The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.     

Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S RNAs, and thought to be involved in interactions with tRNAs. Comparisons to other eukaryotic cytosol 5S ribosomal RNA sequences indicate that the four major eukaryotic kingdoms (animals, plants, fungi, and protists) are about equally remote from each other, and that the latter kingdom may be the most internally diverse.     

Unusual structural features of the 5S ribosomal RNA from Streptococcus cremoris

The nucleotide sequence of the 5S ribosomal RNA of Streptococcus cremoris has been determined. The sequence is 5' (sequence in text) 3'. Comparison of the S. cremoris 5S RNA sequence to an updated prokaryotic generalized 5S RNA structural model shows that this 5S RNA contains some unusual structural features. These features result largely from uncommon base substitutions in helices I, II and IV. Some of these unusual structural features are shared by several of the known 5S RNA sequences from mycoplasmas. However, the characteristic bloc of deletions found in helix V of these mycoplasma 5S RNAs is not present in the 5S RNA of S. cremoris.     

Nucleotide sequence, secondary structure and evolution of the 5S ribosomal RNA from five bacterial species

The nucleotide sequences of the 5S ribosomal RNAs of the bacteria Agrobacterium tumefaciens, Alcaligenes faecalis, Pseudomonas cepacia, Aquaspirillum serpens and Acinetobacter calcoaceticus have been determined. The sequences fit in a generally accepted model for 5S RNA secondary structure. However, a closer comparative examination of these and other bacterial 5S RNA primary structures reveals the potential of additional base pairing and of multiple equilibria between a set of slightly different alternative secondary structures in one area of the molecule. The phylogenetic position of the examined bacteria is derived from a 5S RNA sequence alignment by a clustering method and compared with the position derived on the basis of 16S ribosomal RNA oligonucleotide catalogs.     

Bodo caudatus medRNA and 5S rRNA genes: tandem arrangement and phylogenetic analyses.

The Bodo caudatus mini-exon-derived RNA gene repeat has been isolated following PCR amplification. The DNA sequence of the mini-exon fits the trypanosomatid mini-exon consensus, supporting inclusion of Bodo in this group. The B. caudatus mini-exon repeat also contains the 5S ribosomal RNA gene, an organization found in the trypanosome T. rangeli and five genera of nematodes. Phylogenetic analysis of both mini-exon-derived RNA gene and 5S gene sequences show that the free-living B. caudatus is more closely related to the monogenetic Crithidia than the digenetic Trypanosoma. Similarity between the Euglena gracilis trans-spliced leader and trypanosomatid mini-exon sequences was also noted during these comparisons.     

Nucleotide sequence of cytoplasmic 5S ribosomal RNA fromEuglena gracilis

Summary The nucleotide sequence of cytoplasmic 5S ribosomal RNA fromEuglena gracilis has been determined to be: G- _A ^C -G-U-A-C-G-G-C-C-A-U-A-C-U-A-C-C-G-G-G-A-A-U-A-C-A-C-C-U-G-A-A-C-C-C-G--U-C-G-A-U-U-U-C-A-G-A-A-G-U-U-A-A-G-C-C-G-G-G-U-U-A-G-G-C-C-C-A-G-U-U-A-G-U-A-C-U-G-A-G-U-G-G-G-C-G-A-C-C-A-C-U-U-G-G-G-A-A-C-A-C-U-G-G-G-U-G-C-U-G-U-A-C-G-C-U-Up. This RNA is 119 nucleotides long and the sequence of a probable tRNA-binding site is GAUU (position 41–44 from the 5-terminus), which is the same as that of a trypanosoma species,Crithidia fasci-culata. TheEuglena 5S rRNA has a pseudouridine residue at position 38 and 3-terminus is phosphorylated. The 5S rRNA sequence ofEuglena resembles those of several other protozoa and higher animals rather than plants.On leave from Department of Zoology, Hiroshima University, Hiroshima, Japan     

Structural features unique to the 5 S ribosomal RNAs of the thermophilic cyanobacterium Synechococcus lividus III and the green plant chloroplasts

The complete nucleotide sequence of the 5 S ribosomal RNA from the thermophilic cyanobacterium Synechococcus lividus III was determined. The sequence is: ^5′U-C- C-U-G-G-U-G-G-U-G-A-U-G-G-C-G-A-U-G-U-G-G-A-C-C-C-A-C-A-C-U-C-A-U-C- C-A-U-C-C-C-G-A-A-C-U-G-A-G-U-G-G-U-G-A-A-A-C-G-C-A-U-U-U-G-C-G-G-C- G-A-C-G-A-U-A-G-U-U-G-G-A-G-G-G-U-A-G-C-C-U-C-C-U-G-U-C-A-A-A-A-U-A- G-C-U-A-A-C-C-G-C-C-A-G-G-G-U_OH^3′This 5 S RNA has regional structural characteristics that are found in the green plant chloroplast 5 S RNAs and not in other known sequences of 5 S ribosomal RNAs. These homologies suggest a close phylogenetic relationship between S. lividus and the green plant chloroplasts.     

Phylogenetic origins of the plant mitochondrion based on a comparative analysis of 5S ribosomal RNA sequences

Summary The complete nucleotide sequences of 5S ribosomal RNAs fromRhodocyclus gelatinosa, Rhodobacter sphaeroides, andPseudomonas cepacia were determined. Comparisons of these 5S RNA sequences show that rather than being phylogenetically related to one another, the two photosynthetic bacterial 5S RNAs share more sequence and signature homology with the RNAs of two nonphotosynthetic strains.Rhodobacter sphaeroides is specifically related toParacoccus denitrificans andRc. gelatinosa is related toPs. cepacia.These results support earlier 16S ribosomal RNA studies and add two important groups to the 5S RNA data base. Unique 5S RNA structural features previously found inP. denitrificans are present also in the 5S RNA ofRb. sphaeroides; these provide the basis for subdivisional signatures. The immediate consequence of our obtaining these new sequences is that we are able to clarify the phylogenetic origins of the plant mitochondrion. In particular, we find a close phylogenetic relationship between the plant mitochondria and members of the alpha subdivision of the purple photosynthetic bacteria, namely,Rb. sphaeroides, P. denitrificans, andRhodospirillum rubrum.     

Unusual 5 S ribosomal RNAs. An analysis of individual segments can reveal phylogenetic relatedness

Sequence comparisons of 5 S and other ribosomal RNAs by segments can be useful in understanding anomalous primary and secondary structures and in assessing phylogenetic relationships. In a segmented analysis, the 5'-half of the Chlamydomonas reinhardii chloroplast 5 S ribosomal RNA is found to have a very close sequence homology to the green plant chloroplast and cyanobacterial 5 S RNAs; however, the 3'-half has a highly unusual sequence. Further comparisons of homologies between regions of the 5 S RNAs from C. reinhardii and the green plant chloroplasts suggest that genetic rearrangements within the 5 S DNA may have produced the unusual sequence at the 3'-half. Segmented analyses of the C. reinhardii and green plant chloroplast 5 S RNAs suggest a close relationship which is not revealed by overall sequence comparisons.     

Structure and evolution of the 4.5-5S ribosomal RNA intergenic region from Glycine max (soya bean).

The nucleotide sequence for the 4.5-5S ribosomal DNA region from the chloroplastids of soya beans was determined as the basis of further comparative studies on the structure and evolution of this intergenic region. Comparisons with other plant sequences as well as equivalent sequences in eubacteria suggest that the longer internal transcribed spacer regions of plants have evolved, at least in part, by DNA sequence duplications and that the presence of the 4.5S rRNA in chloroplast may result from the accidental acquisition of a RNA maturation site during the evolution of longer internal transcribed spacer regions. Estimates of the secondary structures also indicate only a very limited retention of structural features and suggest that the primary role of the intergenic sequences may be to bring processed sites into close proximity.     

Isolation of Euglena gracilis chloroplast 5S ribosomal RNA and mapping the 5S rRNA gene on chloroplast DNA.

Ribosomal RNA (5S) from Euglena gracilis chloroplasts was isolated by preparative electrophoresis, labeled in vitro with 125I, and hybridized to restriction nuclease fragments from chloroplast DNA or cloned chloroplast DNA segments. Euglena chloroplast 5S rRNA is encoded in the chloroplast genome. The coding region of 5S rRNA has been positioned within the 5.6 kilobase pair (kbp) repeat which also codes for 16S and 23S rRNA. There are three 5S rRNA genes on the 130-kbp genome. The order of RNAs within a single repeat is 16S-23S-5S. The organization and size of the Euglena chloroplast ribosomal repeat is very similar to the ribosomal RNA operons of Escherichia coli.     

The nucleotide sequence of phenylalanine tRNA and 5S RNA from Rhodospirillum rubrum

The complete nucleotide sequence of tRNAPhe and 5S RNA from the photosynthetic bacterium Rhodospirillum rubrum has been elucidated. A combination of in vitro and in vivo labelling techniques was used. The tRNAPhe sequence is 76 nucleotides long, 7 of which are modified. The primary structure is typically prokaryotic and is most similar to the tRNAPhe of Escherichia coli and Anacystis nidulans (14 differences of 76 positions). The 5S ribosomal RNA sequence is 120 nucleotides long and again typical of other prokaryotic 5S RNAs. The invariable GAAC sequence is found starting at position 45. When aligned with other prokaryotic 5S RNA sequences, a surprising amount of nucleotide substitution is noted in the prokaryotic loop region of the R. rubrum 5S RNA. However, nucleotide complementarity is maintained reinforcing the hypothesis that this loop is an important aspect of prokaryotic 5S RNA secondary structure. The 5S and tRNAPhe are the first complete RNA sequences available from the photosynthetic bacteria.     

Sixteen discrete RNA components in the cytoplasmic ribosome of Euglena gracilis

We have isolated cytoplasmic ribosomes from Euglena gracilis and characterized the RNA components of these particles. We show here that instead of the four rRNAs (17-19 S, 25-28 S, 5.8 S and 5 S) found in typical eukaryotic ribosomes, Euglena cytoplasmic ribosomes contain 16 RNA components. Three of these Euglena rRNAs are the structural equivalents of the 17-19 S, 5.8 S and 5 S rRNAs of other eukaryotes. However, the equivalent of 25-28 S rRNA is found in Euglena as 13 separate RNA species. We demonstrate that together with 5 S and 5.8 S rRNA, these 13 RNAs are all components of the large ribosomal subunit, while a 19 S RNA is the sole RNA component of the small ribosomal subunit. Two of the 13 pieces of 25-28 S rRNA are not tightly bound to the large ribosomal subunit and are released at low (0 to 0.1 mM) magnesium ion concentrations. We present here the complete primary sequences of each of the 14 RNA components (including 5.8 S rRNA) of Euglena large subunit rRNA. Sequence comparisons and secondary structure modeling indicate that these 14 RNAs exist as a non-covalent network that together must perform the functions attributed to the covalently continuous, high molecular weight, large subunit rRNA from other systems.     

The topography of the 5' end of 16-S RNA in the presence and absence of ribosomal proteins S4 and S20

A ribonucleoprotein prepared by strong ribonuclease digestion of a complex of 16-S ribosomal RNA and proteins S4 and S20 from Escherichia coli has been characterized; its nucleotide sequence, the positions of enzyme cuts and the sequence excisions have been placed in the completed sequence of 16-S RNA. The positions and yields of enzyme cuts, and excisions of sequence, are compared with those of various ribonucleoproteins prepared with S4 or S20 alone, and with the ribonuclease-resistant S4 RNA prepared from renatured 16-s RNA in the absence of ribosomal protein. These data yield important information on the topography and organisation of the 5' third of the 16-s RNA which is selectively maintained in its native conformation by the bound proteins; they also provide criteria for testing secondary structural models of this region of 16-S RNA.     

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.     

5S RNA structure and interaction with transcription factor A. 1. Ribonuclease probe of the structure of 5S RNA from Xenopus laevis oocytes

The structure of Xenopus laevis oocyte (Xlo) 5S ribosomal RNA has been probed with single-strand-specific ribonucleases T1, T2, and A with double-strand-specific ribonuclease V1 from cobra venom. The digestion of 5'- or 3'-labeled renatured 5S RNA samples followed by gel purification of the digested samples allowed the determination of primary cleavage sites. Results of these ribonuclease digestions provide support for the generalized 5S RNA secondary structural model derived from comparative sequence analysis. However, three putative single-stranded regions of the molecule exhibited unexpected V1 cuts, found at C36, U73, U76, and U102. These V1 cuts reflect additional secondary structural features of the RNA including A.G base pairs and support the extended base pairing in the stem containing helices IV and V which was proposed by Stahl et al. [Stahl, D. A., Luehrsen, K. R., Woese, C. R., & Pace, N. R. (1981) Nucleic Acids Res. 9, 6129-6137]. A conserved structure for helix V having a common unpaired uracil residue at Xlo position 84 is proposed for all eukaryotic 5S RNAs. Our results are compared with nuclease probes of other 5S RNAs.     

Molecular evolution of 5S RNA

Summary Based on the comparative analyses of the primary structure of 5S RNAs from 19 organisms, a secondary structure model of 5S RNA is proposed. 5S RNA has essentially the same structure among all prokaryotic species. The same is true for eukaryotic 5S RNAs. Prokaryotic and eukaryotic 5S RNAs are also quite similar to each other, except for a difference in a specific region.By comparing the nucleotide alignment from the juxtaposed 5S RNA secondary structures, a phylogenic tree of nineteen organisms was constructed. The time of divergence between prokaryotes and eukaryotes was estimated to be 2.5×10⁹ years ago (minimum estimate: 2.1×10⁹).     

Phylogeny of the 5S ribosomal RNA from Synechococcus lividus II: the cyanobacterial/chloroplast 5S RNAs form a common structural class

The complete nucleotide sequence of the 5S ribosomal RNA from the cyanobacterium Synechococcus lividus II has been determined. The sequence is (sequence in text) This 5S RNA has the cyanobacterial- and chloroplast-specific nucleotide insertion between positions 30 and 31 (using the numbering system of the generalized eubacterial 5S RNA) and the chloroplast-specific nucleotide-deletion signature between positions 34 and 39. The 5S RNA of S. lividus II has 27 base differences compared with the 5S RNA of the related strain S. lividus III. This large difference may reflect an ancient divergence between these two organisms. The electrophoretic mobilities on nondenaturing polyacrylamide gels of renatured 5S RNAs from S. lividus II, S. lividus III, and spinach chloroplasts are identical, but differ considerably from that of Escherichia coli 5S RNA. This most likely reflects differences in higher-order structure between the 5S RNA of E. coli and these cyanobacterial and chloroplast 5S RNAs.     

Isolation from rat liver and sequence of a RNA fragment containing 32 nucleotides from position 5 to 36 from the 3'' end of ribosomal 18S RNA.

Crude tRNA isolated from rat liver by the method of Rogg et al. (Biochem. Biophys. Acta 195, 13-15 1969) contains N6-dimethyladenosine (m6-2A) and was therefore fractionated in order to identify the m6-2A-containing RNAs. A unique species of RNA was purified which contained all the m62A present in the crude tRNA. Sequence analysis by postlabeling with gamma-32p-ATP and polynucleotide kinase revealed that this RNA represents the 32 nucleotides AAGGUUUC(C)U GUAGGUGm62Am62ACCUGCGGAAGGAUC from position 5 to 36 of the 3' terminus of ribosomal 18S RNA. The 36 nucleotide long sequence from the 3' end of rat liver 18S rRNA exhibits extensive homology with the corresponding sequence of E. coli 16S rRNA and with the 21 nucleotide long 3' terminal sequence so far known from Saccharomyces carlsbergensis 17S rRNA. A heterogeneity in this sequence provides the first evidence on the molecular level for the existence of (at least) two sets of redundant ribosomal 18S RNA genes in the rat.     

Alternative conformers of 5S ribosomal RNA and their biological relevance

Different conformational states of Escherichia coli 5S ribosomal RNA that may participate in protein biosynthesis have been either detected experimentally or predicted on the basis of phylogenetic sequence comparisons. The A conformer exists in a high-salt form (AH) that binds ribosomal proteins and assembles into the 50S subunit and in a low-salt form (AL), of uncertain biological relevance, that binds at least one ribosomal protein and differs in tertiary structure from the AH form. Experimentally, the AH form has been investigated comprehensively and the AL form partially. There is also a B conformer that exhibits an altered secondary structure and does not assemble with ribosomal proteins. For this conformer exhibits an altered secondary structure and does not assemble with ribosomal proteins. For this conformer to be functionally active, it must be both discrete and universal among 5S RNAs. Here, we examine its structure by employing single and double strand specific ribonucleases and nucleotide-specific chemical reagents. We demonstrate that the B form exhibits a secondary structure only a part of which is both universal and conformationally homogeneous, and we conclude, therefore, that the whole B form cannot participate in protein biosynthesis. We note, however, that progressive structural changes occur during the transitions AH----AL----B and provide evidence that the structural alteration during the transition AH----AL may be universal, which reinforces the view that the AL form is of biological relevance.