Immunohistochemical comparison of whisker pad cutaneous innervation in Swiss Webster and hairless mice

To establish the mouse mutant, hairless (Hr), as a useful model for future analyses of target-ending interactions, we assessed the cutaneous innervation in the whisker pad after loss of primary hair targets. Postnatal (P) development of fur in Hr begins similarly to that of "normal" Swiss Webster (SW) mice. Around P10, hairs are shed and the follicles rendered permanently incompetent. Hair loss progresses rostrocaudally until the entire skin is denuded. Substantial alterations in the distribution and density of sensory and autonomic endings in the mystacial pad vibrissal and intervibrissal fur innervation were discovered. Pilo-neural complexes innervating fur hairs were dismantled in Hr. Epidermal innervation in SW was rich; only a few endings expressed growth-associated protein-43?kdal (GAP), suggesting limited changes in axonal elongation. Innervation in Hr formed a dense layer passing upward through the thickened epidermis, with substantial increases among all types of endings. Vibrissal follicle-sinus complexes were also hyperinnervated. Endings in Hr vibrissae and fur were strongly GAP-positive, suggesting reorganization of innervation. Dermal and vascular autonomic innervation in both strains co-localized tyrosine hydroxylase and neuropeptide Y, but only in Hr did neuropeptide Y co-localize calcitonin gene-related peptide (CGRP) and express GAP immunolabeling. Stereological quantitation of trigeminal ganglia revealed no differences in neuron number between Hr and SW, although there were small increases in cell volume in Hr trigeminal ganglion cells. These results suggested that a form of collateral sprouting was active in Hr mystacial pads, not in response to local injury, but as a result of loss of primary target tissues.     

Supravital Methylene Blue Staining of Piloneural Complexes of Common Fur Hair Follicles in the Rat

Light microscopic observations employing supravital methylene blue staining are presented for piloneural complexes of common fur hairs in the mystacial pad of the rat snout. The investigation revealed anatomical details of piloneural complexes belonging to follicles of both vellus and guard hairs. In the methylene blue stained preparations, different types of palisade-like lanceolate nerve fiber endings could be discriminated. The thicker vellus and thinner guard hairs (hair diameter: 15-25 μm) exhibited a different innervation pattern compared to the thicker guard hairs, and two subtypes of piloneural complexes could be distinguished. Both subtypes were characterized by slightly stained lanceolate endings and the absence of a circular nerve fiber plexus. One subtype, however, showed strongly stained spines originating from the lanceolate endings. A few spines of adjacent lanceolate endings appeared in contact with each other. In the second subtype, these spines were replaced by anastomoses suggesting a delicate terminal nerve fiber network. The moderately stained lanceolate endings located primarily at the follicles of thicker guard hairs (hair diameter: 30-40 μm) showed smooth outlines, but were characterized by the occurrence of an intensely stained additional circular nerve fiber plexus. The differences in the morphology of piloneural complexes associated with the follicles of common fur hairs suggest differences regarding their mechanoreceptive tasks.     

Supravital Methylene Blue Staining of Piloneural Complexes of Common Fur Hair Follicles in the Rat

Light microscopic observations employing supravital methylene blue staining are presented for piloneural complexes of common fur hairs in the mystacial pad of the rat snout. The investigation revealed anatomical details of piloneural complexes belonging to follicles of both vellus and guard hairs. In the methylene blue stained preparations, different types of palisade-like lanceolate nerve fiber endings could be discriminated. The thicker vellus and thinner guard hairs (hair diameter: 15-25 μm) exhibited a different innervation pattern compared to the thicker guard hairs, and two subtypes of piloneural complexes could be distinguished. Both subtypes were characterized by slightly stained lanceolate endings and the absence of a circular nerve fiber plexus. One subtype, however, showed strongly stained spines originating from the lanceolate endings. A few spines of adjacent lanceolate endings appeared in contact with each other. In the second subtype, these spines were replaced by anastomoses suggesting a delicate terminal nerve fiber network. The moderately stained lanceolate endings located primarily at the follicles of thicker guard hairs (hair diameter: 30-40 μm) showed smooth outlines, but were characterized by the occurrence of an intensely stained additional circular nerve fiber plexus. The differences in the morphology of piloneural complexes associated with the follicles of common fur hairs suggest differences regarding their mechanoreceptive tasks.     

Innervation of the maxillary vibrissae in mice as revealed by anterograde and retrograde tract tracing

Vibrissae are a unique sensory system of mammals that is characterized by a rich and diverse innervation involved in numerous sensory tasks with the potential for species-specific differences. In the present study, indocarbocyanine dyes (DiI and PTIR271) and confocal microscopy were combined to study the innervation of the mystacial vibrissae and vibrissa-specific sensory neuron distribution in the maxillary portion of the trigeminal ganglion of the mouse. The deeper regions of the vibrissa cavernous sinus (CS) contained a dense plexus of free nerve endings, possibly of autonomic fibers. The superficial part of this sinus displayed a massive array of corpuscular endings. Innervation in the region of the ring sinus consisted of Merkel endings and different morphological variances of lanceolate endings. The region of the inner conical body had a circular plexus of free nerve endings. In addition to confirming previous observations obtained by a variety of other techniques and ultrastructural studies, our studies revealed denser terminal receptor endings in a different distribution pattern than previously demonstrated in studies using the rat. We also revealed the distribution of sensory neurons in the trigeminal ganglion using retrograde tracing with fluorescent tracers from two nearby vibrissae. We determined that the populations of sensory neurons innervating the two vibrissae were largely overlapping. This suggests that the somatotopic maps of vibrissal projections reported at the different levels in the neuraxis are not faithfully reproduced at the level of the ganglion.This work was supported by a grant from the NIDCD (RO1 DC 005590; BF), the Egyptian government (AM), and the NIH (ES00365-01 and RR-02-003; LH).     

Localization in the gasserian ganglion of axons innervating the common hairs of the mystacial pad in the normal adult rat and in rats dewhiskered at birth

The neurons which innervate the small common hairs of the mystacial pad are shown to be located in the dorsomedial part of the ganglion of Gasser. In ganglia atrophied as a consequence of early destruction of vibrissae follicles, neurons that innervate these small hairs are still active.     

Epithelial Na+ channels and stomatin are expressed in rat trigeminal mechanosensory neurons

Caenorhabditis elegans MEC-4 and MEC-10 are subunits of the degenerin/epithelial Na+ channel (DEG/ENaC) ion channel superfamily thought to be associated with MEC-2 (a stomatin-like protein) in a mechanotransducing molecular complex in specialized touch sensory neurons. A key question is whether analogous molecular complexes in higher organisms transduce mechanical signals. To address this question, we selected mechanoreceptors of the rat vibrissal follicle-sinus complex in the mystacial pad and the trigeminal ganglia for an immunocytochemical and molecular biological study. RT-PCR of poly(A+) mRNA of rat trigeminal ganglia indicated that alpha-, beta-, and gamma-ENaC and stomatin mRNA are expressed in rat trigeminal ganglia. Using immunocytochemistry, we found that alpha-, beta-, and gamma-ENaC subunits and stomatin are localized in the perikarya of the trigeminal neurons and in a minor fraction of their termination site in the vibrissal follicle-sinus complex, where longitudinal lanceolate endings are immunopositive. We conclude that alpha-, beta-, and gamma-ENaC subunits as well as the candidate interacting protein stomatin are coexpressed in a mammalian mechanoreceptor, a location consistent with a possible role in mechanotransduction.     

Adam10 haploinsufficiency causes freckle-like macules in Hairless mice

The Hairless nuclear receptor co‐repressor is required for hair follicle regeneration during the hair cycle. The classical Hairless^Hr/Hairless^Hr mouse mutant loses all hair between 2 and 3 weeks of age. As the mice age, their trunk skin develops epidermal pigmentation, a feature of human skin which is not found in normal haired mice. In this report, we present a new, dominant mouse mutation, Pied, which arose within a colony of Hairless^Hr/Hairless^Hr mice and causes freckle‐like macules on the skin. The Pied macules require Hairless^Hr homozygosity to form and are composed of localized clusters of epidermal melanocytes. Through linkage analysis, we find that the Pied mutation is a 1914 base pair loss‐of‐function deletion in the Adam10 zinc metalloprotease gene. The pathways that specifically maintain long‐term pigmentation patterns in adults are not well understood. We have identified Adam10 as an inhibitor of melanocyte expansion in adult skin.     

The functional analysis of Type I postplasmic/PEM mRNAs in embryos of the ascidian Halocynthia roretzi

Maternal factors, such as a muscle determinant macho-1 mRNA that is localized to the posterior-vegetal cortex (PVC) of fertilized ascidian eggs, are crucial for embryonic axis formation and cell fate specification. Maternal mRNAs that show an identical posterior localization pattern to that of macho-1 in eggs and embryos are called Type I postplasmic/PEM mRNAs. We investigated the functions of five of the nine Type I mRNAs so far known in Halocynthia roretzi: Hr-Wnt-5, Hr-GLUT, Hr-PEM3, Hr-PEN1, and Hr-PEN2. Suppression of their functions with specific antisense morpholino oligonucleotides (MOs) had effects on the formation of various tissues: Hr-Wnt-5 on notochord, muscle, and mesenchyme, although zygotic function of Hr-Wnt-5 is responsible for notochord formation; Hr-GLUT on notochord, mesenchyme, and endoderm; and Hr-PEN2 on muscle, mesenchyme, and endoderm. On the other hand, Hr-PEM3 and Hr-PEN1 MOs seemed to have no effect. We conclude that the functions of at least some localized maternal Type I postplasmic/PEM mRNAs are necessary for early embryonic patterning in ascidians.     

Morphological and thermal properties of mammalian insulation: the evolution of fur for aquatic living

Carnivora includes three independent evolutionary transitions to the marine environment: pinnipeds (seals, sea lions, and walruses), sea otters, and polar bears. All three lineages must contend with the thermal challenges of submersion in the marine environment. In the present study, we investigated changes in the fur associated with the transition from a terrestrial to an aquatic lifestyle, comparing fur characteristics among these lineages with those of semi‐aquatic and strictly terrestrial carnivores. Characteristics included gross morphology (hair cuticle shape, circularity, length, and density) and thermal conductivity. We found consistent trends in hair morphology associated with aquatic living, such that marine carnivores have significantly flatter (P < 0.001), shorter (P < 0.001), and denser hairs (P < 0.001) than terrestrial carnivores. However, sea lions, phocids, and walrus, which have thicker blubber layers than fur seals, have lower fur densities than fur seals (P < 0.001). Species utilizing fur for insulation in water also showed an elongation of hair cuticle scales compared to terrestrial species and marine species relying on blubber for insulation (P < 0.001). By testing pelts under hydrostatic pressure, we determined that flattening of the hairs, cuticular scale elongation, and increased fur density are critical characteristics for maintaining an insulating air layer within the fur during submersion. Overall, these results indicate consistent evolutionary modifications to the fur associated with the transition to aquatic living, as well as a decrease in fur function associated with a greater reliance on blubber in some groups. © 2012 The Linnean Society of London, Biological Journal of the Linnean Society, 2012, ?? , ??–??.     

Neuropeptide Y-like immunoreactivity in the cardiovascular nerve plexus of the elasmobranchs Raja erinacea and Raja radiata

Summary The distribution of nerves showing neuropeptide Y (NPY)-like immunoreactivity in the cardiovascular system of elasmobranchs and teleosts has been investigated. Two species of teleosts, the rainbow trout (Salmo gairdneri) and the Atlantic cod (Gadus morhua), and three species of elasmobranchs, the spiny dogfish (Squalus acanthias), the little skate (Raja erinacea) and the starry ray (Raja radiata), were used in this study. An innervation of the cardiovascular system by an NPY-like substance was found only in the two species of Raja. A rich innervation was encountered in these skates, with the highest density of fibres in the wall of the ventricle, the conus arteriosus, the coeliac artery and smaller mesenterial vessels. In the vessels, the fibres formed a plexus at the adventitio-mediol border. Few fibres were found in the walls of the dorsal aorta, the sinus venosus and the atrium, and no fibres were observed in the walls of the ventral aorta. Falck-Hillarp fluorescence histochemistry showed the presence of a rich innervation of arteries and arterioles of the gut by catecholamine-containing nerve fibres.     

A novel mutation in Hr causes abnormal hair follicle morphogenesis in hairpoor mouse, an animal model for Marie Unna Hereditary Hypotrichosis

Hairpoor mice (Hr ^Hp ) were derived through N-ethyl-N-nitrosourea (ENU) mutagenesis. These mice display sparse and short hair in the Hr ^Hp /+ heterozygous state and complete baldness in the Hr ^Hp /Hr ^Hp homozygous state. This phenotype was irreversible and was inherited in an autosomal semidominant manner. Hair follicles (HFs) of Hr ^Hp /+ mice underwent normal cycling and appeared normal, although smaller than those of the wild-type mice. In contrast, HFs of Hr ^Hp /Hr ^Hp mice became cyst-like structures by postnatal day (P) 21. The number and length of vibrissae decreased in a dose-dependent manner as the number of mutant alleles increased. A positional candidate gene approach was used to identify the gene responsible for the hairpoor phenotype. Genetic linkage analysis determined that the hairpoor locus is 2 cm from D14Mit34 on chromosome 14. Sequence analysis of the exons of the candidate gene hairless revealed a T-to-A transversion mutation at nucleotide position 403 (exon 2), presumably resulting in abolishment of an upstream open reading frame (uORF). In addition, we also found that the near-naked mouse (Hr ^N ), a spontaneously arising mutant, harbors a A402G transition in its genome. Both mutations were in the uATG codon of the second uORF in the 5′ UTR and corresponded to the mutations identified in Marie Unna Hereditary Hypotrichosis (MUHH) patients. In the present study we describe the phenotype, histological morphology, and molecular etiology of an animal model of MUHH, the hairpoor mouse. Electronic supplementary material  The online version of this article (doi:) contains supplementary material, which is available to authorized users. I. C. Baek and J. K. Kim contributed equally to this work.     

Facial morphology and vibrissal movement in the golden hamster

The major cranial vibrissae in the golden hamster can be moved in complex ways that suggest they are served by a finely controlled motor system. Movements are hypothesized to be the products of differential blood flow and pressure regulation in the sinus surrounding each vibrissal follicle, contractions of the striated facial muscles, and elastic rebound in the connective tissues. The vasculature contributes hydrostatic forces that erect the vibrissae slightly and distort their connective tissue bedding, rigidify the vibrissal capsules, thus forming firm bases of attachment for certain facial muscles, and theoretically provide a pressure plate around the follicle, important in lowering the firing thresholds of receptor endings. The facial muscles supply the major forces in erection and protraction of the vibrissae by acting on both the capsules and the connective tissue bedding. The connective tissues are organized into capsular and extracapsular systems that serve to stabilize the vibrissae and return them to initial rest positions. The slight movements of the genal vibrissa are the effects of vascular and connective tissue dynamics, the musculature being uninvolved. Wide angle movements of the supraorbital vibrissae are products of the vasculature and connective tissues, plus contractions of the Mm. orbicularis oculi and frontalis. Mystacial vibrissal movement is quite complex. The vasculature supplies a small degree of capsular erection and mystacial pad distortion, but primarily rigidifies the capsules. The bulk of erection and protraction is produced by the M. nasolabialis profundus (NLP) and the vibrissal capsular muscles (VCM). The NLP distorts the mystacial pad; the VCM tilt the capsules relative to the pad. Retraction is mainly accomplished by elastic rebound in the pad, this being aided in its extreme degrees by the Mm. nasolabialis and maxillolabialis. The Mm. nasolabialis superficialis and buccinator pars orbicularis oris help to spread the vibrissae into a dorsoventral fan and stabilize the mystacial pad during whisking.     

Dermal cysts participate in reparative regeneration of epidermis in Hrhr/Hrhr mice

One of the phenotypic effects of mutation in the Hr gene in mice is disintegration of hair follicles and their degeneration into open funnel-shaped structures (utricles) opened on skin surface and cysts located in the depth of the dermis. The aim of the current study consists in analysis of the process of reparative regeneration of skin in homozygotous mice with one of the mutant alleles of the Hr gene—Hr ^hr . It is shown that epithelial cells that constitute the inner pavement of cysts take part in the process of epithelization of deep skin wounds. This indicates that the competence of ectodermal cells in relation to inductive signals from injured skin remains in Hr ^hr homozygote mice, in spite of the significant anatomic abnormalities of the hair follicles.     

Response of moist-air receptor on antenna of the stick insect,Carausius morosus,to step changes in temperature

Summary The moist-air sensory cell in the antennal mound-shaped sensillum of Carausius responds to changes in relative humidity brought about by changing either the temperature (T) of the air or the partial pressure of water vapor (Pw) (Figs. 1, 5). When changes in either parameter cause relative humidity (Hr) to rise between roughly 5% and 55%, the same Hr-changes elicit very close to the same responses, no matter how Hr is changed (Figs. 2, 3). Even the resolving power for upward Hr-steps produced by lowering T is very close to that produced by raising Pw: 7.4% vs. 6.3%. Thus upward transients in impulse frequency (F) may be read off directly as quantitative rises in Hr. Whether the rise in Hr as signalled by the moist-air cell is the result of a rise in Pw or of a drop in T could well be indicated by the simultaneous reactions of the cold and dry-air cells (Figs. 1, 5). The moist-air cell also reacts to downward step changes in Hr, but very differently, depending on how they are brought about. Upward steps in T have a much larger effect on F than corresponding downward steps in Pw (Fig. 4). This result demonstrates that changes in relative humidity do not suffice to explain the changes in the activity of the moist-air cell. The receptor may be better construed as bimodal, reacting to changes in T and Pw with independent sensitivities and well matched to relative humidity when changes in either lead to increases in this parameter. The moistair cell's responses to T-steps at Pw = 0 (Figs. 1, 5) offer some support for this interpretation.Abbreviations F impulse frequency in impulses/s (imp/s) - Hr relative humidity in % - Ps saturation pressure of water vapor in torr - Pw partial pressure of water vapor in torr - r correlation coefficient - T temperature in °C     

Zygosity Determination in Hairless Mice by PCR Based on Hrhr Gene Analysis

We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hr^hr allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hr^hr in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hr^hr allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hr^hr (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hr^hr gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age.     

Distribution of subgroups of neuropeptide Y-immunoreactive and noradrenergic nerves in the female rat uterine cervix

Summary Nerves in the uterine cervix of the rat were examined with regard to co-existence of markers for noradrenaline and neuropeptide Y, and differential tissue innervation by nerves containing different combinations of these markers. Immunohistochemical labeling of single and adjacent serial cryostat sections, and double labeling was employed. Some animals were treated with the noradrenergic neurotoxin, 6-hydroxydopamine. In control animals neuropeptide Y-immunoreactive fibers were numerous in the myometrium and around arteries; noradrenergic fibers were few in the myometrium and moderate in number around arteries. Myometrial neuropeptide Y-immunoreactive fibers were not decreased, but apparently increased, in 6-hydroxydopamine-treated rats; in contrast, perivascular neuropeptide Y-immunoreactive fibers were markedly reduced, but not totally absent. Noradrenergic fibers were absent in the myometrium and around arteries following 6-hydroxydopamine treatment. Labeling of adjacent sections and double labeling revealed coincident labeling of markers for neuropeptide Y and noradrenaline in perivascular, but not myometrial, nerves. We concluded that most myometrial neuropeptide Y-immunoreactive nerves did not contain noradrenaline since they were not sensitive to 6-hydroxydopamine and did not stain doubly; however, perivascular neuropeptide Y-immunoreactive fibers which degenerated after 6-hydroxydopamine treatment and did label doubly must co-store noradrenaline. Some neuropeptide Y-immunoreactive perivascular fibers may contain neuropeptide Y but not noradrenaline. Thus, it appears there is a differential innervation of tissues in the cervix by neuropeptide Y/noradrenergic nerves; this could reflect a differential regulation of tissues innervated by these nerves.     

Immunohistochemical properties of nerve fibres supplying accessory male genital glands in the pig. A colocalisation study

 Immunohistochemical studies have been performed to investigate the occurrence and coexistence of two catecholamine-synthesising enzymes, tyrosine hydroxylase and dopamine-β-hydroxylase, and several neuropeptides, including neuropeptide Y, vasoactive intestinal polypeptide, Leu⁵-enkephalin, somatostatin, calcitonin gene-related peptide and substance P, in nerve fibres supplying porcine accessory genital glands, the seminal vesicles, prostate (body and the disseminated part) and bulbourethral glands. Three major populations of nerve fibres supplying non-vascular elements of the glands have been distinguished (from the largest to the smallest one): (1) noradrenergic fibres, the majority of which contain Leu⁵-enkephalin, neuropeptide Y or, to a lesser extent, somatostatin, (2) non-noradrenergic, putative cholinergic fibres containing vasoactive intestinal polypeptide, neuropeptide Y and/or somatostatin and, (3) non-noradrenergic, presumably sensory fibres, containing calcitonin gene-related peptide and substance P. Whilst the coexistence patterns within nerves supplying particular glands are similar, the density of innervation varies between the organs. The innervation of the seminal vesicles and prostatic body is more developed than that of the disseminated part of the prostate and bulbourethral glands. The majority of noradrenergic fibres related to blood vessels contain neuropeptide Y only, while the non-noradrenergic nerves contain mainly vasoactive intestinal polypeptide. The possible function and origin of particular nerve fibre populations are discussed. Accepted: 16 November 1998     

Impact of surgically induced weight loss on cardiovascular autonomic function: one-year follow-up

Objective: To determine the impact of surgically induced weight loss on cardiovascular autonomic function in subjects with severe obesity and examine whether the effect was comparable for persons with and without diabetes. Research Methods and Procedures: Twenty‐six severely obese individuals (BMI = 48 ± 7 kg/m²) underwent bariatric surgery (laparoscopic Roux‐en‐Y gastric bypass, n = 21; laparoscopic adjustable gastric banding, n = 5). Cardiovascular autonomic function (heart rate variation during deep breathing and the Valsalva maneuver) was assessed before and 6 and 12 months after surgery. Results: Twelve months after bariatric surgery, there was a 28% decrease in BMI. There was an increase in all parasympathetic indices of autonomic function (all assessment modalities, p < 0.05) with weight loss. The amount of improvement from baseline for all measures of autonomic function did not differ for those with or without diabetes. Discussion: Surgically induced weight loss 12 months after surgery has a favorable effect on cardiovascular autonomic function in severely obese individuals with and without diabetes.     

Neuropeptide Y immunoreactivity in the mammalian liver: pattern of innervation and coexistence with tyrosine hydroxylase immunoreactivity

Summary The distribution of nerve fibers displaying neuropeptide Y immunoreactivity in relationship to the catecholaminergic innervation of rat, guinea pig, and rabbit liver was investigated by single- and double-label immunofluorescence methods. In all three species, neuropeptide Y-immunoreactive fibers are prominent in association with the vasculature, biliary pathway, and stromal compartment. The neuropeptide Y innervation of the parenchyma, on the other hand, differs among the three species in term of density. It is quite sparse in the rat and rabbit, particularly in the former species. In the guinea pig liver, numerous single, varicose neuropeptide Y-containing nerve fibers innervate the hepatic parenchyma; often, thin processes surround single hepatocytes and lie close to sinusoids. The immunoreactive pattern of tyrosine hydroxylase, a marker for catecholaminergic neurons and fibers, is comparable to that of neuropeptide Y. Most neuropeptide Y-containing nerve fibers also contain tyrosine hydroxylase immunoreactivity, in all three species, with the exception of the rabbit parenchyma, where a substantial proportion of catecholaminergic fibers lack immunoreactivity for neuropeptide Y. Finally, systemic administration of the sympathetic neurotoxin, 6-hydroxydopamine, in rats and guinea pigs resulted in virtually complete elimination of both neuropeptide Y- and tyrosine hydroxylase-immunoreactive fibers. These findings are consistent with the hypothesis that neuropeptide Y-containing nerve fibers form a subpopulation of the sympathetic innervation of the mammalian liver, which is likely to originate from prevertebral sympathetic ganglia.     

Distribution of peptidergic nerve fibres in bullfrog lingual papillae demonstrated by a combination of double immunofluorescence labelling and a multiple dye filter

Summary Immunoreactivity of substance P, calcitonin gene-related peptide, vasoactive intestinal polypeptide, neuropeptide Y, and galanin is localized in nerve fibres distributed in the fungiform and filiform papillae of the tongue of the bullfrog,Rana catesbeiana. A combination of indirect double immunofluorescence labelling and a multiple dye filter system clearly demonstrated that all substance P fibres in the connective tissue core of the fungiform and filiform papillae, and within the rim of ciliated cells located on the top of the fungiform papillae showed coexistence with calcitonin gene-related peptide. A few fibres in the epithelial discs, which are located in the centre of the top of the fungiform papillae, showed the immunoreactivity of calcitonin gene-related peptide alone. There were no substance P fibres which showed coexistence with vasoactive intestinal polypeptide, galanin, and neuropeptide Y. In high magnification images, substance P and vasoactive intestinal polypeptide, and substance P and galanin fibres were recognized as two interwined fibres within the same thin nerve bundle. No immunoreactivity of leucine- and methionine-enkephalins can be detected. These findings suggest that the chemoreceptor function of the bullfrog gustatory organ may be under the control of complicated peptidergic innervation.