic C-terminal end of mammalian ribosomal P proteins, we assayed the effect of a TCS variant, which is unable to interact with P proteins, on trypanosomatid ribosomes. This mutant showed similar shifting of IC(50) values on rat, T. cruzi and C. fasciculata ribosomes, suggesting that the resistance mechanism might involve other ribosomal components rather than the C-terminal end of P proteins.     

A particular set of small non-coding RNAs is bound to the distinctive Argonaute protein of Trypanosoma cruzi: Insights from RNA-interference deficient organisms

The study of small RNAs and Argonaute proteins in eukaryotes that are deficient in functional RNA interference could provide insights into novel functions of small RNAs. In this study we describe small non-coding RNAs bound to a distinctive Argonaute protein of Trypanosoma cruzi, TcPIWI-tryp. Co-immunoprecipitation of TcPIWI-tryp followed by deep sequencing of isolated RNA identified abundant small RNAs derived from rRNAs and tRNAs. The small RNA repertoire differed from that of the canonical Argonaute in organisms with functional RNA interference, which could indicate novel biological functions for TcPIWI-tryp in T. cruzi and other members of the trypanosomatid clade.     

A trypanosomal CCHC-type zinc finger protein which binds the conserved universal sequence of kinetoplast DNA minicircles: isolation and analysis of the complete cDNA from Crithidia fasciculata.

Replication of the kinetoplast DNA minicircle light strand initiates at a highly conserved 12-nucleotide sequence, termed the universal minicircle sequence. A Crithidia fasciculata single-stranded DNA-binding protein interacts specifically with the guanine-rich heavy strand of this origin-associated sequence (Y. Tzfati, H. Abeliovich, I. Kapeller, and J. Shlomai, Proc. Natl. Acad. Sci. USA 89:6891-6895, 1992). Using the universal minicircle sequence heavy-strand probe to screen a C. fasciculata cDNA expression library, we have isolated two overlapping cDNA clones encoding the trypanosomatid universal minicircle sequence-binding protein. The complete cDNA sequence defines an open reading frame encoding a 116-amino-acid polypeptide chain consisting of five repetitions of a CCHC zinc finger motif. A significant similarity is found between this universal minicircle sequence-binding protein and two other single-stranded DNA-binding proteins identified in humans and in Leishmania major. All three proteins bind specifically to single-stranded guanine-rich DNA ligands. Partial amino acid sequence of the endogenous protein, purified to homogeneity from C. fasciculata, was identical to that deduced from the cDNA nucleotide sequence. DNA-binding characteristics of the cDNA-encoded fusion protein expressed in bacteria were identical to those of the endogenous C. fasciculata protein. Hybridization analyses reveal that the gene encoding the minicircle origin-binding protein is nuclear and may occur in the C. fasciculata chromosome as a cluster of several structural genes.     

Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S RNAs, and thought to be involved in interactions with tRNAs. Comparisons to other eukaryotic cytosol 5S ribosomal RNA sequences indicate that the four major eukaryotic kingdoms (animals, plants, fungi, and protists) are about equally remote from each other, and that the latter kingdom may be the most internally diverse.     

The mitochondrial tRNAs of Trypanosoma brucei are nuclear encoded

The mitochondrial DNA of Trypanosoma brucei is organized as a catenated network of maxicircles and minicircles. The maxicircles are equivalent to the typical mitochondrial genome except that the genes for the mitochondrial tRNAs have not been identified by sequence analysis of the maxicircle DNA. The apparent absence of tRNA genes in the maxicircle DNA suggests that the mitochondrial tRNAs are encoded by either the minicircle or the nuclear DNA. In order to determine their genomic origin, we isolated and identified the mitochondrial tRNAs of T. brucei. We show that these mitochondrial tRNAs are truly mitochondrially located in vivo and that they are free from detectable contamination by cytosolic RNAs. By hybridization analysis, using mitochondrial tRNAs as the probe, we determined that the mitochondrial tRNAs are encoded by nuclear DNA. This implies that RNAs, like proteins, are imported into the mitochondria. We investigated the relationship between the cytosolic and the mitochondrial tRNA genes and show that there are unique cytosolic tRNA genes, unique mitochondrial tRNA genes, and tRNA genes which appear to be shared and whose products are therefore targeted to both the cytosol and the mitochondrion.