Common and distinct regions of defective-interfering RNAs of Sindbis virus

Defective-interfering (DI) particles are helper-dependent deletion mutants which interfere specifically with the replication of the homologous standard virus. Serial passaging of alphaviruses in cultured cells leads to the accumulation of DI particles whose genomic RNAs are heterogeneous in size and sequence composition. In an effort to examine the sequence organization of an individual DI RNA species generated from Sindbis virus, we isolated and sequenced a representative cDNA clone derived from a Sindbis DI RNA population. Our data showed that: (i) the 3' end of the DI RNA template was identical to the 50 nucleotides at the 3' end of the standard RNA; (ii) the majority (75%) of the DI RNA template was derived from the 1,200 5'-terminal nucleotides of the standard RNA and included repeats of these sequences; and (iii) the 5' end of the DI RNA template was not derived from the standard RNA, but is nearly identical to a cellular tRNAAsp (S. S. Monroe and S. Schlesinger, Proc. Natl. Acad. Sci. U.S.A. 80:3279-3283, 1983). We have also utilized restriction fragments from cloned DNAs to probe by blot hybridization for the presence of conserved sequences in several independently derived DI RNA populations. These studies indicated that: (i) a 51-nucleotide conserved sequence located close to the 5' end of several alphavirus RNAs was most likely retained in the DI RNAs; (ii) the junction region containing the 5' end of the subgenomic 26S mRNA was deleted from the DI RNAs; and (iii) the presence of tRNAAsp sequences was a common occurrence in Sindbis virus DI RNAs derived by passaging in chicken embryo fibroblasts.     

Studies of defective interfering RNAs of Sindbis virus with and without tRNAAsp sequences at their 5'' termini.

Three of six independently derived defective interfering (DI) particles of Sindbis virus generated by high-multiplicity passaging in cultured cells have tRNAAsp sequences at the 5' terminus of their RNAs (Monroe and Schlesinger, J. Virol. 49:865-872, 1984). In the present work, we found that the 5'-terminal sequences of the three tRNAAsp-negative DI RNAs were all derived from viral genomic RNA. One DI RNA sample had the same 5'-terminal sequence as the standard genome. The DI RNAs from another DI particle preparation were heterogeneous at the 5' terminus, with the sequence being either that of the standard 5' end or rearrangements of regions near the 5' end. The sequence of the 5' terminus of the third DI RNA sample consisted of the 5' terminus of the subgenomic 26S mRNA with a deletion from nucleotides 24 to 67 of the 26S RNA sequence. These data showed that the 5'-terminal nucleotides can undergo extensive variations and that the RNA is still replicated by virus-specific enzymes. DI RNAs of Sindbis virus evolve from larger to smaller species. In the two cases in which we followed the evolution of DI RNAs, the appearance of tRNAAsp-positive molecules occurred at the same time as did the emergence of the smaller species of DI RNAs. In pairwise competition experiments, one of the tRNAAsp-positive DI RNAs proved to be the most effective DI RNA, but under identical conditions, a second tRNAAsp-positive DI RNA was unable to compete with the tRNAAsp-negative DIs. Therefore, the tRNAAsp sequence at the 5' terminus of a Sindbis DI RNA is not the primary factor in determining which DI RNA becomes the predominant species in a population of DI RNA molecules.     

Terminal sequences of vesicular stomatitis virus RNA are both complementary and conserved.

The nucleotide sequences at the 5' and 3' termini of RNA isolated from the New Jersey serotype of vesicular stomatitis virus [vsV(NJ)] and two of its defective interfering (DI) particles have been determined. The sequence differs from that previously demonstrated for the RNA from the Indiana serotype of VSV at only 1 of the first 17 positions from the 3' terminus and at only 2 of the first 17 positions from the 5' terminus. The 5'-terminal sequence of VSV(NJ) RNA is the complement of the 3'-terminal sequence, and duplexes which are 20 bases long and contain the 3' and 5' termini have been isolated from this RNA. The RNAs isolated from DI particles of VSV(NJ) have the same base sequences as do the RNAs from the parental virus. These results are in sharp contrast to those obtained with the Indiana serotype of VSV and its DI particles, in which the 3'-terminal sequences differ in 3 positions within the first 17. However, with both serotypes, the 3'-terminal sequence of the DI RNA is the complement of the 5'-terminal sequence of the RNA from the infectious virus. These findings suggest that the 3' and 5' RNA termini are highly conserved in both serotypes and that the 3' terminus of DI RNA is ultimately derived by copying the 5' end of the VSV genome, as recently proposed (D. Kolakofsky, M. Leppert, and L. Kort, in B. W. J. Mahy and R. D. Barry, ed., Negative-Strand Virus and the Host Cell, 1977; M. Leppert, L. Kort, and D. Kolakofsky, Cell 12:539-552, 1977; A. S. Huang, Bacteriol. Rev. 41:811-8218 1977).     

Selection of functional 5' cis-acting elements promoting efficient sindbis virus genome replication

The 5' portion of the Sindbis virus (SIN) genome RNA is multifunctional. Besides initiating translation of the nonstructural polyprotein, RNA elements in the 5' 200 bases of the SIN genome RNA, or its complement at the 3' end of the negative-strand intermediate, play key roles in the synthesis of both negative- and positive-strand RNAs. We used here a combination of genetic and biochemical approaches to further dissect the functions of this sequence. Replacement of the SIN 5' end in defective-interfering (DI) and genome RNAs with sequences from a distantly related alphavirus, Semliki Forest virus (SFV), resulted in nonviable chimeras. The addition of five nucleotides from the 5' terminus of SIN restored negative-strand RNA synthesis in DI genomes but not their replication in vivo. Pseudorevertants of various SFV-SIN chimeras were isolated, and suppressor mutations were mapped to AU-rich sequences added to the 5' end of the original SFV 5' sequence or its "deleted" versions. Early pseudorevertants had heterogeneous 5' termini that were inefficient for replication relative to the parental SIN 5' sequence. In contrast, passaging of these pseudorevertant viral populations in BHK cells under competitive conditions yielded evolved, more homogeneous 5'-terminal sequences that were highly efficient for negative-strand synthesis and replication. These 5'-terminal sequences always began with 5'-AU, followed by one or more AU repeats or short stretches of oligo(A). Further analysis demonstrated a positive correlation between the number of repeat units and replication efficiency. Interestingly, some 5' modifications restored high-level viral replication in BHK-21 cells, but these viruses were impaired for replication in the cells of mosquito origin. These studies provide new information on sequence determinants required for SIN RNA replication and suggest new strategies for restricting cell tropism and optimizing the packaging of alphavirus vectors.     

Interference among defective interfering particles of vesicular stomatitis virus

Three defective interfering (DI) particles of vesicular stomatitis virus (VSV), all derived from the same parental standard San Juan strain (Indiana serotype), were used in various combinations to infect cells together with the parental virus. The replication of their RNA genomes in the presence of other competing genomes was described by the hierarchical sequence: DI 0.52 particles greater than DI 0.45 particles less than or equal to DI-T particles greater than standard VSV. The advantage of one DI particle over another was not due simply to multiplicity effects nor to the irreversible occupation of limited cellular sites. Interference, however, did correlate with a change in the ratio of plus and minus RNA templates that accumulated intracellularly and with the presence of new sequences at the 3' end of the DI genomes. DI 0.52 particles contained significantly more nucleotides at the 3' end that were complementary to those at the 5' end of its RNA than did DI-T or DI 0.45 particles. The first 45 nucleotides at the 3' ends of all of the DI RNAs were identical. VSV and its DI particles can be separated into three classes, depending on their terminal RNA sequences. These sequences suggest two mechanisms, one based on the affinity of polymerase binding and the other on the affinity of N-protein binding, that may account for interference by DI particles against standard VSV and among DI particles themselves.     

Deletion mapping of Sindbis virus DI RNAs derived from cDNAs defines the sequences essential for replication and packaging

Defective-interfering (DI) genomes of a virus contain sequence information essential for their replication and packaging. They need not contain any coding information and therefore are a valuable tool for identifying cis-acting, regulatory sequences in a viral genome. To identify these sequences in a DI genome of Sindbis virus, we cloned a cDNA copy of a complete DI genome directly downstream of the promoter for the SP6 bacteriophage DNA dependent RNA polymerase. The cDNA was transcribed into RNA, which was transfected into chicken embryo fibroblasts in the presence of helper Sindbis virus. After one to two passages the DI RNA became the major viral RNA species in infected cells. Data from a series of deletions covering the entire DI genome show that only sequences in the 162 nucleotide region at the 5' terminus and in the 19 nucleotide region at the 3' terminus are specifically required for replication and packaging of these genomes.     

Utilization of homotypic and heterotypic proteins of vesicular stomatitis virus by defective interfering particle genomes for RNA replication and virion assembly: implications for the mechanism of homologous viral interference

Defective interfering (DI) particles of Indiana serotype of vesicular stomatitis virus (VSV(Ind)) are capable of interfering with the replication of both homotypic VSV(Ind) and heterotypic New Jersey serotype (VSV(NJ)) standard virus. In contrast, DI particles from VSV(NJ) do not interfere with the replication of VSV(Ind) standard virus but do interfere with VSV(NJ) replication. The differences in the interfering activities of VSV(Ind) DI particles and VSV(NJ) DI particles against heterotypic standard virus were investigated. We examined the utilization of homotypic and heterotypic VSV proteins by DI particle genomic RNAs for replication and maturation into infectious DI particles. Here we show that the RNA-nucleocapsid protein (N) complex of one serotype does not utilize the polymerase complex (P and L) of the other serotype for RNA synthesis, while DI particle genomic RNAs of both serotypes can utilize the N, P, and L proteins of either serotype without serotypic restriction but with differing efficiencies as long as all three proteins are derived from the same serotype. The genomic RNAs of VSV(Ind) DI particles assembled and matured into DI particles by using either homotypic or heterotypic viral proteins. In contrast, VSV(NJ) DI particles could assemble only with homotypic VSV(NJ) viral proteins, although the genomic RNAs of VSV(NJ) DI particles could be replicated by using heterotypic VSV(Ind) N, P, and L proteins. Thus, we concluded that both efficient RNA replication and assembly of DI particles are required for the heterotypic interference by VSV DI particles.     

Essential Role of Cyclization Sequences in Flavivirus RNA Replication

A possible role in RNA replication for interactions between conserved complementary (cyclization) sequences in the 5'- and 3'-terminal regions of Flavivirus RNA was previously suggested but never tested in vivo. Using the M-fold program for RNA secondary-structure predictions, we examined for the first time the base-pairing interactions between the covalently linked 5' genomic region (first ~160 nucleotides) and the 3' untranslated region (last ~115 nucleotides) for a range of mosquito-borne Flavivirus species. Base-pairing occurred as predicted for the previously proposed conserved cyclization sequences. In order to obtain experimental evidence of the predicted interactions, the putative cyclization sequences (5' or 3') in the replicon RNA of the mosquito-borne Kunjin virus were mutated either separately, to destroy base-pairing, or simultaneously, to restore the complementarity. None of the RNAs with separate mutations in only the 5' or only the 3' cyclization sequences was able to replicate after transfection into BHK cells, while replicon RNA with simultaneous compensatory mutations in both cyclization sequences was replication competent. This was detected by immunofluorescence for expression of the major nonstructural protein NS3 and by Northern blot analysis for amplification and accumulation of replicon RNA. We then used the M-fold program to analyze RNA secondary structure of the covalently linked 5'- and 3'-terminal regions of three tick-borne virus species and identified a previously undescribed additional pair of conserved complementary sequences in locations similar to those of the mosquito-borne species. They base-paired with DeltaG values of approximately -20 kcal, equivalent or greater in stability than those calculated for the originally proposed cyclization sequences. The results show that the base-pairing between 5' and 3' complementary sequences, rather than the nucleotide sequence per se, is essential for the replication of mosquito-borne Kunjin virus RNA and that more than one pair of cyclization sequences might be involved in the replication of the tick-borne Flavivirus species.     

Oligonucleotide mapping studies of standard and defective Sindbis virus RNA.

Oligonucleotide mapping studies of the RNA from standard and defective interfering particles of Sindbis virus demonstrate that 3'- and 5'-terminal regions of the genome are conserved in the defective RNAs. These studies also suggest that defective RNAs contain multiple deletions.     

Deletion mapping of a mouse hepatitis virus defective interfering RNA reveals the requirement of an internal and discontiguous sequence for replication.

All of the defective interfering (DI) RNAs of mouse hepatitis virus (MHV) contain both the 5' and 3' ends of the viral genomic RNA, which presumably include the cis sequences required for RNA replication. To define the replication signal of MHV RNA, we have used a vaccinia virus-T7 polymerase-transcribed MHV DI RNA to study the effects of sequence deletion on DI RNA replication. Following infection of susceptible cells with a recombinant vaccinia virus expressing T7 RNA polymerase, various cDNA clones derived from a DI RNA (DIssF) of the JHM strain of MHV, which is a 3.5-kb naturally occurring DI RNA, behind a T7 promoter were transfected. On superinfection with a helper MHV, the ability of various DI RNAs to replicate was determined. Serial deletions from the middle of the RNA toward both the 5' and 3' ends demonstrated that 859 nucleotides from the 5' end and 436 nucleotides from the 3' end of the MHV RNA genome were necessary for RNA replication. Surprisingly, an additional stretch of 135 nucleotides located at 3.1 to 3.3 kb from the 5' end of the genome was also required. This stretch is discontiguous from the 5'-end cis replication signal and is present in all of the naturally occurring DI RNAs studied so far. The requirement for a long stretch of 5'- and 3'-end sequences predicts that the subgenomic MHV mRNAs cannot replicate. The efficiency of RNA replication varied with different cDNA constructs, suggesting possible interaction between different regions of DI RNA. The identification of MHV RNA replication signals allowed the construction of an MHV DI-based expression vector, which can express foreign genes, such as the chloramphenicol acetyltransferase gene.     

The complete sequence of a unique RNA species synthesized by a DI particle of VSV.

The 2S RNA synthesized in vitro by the RNA polymerase of a defective interfering (DI) particle of vesicular stomatitis virus was labeled at its 3' terminus with 32P-cytidine 3', 5' bisphosphate and RNA ligase. Analysis of the labeled RNA showed that it was a family of RNAs of different length but all sharing the same 5' terminal sequence. The largest labeled RNA was purified by gel electrophoresis, and the sequence of 41 of its 46 nucleotides was determined by rapid RNA sequencing methods. The assignment of the remaining 5 nucleotides was made on the basis of an analysis of one of the smaller RNAs and published data. A new approach in RNA sequencing based on the identification of 3' terminal nucleotides of rna fragments originally present in the DI product or generated during the ligation reaction confirmed most of the sequence. The complete sequence of this 46 nucleotide long plus-sense RNA is: ppACGAAGACCACAAAACCAGAUAAAAAA UAAAAACCACAAGAGGGUC-OH. This RNA anneals to the RNA of the DI particle from which it was synthesized, indicating that its synthesis is template-specified. At least the first 17 and possibly all of the nucleotides are also complementary to sequences at the 3' end of two other VSV DI particles which were derived independently and whose genomes differ significantly in length. These data suggest a common 3' terminal sequence among all VSV DI particles which contain part of the Lgene region of the parental genome.     

Degenerate in vitro genetic selection reveals mutations that diminish alfalfa mosaic virus RNA replication without affecting coat protein binding

The alfalfa mosaic virus (AMV) RNAs are infectious only in the presence of the viral coat protein; however, the mechanisms describing coat protein's role during replication are disputed. We reasoned that mechanistic details might be revealed by identifying RNA mutations in the 3'-terminal coat protein binding domain that increased or decreased RNA replication without affecting coat protein binding. Degenerate (doped) in vitro genetic selection, based on a pool of randomized 39-mers, was used to select 30 variant RNAs that bound coat protein with high affinity. AUGC sequences that are conserved among AMV and ilarvirus RNAs were among the invariant nucleotides in the selected RNAs. Five representative clones were analyzed in functional assays, revealing diminished viral RNA expression resulting from apparent defects in replication and/or translation. These data identify a set of mutations, including G-U wobble pairs and nucleotide mismatches in the 5' hairpin, which affect viral RNA functions without significant impact on coat protein binding. Because the mutations associated with diminished function were scattered over the 3'-terminal nucleotides, we considered the possibility that RNA conformational changes rather than disruption of a precise motif might limit activity. Native polyacrylamide gel electrophoresis experiments showed that the 3' RNA conformation was indeed altered by nucleotide substitutions. One interpretation of the data is that coat protein binding to the AUGC sequences determines the orientation of the 3' hairpins relative to one another, while local structural features within these hairpins are also critical determinants of functional activity.     

The rule of six, a basic feature for efficient replication of Sendai virus defective interfering RNA.

The addition of the hepatitis delta virus genomic ribozyme to the 3' end sequence of a Sendai virus defective interfering RNA (DI-H4) allowed the reproducible and efficient replication of this RNA by the viral functions expressed from cloned genes when the DI RNA was synthesized from plasmid. Limited nucleotide additions or deletions (+7 to -7 nucleotides) in the DI RNA sequence were then made at five different sites, and the different RNA derivatives were tested for their abilities to replicate. Efficient replication was observed only when the total nucleotide number was conserved, regardless of the modifications, or when the addition of a total of 6 nucleotides was made. The replicated RNAs were shown to be properly enveloped into virus particles. It is concluded that, to form a proper template for efficient replication, the Sendai virus RNA must contain a total number of nucleotides which is a multiple of 6. This was interpreted as the need for the nucleocapsid protein to contact exactly 6 nucleotides.     

Functional equivalence of common and unique sequences in the 3' untranslated regions of alfalfa mosaic virus RNAs 1, 2, and 3.

The 3' untranslated regions (UTRs) of alfalfa mosaic virus (AMV) RNAs 1, 2, and 3 consist of a common 3'-terminal sequence of 145 nucleotides (nt) and upstream sequences of 18 to 34 nt that are unique for each RNA. The common sequence can be folded into five stem-loop structures, A to E, despite the occurrence of 22 nt differences between the three RNAs in this region. Exchange of the common sequences or full-length UTRs between the three genomic RNAs did not affect the replication of these RNAs in vivo, indicating that the UTRs are functionally equivalent. Mutations that disturbed base pairing in the stem of hairpin E reduced or abolished RNA replication, whereas compensating mutations restored RNA replication. In vitro, the 3' UTRs of the three RNAs were recognized with similar efficiencies by the AMV RNA-dependent RNA polymerase (RdRp). A deletion analysis of template RNAs indicated that a 3'-terminal sequence of 127 nt in each of the three AMV RNAs was not sufficient for recognition by the RdRp. Previously, it has been shown that this 127-nt sequence is sufficient for coat protein binding. Apparently, sequences required for recognition of AMV RNAs by the RdRp are longer than sequences required for CP binding.     

Characterization of a murine coronavirus defective interfering RNA internal cis-acting replication signal.

The mouse hepatitis virus (MHV) sequences required for replication of the JHM strain of MHV defective interfering (DI) RNA consist of three discontinuous genomic regions: about 0.47 kb from both terminal sequences and a 0.13-kb internal region present at about 0.9 kb from the 5' end of the DI genome. In this study, we investigated the role of the internal 0.13-kb region in MHV RNA replication. Overall sequences of the 0.13-kb regions from various MHV strains were similar to each other, with nucleotide substitutions in some strains; MHV-A59 was exceptional, with three nucleotide deletions. Computer-based secondary-structure analysis of the 0.13-kb region in the positive strand revealed that most of the MHV strains formed the same or a similar main stem-loop structure, whereas only MHV-A59 formed a smaller main stem-loop structure. The RNA secondary structures in the negative strands were much less uniform among the MHV strains. A series of DI RNAs that contained MHV-JHM-derived 5'- and 3'-terminal sequences plus internal 0.13-kb regions derived from various MHV strains were constructed. Most of these DI RNAs replicated in MHV-infected cells, except that MRP-A59, with a 0.13-kb region derived from MHV-A59, failed to replicate. Interestingly, replication of MRP-A59 was temperature dependent; it occurred at 39.5 degrees C but not at 37 or 35 degrees C, whereas a DI RNA with an MHV-JHM-derived 0.13-kb region replicated at all three temperatures. At 37 degrees C, synthesis of MRP-A59 negative-strand RNA was detected in MHV-infected and MRP-A59 RNA-transfected cells. Another DI RNA with the internal 0.13-kb region deleted also synthesized negative-strand RNA in MHV-infected cells. MRP-A59-transfected cells were shifted from 39.5 to 37 degrees C at 5.5 h postinfection, a time when most MHV negative-strand RNAs have already accumulated; after the shift, MRP-A59 positive-strand RNA synthesis ceased. The minimum sequence required for maintenance of the positive-strand major stem-loop structure and biological function of the MHV-JHM 0.13-kb region was about 57 nucleotides. Function was lost in the 50-nucleotide sequence that formed a positive-strand stem-loop structure identical to that of MHV-A59. These studies suggested that the RNA structure made by the internal sequence was important for positive-strand MHV RNA synthesis.