DESCRIPTION AND CHARACTERIZATION OF THE ALGAL SPECIES AUREOUMBRA LAGUNENSIS GEN. ET SP. NOV. AND REFERRAL OF AUREOUMBRA AND AUREOCOCCUS TO THE PELAGOPHYCEAE1

The Texas brown tide alga (strain TBA-2) is described as Aureoumbra lagunensis Stockwell, DeYoe, Hargraves, et Johnson, gen. et sp. nov. Pigment composition, chloroplast structure, and 18s ribosomal RNA gene sequence data indicate that A. lagunensis and the east coast brown tide alga Aureococcus anophagefferens (originally placed in the Chrysophyceae) belong in the class Pelagophyceae. The new genus Aureoumbra with A. lagunensis as the type species differs from Aureococcus in 18s ribosomal RNA gene sequence, pyrenoid form, nitrogen physiology, and possession of basal bodies. The genus Aureococcus is placed in the order Pelagomonadates and family Pelagomonadaceae while ordinal placement of Aureoumbra is deferred.     

Analysis of the Cluster of Ribosomal Protein Genes in the Plastid Genome of a Unicellular Red Alga Cyanidioschyzon merolae: Translocation of the str Cluster as an Early Event in the Rhodophyte-Chromophyte Lineage of Plastid Evolution

The nucleotide sequence of a cluster of ribosomal protein genes in the plastid genome of a unicellular red alga, Cyanidioschyzon merolae, which has been supposed to be the most primitive alga, was determined. The phylogenetic tree inferred from the amino acid sequence of ribosomal proteins of two rhodophytes, a chromophyte, a glaucophyte, two chlorophytes (land plants), a cyanobacterium, and three eubacteria suggested a close relationship between the cyanobacterium Synechocystis PCC6803 and the plastids of various species in the kingdom Plantae, which is consistent with the hypothesis of the endosymbiotic origin of plastids. In this tree, the two species of rhodophytes were grouped with the chromophyte, and the glaucophyte was grouped with the chlorophytes. Analysis of the organization of the genes encoding the ribosomal proteins suggested that the translocation of the str cluster occurred early in the lineage of rhodophytes and chromophytes after these groups had been separated from chlorophytes and glaucophytes. Received: 2 June 1997 / Accepted: 15 July 1997     

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.     

A NEW PHYLOGENY FOR CHROMOPHYTE ALGAE USING 16S-LIKE RRNA SEQUENCES FROM MALLOMONAS PAPILLOSA (SYNUROPHYCEAE) AND TRIBONEMA AEQUALE (XANTHOPHYCEAE)1

The 16S-like ribosomal RNA genes from Mallomonas papillosa Harris et Bradley (Synurophyceae) and Tribonema aequale Pascher (Xanthophyceae) were sequenced and compared to those of other eukaryotes. Mallomonas is closely related to Ochromonas (Chrysophyceae) and supports the general hypothesis of a close phylogenetic relationship between the Synurophyceae and Chrysophyceae. Tribonema is specifically related to Costaria costata (C. A. Agardh) Saunders (Phaeophyceae) demonstrating an unexpected phylogenetic relationship between the Xanthophyceae and Phaeophyceae. Distance and parsimony analysis place these four chromophyte genera in a complex evolutionary assemblage that includes the Bacillariophyceae and Oomycetes but excludes the Dinophyceae. The close relationship between the chromophyte algae and the Öomycete fungi supports the hypothesis that protists with tripartite hairs form a natural assemblage.     

Molecular evolution of a plastid tandem repeat locus in an orchid lineage

The molecular evolution of a chloroplast minisatellite locus in the Anacamptis palustris (Orchidaceae) lineage and haplotype variation in two Italian A. palustris populations were investigated. A phylogenetic analyses of the chloroplast tRNA(LEU) intron, where the minisatellite locus is located, revealed that a deletion in the ancestor of the A. palustris lineage led to the formation of two noncontiguous, complementary sequence motifs. We propose a model to explain the initial formation of the minisatellite repeat motif, starting with the two noncontiguous, complementary sequence motifs. A survey of minisatellite variation in four species of the A. palustris lineage revealed several haplotypes that differed not only in repeat number, but also in repeat organization. A haplotype network suggests that three different minisatellite loci evolved independently at the same position in the tRNA(LEU) intron. A secondary structure model revealed that the A. palustris minisatellite repeat forms a stem region of the tRNA(LEU) intron, which allows its notable expansion without negatively affecting splicing. Minisatellite variation was high in the two examined A. palustris populations where 20 haplotypes were detected, whereas no length variation was detected in a neighboring poly (A) microsatellite locus. We estimated a chloroplast minisatellite mutation rate of 3.2 x 10(-3) mutations per generation. Southern blot analyses did not find evidence for chloroplast heteroplasmy. Based on the analysis of the largest known, extant A. palustris population, a stepwise mutation model (SMM) was inferred.     

A MOLECULAR PHYLOGENY OF THE HETEROKONT ALGAE BASED ON ANALYSES OF CHLOROPLAST-ENCODED rbcL SEQUENCE DATA1

Nearly complete ribulose-1,5-bisphosphate carboxylase/ oxygenase (rbcL)sequences from 27 taxa of heterokont algae were determined and combined with rbcL sequences obtained from GenBank for four other heterokont algae and three red algae. The phylogeny of the morphologically diverse haterokont algae was inferred from an unambiguously aligned data matrix using the red algae as the root, Significantly higher levels of mutational saturation in third codon positions were found when plotting the pair-wise substitutions with and without corrections for multiple substitutions at the same site for first and second codon positions only and for third positions only. In light of this observation, third codon positions were excluded from phylogenetic analyses. Both weighted-parsimony and maximum-likelihood analyses supported with high bootstrap values the monophyly of the nine currently recognized classes of heterokont algae. The Eustigmatophyceae were the most basal group, and the Dictyochophyceae branched off as the second most basal group. The branching pattern for the other classes was well supported in terms of bootstrap values in the weightedparsimony analysis but was weakly supported in the maximum-likelihood analysis (<50%). In the parsimony analysis, the diatoms formed a sister group to the branch containing the Chrysophyceae and Synurophyceae. This clade, charactetized by siliceous structures (frustules, cysts, scales), was the sister group to the Pelagophyceae/Sarcinochrysidales and Phaeo-/Xantho-/ Raphidophyceae clades. In the latter clade, the raphido-phytes were sister to the Phaeophyceae and Xanthophyceae. A relative rate test revealed that the rbcL gene in the Chrysophyceae and Synurophyceae has experienced a significantly different rate of substitutions compared to other classes of heterokont algae. The branch lengths in the maximum-likelihood reconstruction suggest that these two classes have evolved at an accelerated rate. Six major carotenoids were analyzed cladistically to study the usefulness of carotenoid pigmentation as a class-level character in the heterokont algae. In addition, each carotenoid was mapped onto both the rbcL tree and a consensus tree derived from nuclear-encoded small-subunit ribosomal DNA (SSU rDNA) sequences. Carotenoid pigmentation does not provide unambiguous phylogenetic information, whether analyzed cladistically by itself or when mapped onto phylogenetic trees based upon molecular sequence data.     

Phylogenetic analysis of the SSU rRNA from members of the Chrysophyceae

The nucleotide sequence for the nuclear-encoded small subunit ribosomal RNA gene (SSU rRNA) was determined for 24 species of the Chrysophyceae sensu stricto. These sequences were aligned, using primary and secondary structure, with nine previously published sequences for the Chrysophyceae, 14 for the Synurophyceae, and five for the Eustigmatophyceae (outgroup). Data analyses were the substitution rate calibration distance method using neighbor-joining (TREECON), Kimura 2-parameter neighbor-joining method (PAUP) and the maximum parsimony method (PAUP, PHYLIP). Trees from the analyses were largely congruent, but bootstrap support was weak at many nodes. The analyses recovered clades of uniflagellate and biflagellate organisms associated with current higher level taxonomy (e.g., subclass, order). The genus Ochromonas was polyphyletic, and O. tuberculata in particular was distantly related to the other Ochromonas species in the analysis. The family Paraphysomonadaceae occupied a basal position in three of four analyses. The class Synurophyceae appeared to be embedded within the Chrysophyceae, but bootstrap support was weak (< 50%) in all analyses except the PHYLIP parsimony analysis (= 81%). It was considered premature to place the Synurophyceae back into the Chrysophyceae based upon the analysis of one gene, especially given the ultrastructural and pigment differences between the two groups, but the relationship of these two groups deserves further study.     

Sequence analysis of the cryptic plasmid pMG101 from Rhodopseudomonas palustris and construction of stable cloning vectors

A 15-kb cryptic plasmid was obtained from a natural isolate of Rhodopseudomonas palustris. The plasmid, designated pMG101, was able to replicate in R. palustris and in closely related strains of Bradyrhizobium japonicum and phototrophic Bradyrhizobium species. However, it was unable to replicate in the purple nonsulfur bacterium Rhodobacter sphaeroides and in Rhizobium species. The replication region of pMG101 was localized to a 3.0-kb SalI-XhoI fragment, and this fragment was stably maintained in R. palustris for over 100 generations in the absence of selection. The complete nucleotide sequence of this fragment revealed two open reading frames (ORFs), ORF1 and ORF2. The deduced amino acid sequence of ORF1 is similar to sequences of Par proteins, which mediate plasmid stability from certain plasmids, while ORF2 was identified as a putative rep gene, coding for an initiator of plasmid replication, based on homology with the Rep proteins of several other plasmids. The function of these sequences was studied by deletion mapping and gene disruptions of ORF1 and ORF2. pMG101-based Escherichia coli-R. palustris shuttle cloning vectors pMG103 and pMG105 were constructed and were stably maintained in R. palustris growing under nonselective conditions. The ability of plasmid pMG101 to replicate in R. palustris and its close phylogenetic relatives should enable broad application of these vectors within this group of alpha-proteobacteria.     

Multiple copies of the coding regions for the light-harvesting B800-850 alpha- and beta-polypeptides are present in the Rhodopseudomonas palustris genome.

A reverse-phase HPLC System for isolation of the water insoluble alpha- and beta-polypeptides of the light-harvesting complex II (LH II) of Rhodopseudomonas (Rps.) palustris without employment of any detergent was developed. The material obtained was of high purity and suitable for direct microsequence analysis. Chromatographic analysis could resolve at least two major beta-polypeptides, beta a and beta b, two major alpha-polypeptides, alpha a and alpha b, and two additional minor polypeptides. N-terminal amino acid sequencing shows that the resolved peaks correspond to different polypeptide species and that the minor species have an N-terminal sequence identical to that of the alpha b polypeptide. An oligonucleotide derived from the amino terminal sequence of the alpha a polypeptide was utilized to screen a genomic library from Rps.palustris. Several independent clones have been characterized by Southern blot and nucleotide sequence analysis. We show that Rps.palustris contains at least four different clusters of beta and alpha genes. Two clones contain sequences potentially coding for beta a-alpha a and beta b-alpha b polypeptides; and two additional clones potentially coding for beta and alpha peptides which we named beta c-alpha c and beta d-alpha d, which did not correspond to the major purified polypeptides. In addition to the protein chemistry data, the conservation at the amino acid level and the presence of canonical ribosomal binding sites upstream of each of the identified genes strongly suggest that all four coding regions are expressed.     

High diversity of the 'Spumella-like' flagellates: an investigation based on the SSU rRNA gene sequences of isolates from habitats located in six different geographic regions

We isolated 28 strains of 'Spumella-like' flagellates from different freshwater and soil habitats in Austria, People's Republic of China, Nepal, New Zealand, Uganda, Kenya, Tanzania and Hawaii by use of a modified filtration-acclimatization method. 'Spumella-like' flagellates were found in all of the samples and were often among the dominant bacterivorous flagellates in the respective environments. The small subunit ribosomal RNA (SSU rRNA) gene sequence of the isolates was determined and aligned with previously published sequences of members belonging to the Chrysophyceae sensu stricto. Phylogenetic analysis of the 28 new sequences confirmed their position within the Chrysophyceae sensu stricto and positioned them within different clades. Most of the sequences grouped within clade C and formed several subclusters separated from each other by green taxa including flagellates belonging to Ochromonas, Dinobryon, Poterioochromonas and others. All soil isolates clustered together (subcluster C1) with the soil strain Spumella elongata and the undescribed soil strain 'Spumella danica'. Aquatic isolates were affiliated with at least two branches (C2 and C3). Sequence similarity to the closest related member of the Chrysophyceae ranged between 92% and 99.6%, sequence divergence among the 'Spumella-like' flagellates was as high as 10%. We conclude that (i) the 'Spumella-like' flagellates are a diverse group both in terms of sequence dissimilarity between isolates and in terms of the number of genotypes, (ii) Spumella and Ochromonas are polyphyletic, and (iii) based on the SSU rRNA gene no biogeographical restriction of certain branches could be observed even though different ecotypes may be represented by the same genotype.     

The unusually long small subunit ribosomal RNA gene found in amitochondriate amoeboflagellate Pelomyxa palustris: its rRNA predicted secondary structure and phylogenetic implication

In order to ascertain a phylogenetic position of the freshwater amitochondriate amoeboflagellate Pelomyxa palustris its small subunit (SSU) rRNA gene was amplified and sequenced. It was shown to be 3502 bp long. The predicted secondary structure of its rRNA includes at least 16 separate expansion zones located in all the variable regions (V1-V9), as well as in some conservative gene regions. Most insertions are represented by sequences of low complexity that have presumably arisen by a slippage mechanism. Relatively conservative, uniformly positioned motifs contained in regions V4 and V7, as well as in some others, made it possible to perform folding. In maximum likelihood, maximum parsimony, and neighbor-joining trees, P. palustris tends to cluster with amitochondriate and secondary lost mitochondria amoebae and amoeboflagellates Entamoeba, Endolimax nana, and Phreatamoeba balamuthi, comprising together with them and aerobic lobose amoebae Vannella, Acanthamoeba, Balamuthia, and Hartmannella a monophyletic cluster. Another pelobiont, Mastigamoeba invertens, does not belong to this cluster. No specific similarity was discovered between the SSU rRNA of P. palustris and amitochondriate taxa of 'Archezoa': Diplomonada, Parabasalia, Microsporidia. Pelomyxa palustris SSU rRNA does not occupy a basal position in the phylogenetic trees and could be ascribed to the so-called eukaryotic 'crown' group if the composition of the latter were not so sensitive to the methods of tree building. Thus, molecular and morphological data suggest that P. palustris represents a secondarily modified eukaryotic lineage.     

ULTRASTRUCTURE AND PIGMENTS OF TWO STRAINS OF THE PICOPLANKTONIC ALGA PELAGOCOCCUS SUBVIRIDIS (CHRYSOPHYCEAE)1

The organelle ultrastructure and photosynthetic pigments of a new isolate of the picoplanktonic alga Pelagococcus subviridis Norris from the East Australian Current was compared with the North Pacific Ocean type species. No differences in the ultrastructure of the two isolates were observed. Mitosis was studied in detail in the Australian strain, and showed two unusual features: the de novo appearance of centrioles prior to mitosis, and the formation of a small, extra-nuclear spindle. The major carotenoids in both strains were fucoxanthin and a 19′-butanoyloxyfucoxanthin-like pigment, with diadinoxanthin and diatoxanthin as secondary pigments. Several minor carotenoids have not yet been identified. In addition to chlorophylls a and c₂, a new chlorophyll c derivative (chlorophyll c₃), present in both strains, was separated by high-performance thin-layer chromatography (HPTLC). The Australian isolate, unlike the type material, showed no evidence of chlorophyllase activity during cell harvest and extraction. While the pigment composition suggests affinities with certain newly examined prymnesiophytes, organelle ultrastructure indicates Pelagococcus to be a member of the Chrysophyceae. Mitosis is, however, atypical of both Prymnesiophyceae and Chrysophyceae, and if this picoplanktonic alga is to be retained in the Chrysophyceae it must be seen as a most unusual member.     

Evolution of ITS1 rDNA in the Digenea (Platyhelminthes: Trematoda): 3′ End Sequence Conservation and Its Phylogenetic Utility

A comparison of ribosomal internal transcribed spacer 1 (ITS1) elements of digenetic trematodes (Platyhelminthes) including unidentified digeneans isolated from Cyathura carinata (Crustacea: Isopoda) revealed DNA sequence similarities at more than half of the spacer at its 3′ end. Primary sequence similarity was shown to be associated with secondary structure conservation, which suggested that similarity is due to identity by descent and not chance. Using an analysis of apomorphies, the sequence data were shown to produce a distinct phylogenetic signal. This was confirmed by the consistency of results of different tree reconstruction methods such as distance approaches, maximum parsimony, and maximum likelihood. Morphological evidence additionally supported the phylogenetic tree based on ITS1 data and the inferred phylogenetic position of the unidentified digeneans of C. carinata met the expectations from known trematode life-cycle patterns. Although ribosomal ITS1 elements are generally believed to be too variable for phylogenetic analysis above the species or genus level, the overall consistency of the results of this study strongly suggests that this is not the case in digenetic trematodes. Here, 3′ end ITS1 sequence data seem to provide a valuable tool for elucidating phylogenetic relationships of a broad range of phylogenetically distinct taxa. Received: 20 October 1997 / Accepted: 24 March 1998     

Structure, expression and products of the ribosomal RNA operons of Rhodopseudomonas palustris No. 7

Rhodopseudomonas palustris strains carry one or two ribosomal rRNA operons, and those with duplicated rrn operons grow faster. The two rrn operons in R. palustris No. 7 are virtually identical over a 54,70-bp stretch containing the genes for 16S rRNA, tRNAile, tRNAala, 23S rRNA and 5S rRNA, as well as the intergenic spacers and part of the extragenic spacer. In R. palustris, unlike most bacteria with multiple rrn operons, the putative promoter sequences of the two operons are highly diverged, suggesting possible functional differentiation. By simultaneous primer-extension analysis of both pre-rRNAs, we detected a two-fold higher level of expression from rrnA under photoautotrophic conditions. Alteration of the conditions of growth leads to changes in the relative levels of expression of the two operons. Within the 5,470-bp segment, only two sequence differences are found between the 23S rRNA genes; one is at the center of the 23S rRNA molecule and affects a site of unknown function, and the other is within or immediately adjacent to sequences involved in processing of the 5' 23S rRNA IVS. In vitro processing of 5' IVS-containing 23S rRNA precursors from each operon does not reveal any detectable difference between them. The 5' ends of the mature 16S, 23S, and 5S rRNAs were determined by primer-extension analysis, and the 3' end of 23S rRNA was determined by RNA linker ligation-mediated cDNA cloning. The 5' and 3' ends of the R. palustris 23S rRNA molecule are extensively processed, suggesting that, unlike the situation in the established eubacterial model, these ends cannot basepair.     

Secondary structural modeling of the second internal transcribed spacer (ITS2) from Pfiesteria-like dinoflagellates (Dinophyceae)

Pfiesteria piscicida is a harmful bloom-forming alga that has received a great deal of attention due to its potential association with large fish kills and neurological problems in humans. Since the discovery of Pfiesteria, several other Pfiesteria-like dinoflagellates (PLDs) have also been identified. Genetic identification and phylogenetic relationships among the PLDs commonly utilize sequence data from the genes and spacers of the ribosomal DNA (rDNA) operon. Of these, the internal transcribed spacers (ITSs) have been previously shown to fold into secondary structures that are critical for proper ribosomal processing. In this study, we modeled the secondary structure of the second internal transcribed spacer (ITS2) from 16 PLDs (as well as an outgroup taxon) using phylogenetic comparative methods and minimum free energy. The secondary structural models predicted for these dinoflagellates consisted of four paired helices separated by five unpaired regions, consistent with those reported from many eukaryotes. All of the structures were highly stable (ΔG = ?66.1 to ?122.3 kcal·mol at 37 °C) and several structural characters were found to be conserved either across the PLDs or were specific to monophyletic subgroups, strengthening previously inferred phylogenetic relationships among taxa. Additionally, an 18 bp motif was identified in the PLDs whose position corresponds to a ribosomal processing site described from other eukaryotes. Potential applications of these ITS2 secondary structures include utility in strain and species identification, phylogenetic inference and serving as a tool for identifying and excluding rDNA pseudogenes when assessing biodiversity within the PLDs.     

Construction of phylogenetic tree of plant tubulins basing on the homology of their protein sequences

We have built phylogenetic tree of alpha-, beta- and gamma-tubulins of plant kingdom, alpha- and beta-tubulins of pig, and all epsilon- and delta-tubulins with known primary sequences and analyzed the levels of homology of tubulin sequences for repersentatives of different groups of organisms. It has been established low heterogeneity of alpha-, gamma-tubulin families and more than two fold higher heterogeneity of beta-tubulins, based on the sequence speciality of alga tubulins. We have showed that sequences of animal tubulins do not fit any cluster formed by on the plant tubulins. Presence in primary tubulin sequences of three major families of insignificant specific differences which are specific for such phylogenetic items of plant kingdom as alga and angiosperms has been also demostrated. The cladogramm shows clear clasterization of investigated sequences according to their belonging to the tubulin families.     

Long-Term Evolution of 5S Ribosomal DNA Seems to Be Driven by Birth-and-Death Processes and Selection in Ensis Razor Shells (Mollusca: Bivalvia)

A study of nucleotide sequence variation of 5S ribosomal DNA from six Ensis species revealed that several 5S ribosomal DNA variants, based on differences in their nontranscribed spacers (NTS), occur in Ensis genomes. The 5S rRNA gene was not very polymorphic, compared with the NTS region. The phylogenetic analyses performed showed a between-species clustering of 5S ribosomal DNA variants. Sequence divergence levels between variants were very large, revealing a lack of sequence homogenization. These results strongly suggest that the long-term evolution of Ensis 5S ribosomal DNA is driven by birth-and-death processes and selection.