Sterols of Candida tropicalis grown on N-alkanes

Six sterols isolated from the yeast Candida tropicalis were identified as ergosterol (major component), (22E)-ergosta-5,7,9(11),22-tetraen-3β     

Role of superoxide dismutase in the oxidation of N-alkanes by yeasts.

Yeast microorganisms from Candida genus are investigated for their superoxide dismutase (SOD) and catalase activity during cultivation on N-alkanes. The later caused a considerable increase of Cu/Zn SOD activity of yeast cells in comparison with glucose. A correlation between SOD and catalase activity existed. It is further observed that cells of Candida lipolytica 68-72 which contain a high level of Cu/Zn SOD were more resistant to lethality of exogenous O2-. An over-production of Cu/Zn SOD during the assimilation of N-alkanes by yeasts is also connected to their considerable resistance to increased concentrations of Cu2+ and Zn2+ ions in the nutrient medium. The results are consistent with the assumption that the enhanced resistance of yeast cells to O2- and high concentrations of Cu2+ and Zn(2+)-ions are due to the increased activity of Cu/Zn SOD and that SOD is involved in the protection of some cellular components. Polyacrylamide gel electrophoresis of Candida lipolytica cell-free extracts revealed the same chromatic bands of SOD activity under growth on glucose and N-alkanes. The type of the carbon source used from yeast cells as a single source of carbon and energy had no influence on the SOD profile of the cell.     

Conformation of viroids.

Viroids are uncoated infectious RNA molecules (MW 107 000-127 000) known as pathogens of certain higher plants. Thermodynamic and kinetic studies were carried out on highly purified viroid preparations by applying UV-absorption melting analysis and temperature jump methods. The thermal denaturation of viroids is characterized by high thermal stability, high cooperativity and a high degree of base pairing. Two relaxation processes could be resolved; a process in the sec range could be evaluated as an independent all-or-none-transition with the following properties: reaction enthalpy= 550 kcal/mol, activation enthalpy of the dissociation = 470 kcal/mol; G : C content = 72 %. These data indicate the existence of an uninterrupted double helix of 52 base pairs. A process in the msec range involves 15 - 25 base pairs which are most probably distributed over several short double helical stretches. A tentative model for the secondary structure of viroids isproposed and the possible functional implications of their physicochemical properties are discussed.     

N-alkanes in normal and pathological human scale

When $\text{n}\text{-}\text{alkanes}$ have been found in mammalian tissues, they have been considered to be solely of exogenous origin, and have not been assigned any normal or pathological function. We have observed $\text{n}\text{-}\text{alkanes}$ regularly in normal stratum corneum (5.5 ± 0.2% total lipid), and found striking accumulations (> 25% total lipid) in some scaling diseases. Although the origin of these $\text{n}\text{-}\text{alkanes}$ is not known, evidence is presented that they do not arise from external contaminants, medications, sebaceous glands, and spontaneous or bacterial degradation. The presence of large quantities of $\text{n}\text{-}\text{alkanes}$ in human stratum corneum suggests that they may play a role in normal human epidermal function and in the pathophysiology of some epidermal diseases.     

Conformation of uteroglobin fragments.

The conformation of three fragments of uteroglobin in aqueous solution and in the presence of SDS micelles is described. Two of these fragments correspond to helix II and helix III of uteroglobin, the crystal structure of which is made of four helices. The third peptide comprises helices II and III, with the connecting beta-turn. While helix II does not interact strongly with the micelles, helix III adopts a rather clear alpha-helix in this system. The elongation of helix III with the addition of helix II at the N-terminus somewhat stabilizes the ordered structure. It is possible that the beta-turn found in the crystal is also present in solution.     

Conformation of gonadotropin releasing hormone.

The conformation of the gonadotropin releasing hormone (Gn-RH), whose primary sequence is pGlu-His-Trp-Ser-Tyr-Gly-Leu-Arg-Pro-GlyNH2, and of several of its structural analogues has been studied by circular dichroism, optical rotatory dispersion, and fluorescence spectroscopy. The effects of pH, guanidine, and temperature on fluorescence emission have also been examined. Titration data demonstrate that the histidine and tyrosine residues are free of any mutual interactions. The similarity of emission spectra in water and in guanidine hydrochloride solutions precludes significant interactions between the fluorescent groups and other residues. Neither the temperature nor the pH profiles of the emission intensities of either tyrosine or tryptophan reveal any fixed secondary structure in Gn-RH. Both the extent of alkaline quenching and the distance of 10-11 A calculated from F?rster energy transfer theory are in accord with a randomly coiled structure with only one residue between tyrosine and tryptophan. Furthermore, the circular dichroism spectrum and optical rotatory dispersion do not exhibit any contributions from peptide bonds in an ordered structure, although there is a perturbation of the peptide absorption region due to overlapping bands from side-chain chromophores. Gn-RH, therefore, appears to behave as a random coil polypeptide in water devoid of any intrachain residue interactions. This nonordered structure in Gn-RH and the lack of any significant differences in the physical-chemical properties of the hormone analogues indicate that a predetermined solution conformation is not required for biological activity. In contrast to its behavior in water, Gn-RH in trifluoroethanol exhibits a conformational transition, with the formation of a beta structure. Differences in conformational changes exhibited by several analogues in trifluoroethanol may be relevant to their relative biological activities at the receptor site.     

Conformation of an RNA pseudoknot.

The structure of the 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' RNA oligonucleotide was investigated using biochemical and chemical probes and nuclear magnetic resonance spectroscopy. Formation of a pseudoknot is indicated by the imino proton spectrum. Imino protons are observed consistent with formation of two helical stem regions; nuclear Overhauser enhancements between imino protons show that the two stem regions stack to form a continuous helix. In the stem regions, nucleotide conformations (3'-endo, anti) and internucleotide distances, derived from two-dimensional correlated, spectroscopy and two-dimensional nuclear Overhauser effect spectra, are characteristic of A-form geometry. The data suggest minor distortion in helical stacking at the junctions of stems and loops. The model of the pseudoknot is consistent with the structure originally proposed by Pleij et al.     

Conformation of tetranactin in solution.

The conformation of tetranactin, an ionophore, in chloroform was investigated by infrared and Raman spectra and by proton and ¹³C magnetic resonances. The infrared spectra show that the structure of its K⁺ complex in the solution is quite similar to that in crystals. The proton spin–spin coupling constants are explained well by assuming that the crystalline structure is retained in solution. The spin–lattice relaxation times of the ¹³C nuclei of the K⁺ complex indicate that its framework is rigid. The correlation time of the overall reorientation of the molecule was calculated to be 9 X 10^?11 sec. On the other hand, the conformation of the complexed form in chloroform differs from that in crystals. Despite the geometrical nonequivalence of the four subunits in the crystalline state, the nuclear magnetic resonance spectra show their magnetic equivalence in the solution. The proton spin–spin coupling constants have values that are averaged by rapid internal rotation. The spin–lattice relaxation times of the ¹³C nuclei in its framework are unexplained by the overall reorientation of the molecule, and reveal the existence of internal motion in the framework. The rate of the local motion of the framework is between 10²–10¹⁰ sec^?1. By comparison of the infrared spectra, it can be said that the mean conformation of the fluctuated framework of the uncomplexed tetranactin in the solution is similar to that of nonactin in the crystalline form, which has an S₄ symmetry axis through the center of the macrocyclic ring.     

Conformation and dynamics of drug-DNA intercalation.

Molecular dynamics simulations have been undertaken for a B-form dodecanucleotide duplex in solution with and without an intercalated proflavine molecule between the central C.G base pairs. The introduction of this simple intercalator affects both the conformational features and dynamic properties of the oligonucleotide double helix. Changes are seen in the rms atomic fluctuations and anisotropy of phosphate, sugar and base atoms. The backbone conformation is slightly changed on average and more sugars adopt the C3' endo conformation in the simulation of the complex compared with the simulation of the oligonucleotide alone. Both major and minor grooves becomes wider on average with the addition of the intercalating drug. Flanking A.T base pairs on both sides of the intercalation site have undergone an increase in flexibility, with the base pairs, especially at the 5' side, having the N1...N3 hydrogen bonds being broken.     

Conformation and cooperativity in hemoglobin.

19-F and 31-P nuclear magnetic resonance (NMR) spectroscopy have been used to study the ligand binding process in human hemoglobin. 19-F nuclear magnetic resonance studies of hemoglobin specifically trifluoroacetonylated at cysteine-beta93 have permitted observation and characterization of molecular species containing two and three ligands. The behavior of these intermediate species in response to changes in pH and organic phosphate concentration is not completely consistent with any of the current theories of allostery. A model consistent with the 19-F and 31-P NMR data is proposed.     

Conformation and circular dichroism of DNA.

CD spectra of calf thymus, C. perfringens, E. coli, and M. luteus DNA have been measured in the vacuum-uv region to about 168 nm for the A-, B-, and C-forms. The positive band at about 187 nm and the negative band at about 170 nm found for each type and form of DNA are sensitive to the source of the DNA and the base–base interactions of the double-stranded helix. The A-form spectra confirm that these bands are indeed sensitive to secondary structure. In the near-uv, the CD of B-form DNA is well analyzed as a linear combination of 27% A-form and 78% C-form. However, an analysis of the extended spectrum demonstrates that the near-uv analysis is not correct. The extended analysis shows that the base–base interactions are similar for B- and C-forms in solution, which implies that these two forms have nearly the same number of base pairs per turn. Various types of CD difference spectra are also discussed.     

Conformation and spin state in methemoglobin.

The properties of human methemoglobin have been investigated under a wide variety of conditions to determine its conformation and to test for evidence of the T state conformation which has been proposed by Perutz to exist in the presence of high spin ligands and inositol hexaphosphate (IHP). Subunit dissociation was measured as a criterion for the T state since marked differences in the tetramer-dimer equilibrium exist for oxyhemoglobin (R state) and deoxyhemoglobin (T state). In the absence of IHP, complexes of methemoglobin with both high spin ligands (water, fluoride) or low spin ligands (azide, cyanide) show extensive dissociation in 2,2-bis(hydroxymethyl)-2,2',2"-nitriloethanol buffers, pH 6, 0.1 M NaCl, with values of the tetramer-dimer dissociation constant (K4,2) near 10-5 M. The addition of IHP lowers K4,2 to a value near 10-5 M for all forms of methemoglobin. Combination of IHP with methemoglobin promotes a conformational change, but the change is apparently independence of spin state. The conformation acquired in the presence of IHP is not identical with the T state (K4,2 similar to 10-12 M) and can also occur with hemoglobin in the ferrous form, as revealed by a substantial reduction in K4,2 for CO-hemoglobin upon addition of IHP. Subunit dissociation has also been measured using the haptoglobin reaction, since haptoglobin binds only to hemoglobin dimers. The haptoglobin experiments give results that are qualitatively in agreement with the conclusions reached by ultracentrifuge measurements. Similar results are also obtained by estimating the degree of dissociation on the basis of the material which aggregates following mixing with dithionite. The effect of IHP on azide-binding kinetics with methemoglobin has also been examined. Changes in reactivity is observed upon addition of IHP, but the principal effect is observed upon addition of IHP, but the principal effect is an enhancement of the rate of reaction of the beta chains. Changes in the reactivity of the beta93 sulfhydryl group of methemoglobin also accompany addition of IHP, but in a manner which is largely independent of the spin state of the iron. Similar changes are again found with CO-hemoglobin upon addition of IHP. The rate of binding of bromthymol blue also shows some changes upon addition of IHP, but the changes are more pronounced for deoxyhemoglobin than for methemoglobin. Since the results obtained did not appear to indicate a significant role for spin state in the changes observed, additional studies were undertaken using EPR spectroscopy.     

Conformation of cyclosporin A in polar solvents.

A major conformation of cyclosporin A in methanol and in aqueous methanol was revealed by some simple NMR experiments. Thus, a stepwise transition of cyclosporin A conformation from 100% CDCl3 to 100% CD3OD was followed by 1H NMR, which showed that the chloroform conformation of cyclosporin A was still the major one in methanol. Employing the same technique, it was also shown that the chloroform conformation of cyclosporin A was one of the major conformations in 50% aqueous methanol. This may be the first experimental determination of a major conformation of cyclosporin A in polar solvents.     

N-alkanes induce the synthesis of cytochrome P-450 mRNA in Candida maltosa

In the yeast Candida maltosa the level of cytochrome P-450 was 100-300-fold higher in alkane-grown cells than in glucose-grown ones (detected by a radioimmunoassay). It was shown immunochemically (1) that this was not the result of an assembly of preexisting apoenzyme with the prosthetic heme group. By cell-free translation of total poly(A)RNA in a wheat germ system and subsequent immunoprecipitation it was shown that the amount of mRNA coding for cytochrome P-450 paralleled its concentration in the cell.     

Conformation of physalaemin

The conformational and spatial configuration of the biologically active undecapeptide physalaemin was studied using 350-MHz1H NMR. The NMR analyses suggested the existence of a strong hydrogen bond between the amide proton of the Phe7 and a carbonyl group in the N-terminal moiety, most likely the Pro4 one. Other bondings were postulated, involving the side-chain amine of Lys6 and the side-chain amide of Asn5 and respectively the side-chain carboxyl of Asp3 and the terminal amide carbonyl of Met-NH2. Thus unlike its shorter peptidic fragments, physalaemin exhibited a stable molecular structure in solution, giving some insight into the conformation required for interaction at the biological receptor of tachykinins.     

Conformation of dipeptides

The amide bond in L ,L - and L ,D -α-chloropropionylalanine methyl ester is shown to be trans by molar polarization and infrared spectroscopy. In these dipeptide diastereoisomer analogues, therefore, differences in physical properties, i.e., melting points, crystalline forms, gas chromatographic mobilities, etc., depend on preferred molecular conformations and not peptide bond configuration. Nuclear magnetic resonance spectra of both compounds were identical, indicating that no major chemical environment differences exist, which might have resulted from dissimilar side group interactions. Based on the data reported here and those of others, most dipeptide conformations can be eliminated because of contradiction with limits set by experimental or theoretical considerations. Of the remaining conformational possibilities, a single pair accounts for observed physical differences in dipeptide diastereoisomers, free or blocked. The preferred form contains α-hydrogens trans to each other and in the plane of the peptide bond. In this conformation, R¹–R² and amino–carboxyl distances are minimal in L ,D diastereomers and maximal in L ,L forms.