Short-range RNA-RNA crosslinking methods to determine rRNA structure and interactions

We describe details of procedures to analyze RNA-RNA crosslinks made by far-UV irradiation (< 300 nm) or made by irradiation with near-UV light (320-365 nm) on RNA containing photosensitive nucleotides, in the present case containing 4-thiouridine. Zero-length crosslinks of these types must occur because of the close proximity of the participants through either specific interactions or transient contacts in the folded RNA structure, so they are valuable monitors of the conformation of the RNA. Procedures to produce crosslinks in the 16S ribosomal RNA and between the 16S rRNA and mRNA or tRNA are described. Gel electrophoresis conditions are described that separate the products according to their structure to allow the determination of the number and frequency of the crosslinking products. Gel electrophoresis together with an ultracentrifugation procedure for the efficient recovery of RNA from the polyacrylamide gels allows the purification of molecules containing different crosslinks. These separation techniques allow the analysis of the sites of crosslinking by primer extension and RNA sequencing techniques. The procedures are applicable to other types of RNA molecules with some differences to control levels of crosslinking and separation conditions.     

Neighborhood of 16S rRNA nucleotides U788/U789 in the 30S ribosomal subunit determined by site-directed crosslinking.

Site-specific photo crosslinking has been used to investigate the RNA neighborhood of 16S rRNA positions U788/ U789 in Escherichia coli 30S subunits. For these studies, site-specific psoralen (SSP) which contains a sulfhydryl group on a 17 A side chain was first added to nucleotides U788/U789 using a complementary guide DNA by annealing and phototransfer. Modified RNA was purified from the DNA and unmodified RNA. For some experiments, the SSP, which normally crosslinks at an 8 A distance, was derivitized with azidophenacylbromide (APAB) resulting in the photoreactive azido moiety at a maximum of 25 A from the 4' position on psoralen (SSP25APA). 16S rRNA containing SSP, SSP25APA or control 16S rRNA were reconstituted and 30S particles were isolated. The reconstituted subunits containing SSP or SSP25APA had normal protein composition, were active in tRNA binding and had the usual pattern of chemical reactivity except for increased kethoxal reactivity at G791 and modest changes in four other regions. Irradiation of the derivatized 30S subunits in activation buffer produced several intramolecular RNA crosslinks that were visualized and separated by gel electrophoresis and characterized by primer extension. Four major crosslink sites made by the SSP reagent were identified at positions U561/U562, U920/U921, C866 and U723; a fifth major crosslink at G693 was identified when the SSP25APA reagent was used. A number of additional crosslinks of lower frequency were seen, particularly with the APA reagent. These data indicate a central location close to the decoding region and central pseudoknot for nucleotides U788/U789 in the activated 30S subunit.     

Sequence determination of rat U5 RNA using a chemical modification procedure for counteracting sequence compression

Using post-labeling techniques, the nucleotide sequence of a major species of U5 RNA isolated from rat liver was determined to be: XpppAmUmACUCUGGUUUCUCUUCAGAUCGUAUAAAUCUUUCGmCCUUmUpsiACmNAAAGAUpsiUCCGUGGAGAGGA ACAACUCUGAGUCUUAAACCAAUUUUUUGAGGCCUUGUCUUGA(G)CAAGGCUOH. The 5'-end of the RNA is blocked with a cap structure. In addition to the modified nucleotides around the 5'-end (XpppAmUmA), U5 RNA contains Gm at position 38, Um at position 42, psi at position 44, Cm at position 46, N at position 47, and psi at position 54 as modified nucleotides. U5 RNA is present as a mixture of several species with microheterogeneity, whose lengths are 117, 118, or 119 nucleotides. The major species, with 117 nucleotides, comprised approximately 60% of the total U5 RNA. A region near the 3'-end forms a stable second structure, which causes sequence compression on electrophoresis in polyacrylamide gel. To surmount with this obstacle, we developed a chemical modification procedure with sodium bisulfite prior to partial hydrolysis in formamide, which allows denaturation of the secondary structure in polyacrylamide gel containing 7 M urea. The procedure provides a good system for checking RNA sequences determined by electrophoresis in polyacrylamide gel which might have apparent deletions on account of sequence compression.     

Probing of the spliceosome with site-specifically derivatized 5' splice site RNA oligonucleotides.

We have developed a site-specific chemical modification technique to incorporate a photoreactive azidophenacyl (APA) group at designated internal positions along the RNA phosphodiester backbone. Using this technique, we have analyzed interactions of the 5' splice site (5'SS) RNA within the spliceosome. Several crosslinked products can be detected within complex B using the derivatized 5'SS RNAs, including U6 snRNA, hPrp8p, and 114-, 90-, 70-, 54-, and 27-kDa proteins. The 5'SS RNAs derivatized at intron positions +4 to +8 crosslink to U6 snRNA, confirming the previously reported pairing interaction between these sequences. hPrp8p and p70 are crosslinked to the 5'SS RNA when the APA is placed within the 5' exon. Finally, a set of unidentified proteins, including p114, p54, and p27, is detected with the 5'SS RNA derivatized at intron positions +4 to +8. Introduction of the bulky APA group near the 5'SS junction (positions -2 to +3) strongly interferes with complex B formation and thus no APA crosslinks are observed at these positions. Together with our earlier observation that hPrp8p crosslinks to the GU dinucleotide at the 5' end of the intron, these results suggest that the inhibitory effect of APA results from steric hindrance of the hPrp8p:5'SS interaction. Unexpectedly, thio-modifications within the region of the 5'SS RNA that is involved in base pairing to U6 snRNA strongly stimulate complex B formation.     

Site-specific crosslinks of yeast U6 snRNA to the pre-mRNA near the 5' splice site.

We have introduced a single photochemical crosslinking reagent into specific sites in the central domain of U6 to identify the sites that are in close proximity to the pre-mRNA substrate. Four distinct U6 snRNAs were synthesized with a single 4-thiouridine (4-thioU) at positions 46, 51, 54, and 57, respectively. Synthetic U6 RNA containing the 4-thioU modifications can functionally reconstitute splicing activity in cell-free yeast splicing extracts depleted of endogenous U6 snRNA. Upon photoactivation with UV (>300 nm), 4-thioU at position 46 forms crosslinks to pre-mRNA near the 5' splice site at nt +4, +5, +6, and +7 in the intron, whereas 4-thioU at position 51 crosslinks to the pre-mRNA at positions -2, -1, +1, +2, +3, and at the invariant G in the lariat intermediate. All crosslinks are dependent on the presence of ATP and the splicing substrate. The two crosslinks to the pre-mRNA from position 46 and 51 of U6 can also occur in prp2 heat-inactivated yeast splicing extracts blocked immediately prior to the first chemical step. Significantly, the crosslink from position 51 can undergo subsequent splicing when the mutant extract is complemented with functional Prp2 protein in a chase experiment, indicating that the crosslink reflects a functional interaction that is maintained during the first step. The crosslink to lariat intermediate appears when the mutant spliceosomes are complemented with functional Prp2 protein added exogenously. This experiment is a paradigm for future studies in which different mutant extracts are used to establish the stage in assembly at which particular RNA-RNA interactions defined by unique crosslinks occur.     

Gel electrophoretic technique for separating crosslinked RNAs. Application to improved electron microscopic analysis of psoralen crosslinked 16 S ribosomal RNA

We have developed a gel electrophoresis technique for separating crosslinked RNA molecules into a series of discrete fractions. The gel used is polyacrylamide made in formamide and low salt designed to denature the RNA during electrophoresis. The mobility depends upon the position of crosslinking within each molecule, as demonstrated by electron microscopy of RNA eluted from the gel. In general, molecules with large loops electrophorese more slowly than molecules with small loops or uncrosslinked molecules. We have used this technique to re-examine the psoralen crosslinking pattern of Escherichia coli 16 S ribosomal RNA in inactivated 30 S ribosomal subunits. To determine the correct orientation of each type of crosslink, we have covalently attached DNA restriction fragments to the RNA so that the polarity of the RNA in the microscope would be known. Our previous major conclusions are confirmed: the predominant long-distance crosslink detected by gel electrophoresis involves a residue close to the 3′ end and a residue approximately 600 nucleotides away: the formamide/polyacrylamide gel is able to separate two closely spaced 1100-nucleotide interactions beginning close to the 3′ end, which were reported as one interaction before: and an interaction joining the ends is detected as before. However, one low-frequency crosslinked interaction, between positions 950 and 1400, and possibly another low-frequency interaction, between positions 550 and 870, are determined to be in the opposite polarity to that described previously.     

Localization of a base-paired interaction between small nuclear RNAs U4 and U6 in intact U4/U6 ribonucleoprotein particles by psoralen cross-linking

The small nuclear RNAs U4 and U6 display extensive sequence complementarity and co-exist in a single ribonucleoprotein particle. We have investigated intermolecular base-pairing between both RNAs by psoralen cross-linking, with emphasis on the native U4/U6 ribonucleoprotein complex. A mixture of small nuclear ribonucleoproteins U1 to U6 from HeLa cells, purified under non-denaturing conditions by immune affinity chromatography with antibodies specific for the trimethylguanosine cap of the small nuclear RNAs was treated with aminomethyltrioxsalen. A psoralen cross-linked U4/U6 RNA complex could be detected in denaturing polyacrylamide gels. Following digestion of the cross-linked U4/U6 RNA complex with ribonuclease T1, two-dimensional diagonal electrophoresis in denaturing polyacrylamide gels was used to isolate cross-linked fragments. These fragments were analysed by chemical sequencing methods and their positions identified within RNAs U4 and U6. Two overlapping fragments of U4 RNA, spanning positions 52 to 65, were cross-linked to one fragment of U6 RNA (positions 51 to 59). These fragments show complementarity over a contiguous stretch of eight nucleotides. From these results, we conclude that in the native U4/U6 ribonucleoprotein particle, both RNAs are base-paired via these complementary regions. The small nuclear RNAs U4 and U6 became cross-linked in the deproteinized U4/U6 RNA complex also, provided that small nuclear ribonucleoproteins were phenolized at 0 degree C. When the phenolization was performed at 65 degrees C, no cross-linking could be detected upon reincubation of the dissociated RNAs at lower temperature. These results indicate that proteins are not required to stabilize the mutual interactions between both RNAs, once they exist. They further suggest, however, that proteins may well be needed for exposing the complementary RNA regions for proper intermolecular base-pairing in the course of the assembly of the U4/U6 RNP complex from isolated RNAs. Our results are discussed also in terms of the different secondary structures that the small nuclear RNAs U4 and U6 may adopt in the U4/U6 ribonucleoprotein particle as opposed to the isolated RNAs.     

Structure of the Escherichia coli 16 S ribosomal RNA. Psoralen crosslinks and N-acetyl-N'-(p-glyoxylylbenzoyl)cystamine crosslinks detected by electron microscopy

Escherichia coli 16 S ribosomal RNA in reconstitution buffer has been photochemically crosslinked with aminomethyltrimethylpsoralen and chemically crosslinked with N-acetyl-N'-(p-glyoxylylbenzoyl)cystamine. The positions of crosslinking have been detected by viewing the molecules in the electron microscope. DNA restriction fragments that contain psoralen mono-adducts were hybridized and crosslinked to the samples so that the orientations of the crosslinked molecules were seen directly. A two-dimensional histogram method has been used to classify the different types of looped crosslinked molecules. These methods allow the identification of 13 distinct types of loops in the photochemically crosslinked molecules and 31 distinct types of loops in the chemically crosslinked molecules. The psoralen experiments are a reinvestigation of some of our earlier results. Some of the crosslinks were previously reported in the incorrect orientation; with the corrected orientation, seven of the psoralen crosslinks can now be correlated with complementarities in the proposed secondary-structure models. However, there are still six other psoralen crosslinks that indicate additional contacts not found in the current models. The chemical crosslinks indicate pairs of single-stranded regions that must be close in the folded molecule. Many of these crosslinks occur between regions that are distant in the secondary structure; these crosslinks indicate part of the three-dimensional form of the folded molecule.     

A covariant change of the two highly conserved bases in the GTPase-associated center of 28 S rRNA in silkworms and other moths

The GTPase-associated center in 23/28 S rRNA is one of the most conserved functional domains throughout all organisms. We detected a unique sequence of this domain in Bombyx mori species in which the bases at positions 1094 and 1098 (numbering from Escherichia coli 23 S rRNA) are C and G instead of the otherwise universally conserved bases U and A, respectively. These changes were also observed in four other species of moths, but not in organisms other than the moths. Characteristics of the B. mori rRNA domain were investigated by native polyacrylamide gel electrophoresis using RNA fragments containing residues 1030-1128. Although two bands of protein-free RNA appeared on gel, they shifted to a single band when bound to Bombyx ribosomal proteins Bm-L12 and Bm-P complex, equivalent to E. coli L11 and L8, respectively. Bombyx RNA showed lower binding capacity than rat RNA for the ribosomal proteins and anti-28 S autoantibody, specific for a folded structure of the eukaryotic GTPase-associated domain. When the C(1094)/G(1098) bases in Bombyx RNA were replaced by the conserved U/A bases, the protein-free RNA migrated as a single band, and the complex formation with Bm-L12, Bm-P complex, and anti-28 S autoantibody was comparable to that of rat RNA. The results suggest that the GTPase-associated domain of moth-type insects has a labile structural feature that is caused by an unusual covariant change of the U(1094)/A(1098) bases to C/G.     

Recent approaches to probe functional groups in ribonuclease P RNA by modification interference

Modification interference is a powerful method to identify important functional groups in RNA molecules. We review here recent developments of techniques to screen for chemical modifications that interfere with (i) binding of(pre-)tRNA to bacterial RNase P RNA or (ii) pre-tRNA cleavage by this ribozyme. For example, two studies have analyzed positions at which a substitution of sulfur for thepro-Rp oxygen affects tRNA binding [1] or catalysis [2]. The results emphasize the functional key role of a central core element present in all known RNase P RNA subunits. The four sulfur substitutions identified in one study [2] to inhibit the catalytic step also interfered with binding of tRNA toE. coli RNase P RNA [1]. This suggests that losses in binding energy due to the modification at these positions affect the enzyme-substrate and the enzyme-transition state complex. In addition, the two studies have revealed, for the first time, sites of direct metal ion coordination in RNase P RNA. The potentials, limitations and interpretational ambiguities of modification interference experiments as well as factors influencing their outcome are discussed.Abbreviations nt nucleotide(s) - PAGE polyacrylamide gel electrophoresis