Mass spectrometry of mRNA cap 4 from trypanosomatids reveals two novel nucleosides.

Synthesis of mRNA in kinetoplastid protozoa involves the process of trans-splicing, in which an identical 39-41-nucleotide (depending on the species) mini-exon is placed at the 5' end of mature mRNAs. The mini-exon sequence is highly conserved among all members of the Kinetoplastida, nucleotides 1-6 being identical in the four genera so far examined. Prior to trans-splicing, the mini-exon donor RNA is capped by the addition of a (5'-5') triphosphate-linked 7-methylguanosine, followed by modification of the first four transcribed nucleotides. Partial structures have been previously deduced for this cap 4 moiety from Trypanosoma brucei and Leptomonas collosoma. We have purified enough cap 4 from T. brucei and Crithidia fasciculata to allow definitive structural analysis by combined liquid chromatography/mass spectrometry and gas chromatography/mass spectrometry. The results, together with the known mini-exon sequence, show that cap 4 in both species has the structure m7G(5')ppp(5')m6(2)AmpAmpCmpm3Ump. The presence of N6,N6,2'-O-trimethyladenosine and 3,2'-O-dimethyluridine, nucleosides previously unknown in nature, were confirmed by rigorous comparison with synthetic standards. The conservation of cap 4 between these divergent genera suggests that this structure may be common to most if not all Kinetoplastida.     

Chromosomes of kinetoplastida

We have compared chromosome-sized DNA molecules (molecular karyotypes) of five genera (nine species) of kinetoplastida after cell lysis and deproteinization of DNA in agarose blocks and size fractionation of the intact DNA molecules by pulsed field gradient (PFG) gel electrophoresis. With the possible exception of Trypanosoma vivax and Crithidia fasciculata, all species have at least 20 chromosomes. There are large differences between species in molecular karyotype and in the chromosomal distribution of the genes for alpha- and beta-tubulin, rRNA and the common mini-exon sequence of kinetoplastid mRNAs. In all cases, the rRNA genes are in DNA that is larger than 500 kb. Whereas T. brucei has approximately 100 mini-chromosomes of 50-150 kb, only few are found in T. equiperdum; T. vivax has no DNA smaller than 2000 kb. As all three species exhibit antigenic variation, small chromosomes with telomeric variant surface glycoprotein genes cannot be vital to the mechanism of antigenic variation. The apparent plasticity of kinetoplastid genome composition makes PFG gel electrophoresis a potentially useful tool for taxonomic studies.     

Bodo caudatus medRNA and 5S rRNA genes: tandem arrangement and phylogenetic analyses.

The Bodo caudatus mini-exon-derived RNA gene repeat has been isolated following PCR amplification. The DNA sequence of the mini-exon fits the trypanosomatid mini-exon consensus, supporting inclusion of Bodo in this group. The B. caudatus mini-exon repeat also contains the 5S ribosomal RNA gene, an organization found in the trypanosome T. rangeli and five genera of nematodes. Phylogenetic analysis of both mini-exon-derived RNA gene and 5S gene sequences show that the free-living B. caudatus is more closely related to the monogenetic Crithidia than the digenetic Trypanosoma. Similarity between the Euglena gracilis trans-spliced leader and trypanosomatid mini-exon sequences was also noted during these comparisons.     

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.     

An acridine-linked oligodeoxynucleotide targeted to the common 5' end of trypanosome mRNAs kills cultured parasites

Anti-messenger oligodeoxynucleotides covalently linked to an intercalating agent were tested for their ability to inhibit translation of Trypanosoma brucei mRNAs in a cell-free system. The sequence of these oligodeoxynucleotides was complementary to part of the 35-nucleotide (nt) sequence which is present at the 5' end of all trypanosome mRNAs (the so-called mini-exon sequence). In a rabbit reticulocyte lysate, a nonadeoxynucleotide linked to an acridine derivative, specifically inhibited protein synthesis from T. brucei mRNAs much more efficiently than unmodified oligodeoxynucleotides of similar length. These oligodeoxynucleotides were tested on cultured trypanosomes. The acridine-linked nonadeoxynucleotide had a lethal effect on the parasites. No effect was observed with the homologous unmodified 9-mer nor with those 9-mers linked to the acridine derivative which were not complementary to the mini-exon sequence. These effects are probably a result of hybrid formation between the anti-messenger and mini-exon sequence. Trypanocidal activity of the acridine-modified nonadeoxynucleotide is most likely due to (i) increased affinity for its target, (ii) improved resistance to 3' exonucleases, and (iii) promoted membrane penetration of living parasites.     

Cloning, molecular analysis and differential cell localisation of the p36 RACK analogue antigen from the parasite protozoon Crithidia fasciculata

The family of the RACK molecules (receptors for activated C kinases) are present in all the species studied so far. In the genus Leishmania, these molecules also induce a strong immune reaction against the infection. We have cloned and characterised the gene that encodes the RACK analogue from the parasite trypanosomatid Crithidia fasciculata (CACK). The molecule seems to be encoded by two genes. The sequence analysis of the cloned open reading frame indicates the existence of a high degree of conservation not only with other members of the Trypanosomatidae but also with mammalians. The study of the protein kinase C phosphorylation sites shows the presence of three of them, shared with the mammalian species, additional to those present in the other protozoa suggesting a certain phylogenetic distance between the protozoon Crithidia fasciculata and the rest of the Trypanosomatidae. The CACK-encoded polypeptide shows an additional sequence of four amino acids at the carboxy-terminal end, which produces a different folding of the fragment with the presence of an alpha-helix instead of the beta-sheet usual in all the other species studied. A similar result is elicited at the amino-terminal end by the change of three amino acid residues. The immunolocalisation experiments show that the CACK displays a pattern with a distribution mainly at the plasma membrane, different from that of the related Leishmania species used as control, that displays a distribution close to the nucleus. Altogether, the data suggest that the existence of the structural differences found may have functional consequences.     

Discontinuous transcription in Leptomonas seymouri: presence of intact and interrupted mini-exon gene families.

Mature mRNAs of trypanosomatid protozoa result from the joining of at least two exons, which are initially transcribed as separate RNAs. In all trypanosomatids examined to date, the first exon (mini-exon) is encoded by approximately 200 tandemly reiterated genes. In characterizing the mini-exon genes of Leptomonas seymouri, we identified two predominant size classes of repetitive sequences that hybridized strongly to the L. seymouri mini-exon sequence. These two sequences are arranged as interspersed clusters. DNA sequence analysis of a clone representing the smaller size class demonstrated that these sequences have the capacity to encode a mini-exon donor (med)RNA corresponding to the 86 nt component seen in Northern blots of L. seymouri RNA. The larger size class comprises a family of related sequences, some of which contain DNA inserted into the mini-exon portion of the medRNA gene. The specific insert identified here (LINS 1) is exclusively associated with medRNA sequences, and is present in approximately 20% of the larger size class of L. seymouri medRNA genes. Disregarding the insertion, the sequences of the smaller bona fide mini-exon genes and the gene copy containing the insert were almost identical. The insert sequence is transcribed in the same direction as medRNA to yield at least four small non-polyadenylated RNAs, which appeared not to be linked to medRNA sequences.     

Mini-exon Gene Sequences Define Six Groups within the Genus Crithidia

ABSTRACT. To develop molecular markers for lower trypanosmatids, we have examined the mini-exon gene repeats of 17 isolates that were classified as Crithidia by traditional methods. Representative repeats were amplified by polymerase chain reaction and the amplification products were cloned and used as hybridization probes against genomic DNA. Six hybridization groups of Crithidia were defined on the basis of the DNA blotting experiments. The three endosymbiont-bearing species ( C. deanei, C. desouzai and C. oncopelti ) and C. acanthocephali each belonged to single-member hybridization groups, while the C. fasciculata group contained additional named and undesignated species. The Crithidia lucilae thermophila probe hybridized to multiple undesignated isolates. The DNA sequence of the cloned products revealed that the specificity of the hybridization probes was due to substantial differences in the intron and the non-transcribed spacer regions. These data indicate substantial heterogeneity within the mini-exon gene locus of the taxon Crithidia .     

The common 5'' terminal sequence on trypanosome mRNAs: a target for anti-messenger oligodeoxynucleotides.

Several mature mRNAs of Trypanosoma brucei were previously shown to have a common 5' terminal sequence of 35 nucleotides (nt) encoded by a separate mini-exon. To verify whether all trypanosome mRNAs contain this mini-exon sequence at their 5' end, we have tested oligodeoxynucleotides complementary to different parts of the 35 nt leader sequence for their ability to inhibit translation of total trypanosome mRNA. All oligomers tested inhibited translation of trypanosome mRNAs in a wheat germ extract. They had no effect on translation of Brome mosaic virus mRNA and of a trypanosome mRNA for phosphoglycerate kinase modified to remove the mini-exon sequence. Three different 12mers inhibited translation 35-60%; both the 22- and 34mer inhibited translation 95-100%. Incorporation of amino acids decreased proportionally in all protein bands detected in high resolution polyacrylamide gels. Our results show that all trypanosome mRNAs that yield a product detectable in gel contain a mini-exon sequence. We infer that most, if not all, trypanosome mRNAs contain a 5' terminal mini-exon sequence acquired by discontinuous synthesis.     

The majority of minicircle DNA in Crithidia fasciculata strain CF-C1 is of a single class with nearly homogeneous DNA sequence

DNA minicircles found within the kinetoplast of the trypanosomatid Crithidia fasciculata, like those of most other kinetoplastid species, are heterogeneous in sequence. The pattern of minicircle DNA fragments generated by cleavage of kinetoplast DNA with various restriction enzymes has been used to demonstrate this heterogeneity. Here we describe a strain of Crithidia fasciculata in which more than 90% of the DNA minicircles exhibit a common pattern of restriction enzyme cleavage sites. A map of cleavage sites within this major minicircle DNA class is presented for seven restriction enzymes with hexanucleotide recognition sequences. Sequence homogeneity at an even finer level is reflected in minicircle DNA digestion patterns generated by restriction enzymes with tetranucleotide recognition sites. Partial DNA sequence analysis of multiple clones from the major minicircle class shows nearly complete homogeneity at the nucleotide level. The existence of a near homogeneous complement of DNA minicircles in Crithidia should facilitate the study of their replication in this organism.